Melatonin-Nrf2 Signaling Activates Peroxisomal Activities in Porcine Cumulus Cell-Oocyte Complexes
Abstract
1. Introduction
2. Materials and Methods
2.1. Research Ethics and Chemicals
2.2. COC Retrieval and In Vitro Maturation (IVM)
2.3. Cumulus Cell Expansion Assessment
2.4. Parthenogenetic Activation (PA)
2.5. Embryo Evaluation and Total Cell Count after PA
2.6. Immunofluorescence Staining
2.7. ATP Content Assay
2.8. Measurement of Intracellular Glutathione (GSH) and Reactive Oxygen Species (ROS) Levels
2.9. mRNA Sequencing
2.10. Analysis of Gene Expression by Quantitative Real-Time PCR
2.11. Western Blotting
2.12. Statistical Analysis
3. Results
3.1. Optimization of Brusatol Concentration and Subsequent Co-Treatment with Melatonin
3.2. Effects of Melatonin on Oocyte Maturation and Subsequent Embryo Development
3.3. ATP Production, GSH/ROS Levels, and Gene Expression Patterns in COCs
3.4. Analysis from DEG and Gene Ontology (GO) Term in Porcine COCs
3.5. Gene and Protein Expression Related to Melatonin-Nrf2 Signaling and Peroxisome Mechanism
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Stehle, J.H.; Saade, A.; Rawashdeh, O.; Ackermann, K.; Jilg, A.; Sebesteny, T.; Maronde, E. A survey of molecular details in the human pineal gland in the light of phylogeny, structure, function and chronobiological diseases. J. Pineal Res. 2011, 51, 17–43. [Google Scholar] [CrossRef] [PubMed]
- MacPhee, A.A.; Cole, F.E.; Rice, B.F. The effect of melatonin on steroidogenesis by the human ovary in vitro. J. Clin. Endocrinol. Metab. 1975, 40, 688–696. [Google Scholar] [CrossRef] [PubMed]
- Tamarkin, L.; Baird, C.J.; Almeida, O.F. Melatonin: A coordinating signal for mammalian reproduction? Science 1985, 227, 714–720. [Google Scholar] [CrossRef]
- Nguyen, T.; Nioi, P.; Pickett, C.B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. J. Biol. Chem. 2009, 284, 13291–13295. [Google Scholar] [CrossRef] [PubMed]
- Reiter, R.J.; Mayo, J.C.; Tan, D.X.; Sainz, R.M.; Alatorre-Jimenez, M.; Qin, L. Melatonin as an antioxidant: Under promises but over delivers. J. Pineal. Res. 2016, 61, 253–278. [Google Scholar] [CrossRef]
- Sanchez-Barcelo, E.J.; Mediavilla, M.D.; Tan, D.X.; Reiter, R.J. Clinical uses of melatonin: Evaluation of human trials. Curr. Med. Chem. 2010, 17, 2070–2095. [Google Scholar] [CrossRef]
- Liang, S.; Jin, Y.X.; Yuan, B.; Zhang, J.B.; Kim, N.H. Melatonin enhances the developmental competence of porcine somatic cell nuclear transfer embryos by preventing DNA damage induced by oxidative stress. Sci. Rep. 2017, 7, 11114. [Google Scholar] [CrossRef] [PubMed]
- Kim, E.H.; Kim, G.A.; Taweechaipaisankul, A.; Lee, S.H.; Muhammad, Q.; Ahn, C.; Lee, B.C. Melatonin enhances porcine embryo development via the Nrf2/ARE signaling pathway. J. Mol. Endocrinol. 2019, 63, 175–185. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Jin, J.X.; Taweechaipaisankul, A.; Kim, G.A.; Ahn, C.; Lee, B.C. Melatonin influences the sonic hedgehog signaling pathway in porcine cumulus oocyte complexes. J. Pineal Res. 2017, 63. [Google Scholar] [CrossRef] [PubMed]
- Jin, J.X.; Lee, S.; Taweechaipaisankul, A.; Kim, G.A.; Lee, B.C. Melatonin regulates lipid metabolism in porcine oocytes. J. Pineal Res. 2017, 62. [Google Scholar] [CrossRef] [PubMed]
- Shah, S.A.; Khan, M.; Jo, M.H.; Jo, M.G.; Amin, F.U.; Kim, M.O. Melatonin Stimulates the SIRT1/Nrf2 Signaling Pathway Counteracting Lipopolysaccharide (LPS)-Induced Oxidative Stress to Rescue Postnatal Rat Brain. CNS. Neurosci. Ther. 2017, 23, 33–44. [Google Scholar] [CrossRef]
- Trivedi, P.P.; Jena, G.B.; Tikoo, K.B.; Kumar, V. Melatonin modulated autophagy and Nrf2 signaling pathways in mice with colitis-associated colon carcinogenesis. Mol. Carcinog. 2016, 55, 255–267. [Google Scholar] [CrossRef]
- Sykiotis, G.P.; Habeos, I.G.; Samuelson, A.V.; Bohmann, D. The role of the antioxidant and longevity-promoting Nrf2 pathway in metabolic regulation. Curr. Opin. Clin. Nutr. Metab. Care. 2011, 14, 41–48. [Google Scholar] [CrossRef]
- Lee, J.M.; Johnson, J.A. An important role of Nrf2-ARE pathway in the cellular defense mechanism. J. Biochem. Mol. Biol. 2004, 37, 139–143. [Google Scholar] [CrossRef]
- Wells, G. Peptide and small molecule inhibitors of the Keap1-Nrf2 protein-protein interaction. Biochem. Soc. Trans. 2015, 43, 674–679. [Google Scholar] [CrossRef]
- Amin, A.; Gad, A.; Salilew-Wondim, D.; Prastowo, S.; Held, E.; Hoelker, M.; Rings, F.; Tholen, E.; Neuhoff, C.; Looft, C.; et al. Bovine embryo survival under oxidative-stress conditions is associated with activity of the NRF2-mediated oxidative-stress-response pathway. Mol. Reprod. Dev. 2014, 81, 497–513. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.; Sui, L.C.; Wu, R.H.; Ma, R.J.; Fu, H.Y.; Xu, J.J.; Qiu, X.H.; Chen, L. Nrf2 inhibition affects cell cycle progression during early mouse embryo development. J. Reprod. Dev. 2018, 64, 49–55. [Google Scholar] [CrossRef]
- Kansanen, E.; Kuosmanen, S.M.; Leinonen, H.; Levonen, A.L. The Keap1-Nrf2 pathway: Mechanisms of activation and dysregulation in cancer. Redox. Biol. 2013, 1, 45–49. [Google Scholar] [CrossRef]
- Ma, Q. Role of nrf2 in oxidative stress and toxicity. Annu. Rev. Pharmacol. Toxicol. 2013, 53, 401–426. [Google Scholar] [CrossRef]
- Olayanju, A.; Copple, I.M.; Bryan, H.K.; Edge, G.T.; Sison, R.L.; Wong, M.W.; Lai, Z.Q.; Lin, Z.X.; Dunn, K.; Sanderson, C.M.; et al. Brusatol provokes a rapid and transient inhibition of Nrf2 signaling and sensitizes mammalian cells to chemical toxicity-implications for therapeutic targeting of Nrf2. Free Radic. Biol. Med. 2015, 78, 202–212. [Google Scholar] [CrossRef]
- Ren, D.; Villeneuve, N.F.; Jiang, T.; Wu, T.; Lau, A.; Toppin, H.A.; Zhang, D.D. Brusatol enhances the efficacy of chemotherapy by inhibiting the Nrf2-mediated defense mechanism. Proc. Natl. Acad. Sci. USA 2011, 108, 1433–1438. [Google Scholar] [CrossRef]
- Lee, C. Collaborative Power of Nrf2 and PPARgamma Activators against Metabolic and Drug-Induced Oxidative Injury. Oxid. Med. Cell. Longev. 2017, 2017, 1378175. [Google Scholar] [CrossRef]
- Cho, H.Y.; Gladwell, W.; Wang, X.; Chorley, B.; Bell, D.; Reddy, S.P.; Kleeberger, S.R. Nrf2-regulated PPAR{gamma} expression is critical to protection against acute lung injury in mice. Am. J. Respir. Crit. Care Med. 2010, 182, 170–182. [Google Scholar] [CrossRef]
- Polvani, S.; Tarocchi, M.; Galli, A. PPARgamma and Oxidative Stress: Con(beta) Catenating NRF2 and FOXO. PPAR Res. 2012, 2012, 641087. [Google Scholar] [CrossRef]
- Gabaldon, T. Peroxisome diversity and evolution. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2010, 365, 765–773. [Google Scholar] [CrossRef]
- Antonenkov, V.D.; Grunau, S.; Ohlmeier, S.; Hiltunen, J.K. Peroxisomes are oxidative organelles. Antioxid. Redox Signal. 2010, 13, 525–537. [Google Scholar] [CrossRef]
- Walton, P.A.; Pizzitelli, M. Effects of peroxisomal catalase inhibition on mitochondrial function. Front. Physiol. 2012, 3, 108. [Google Scholar] [CrossRef] [PubMed]
- Fransen, M.; Lismont, C.; Walton, P. The Peroxisome-Mitochondria Connection: How and Why? Int. J. Mol. Sci. 2017, 18, 1126. [Google Scholar] [CrossRef]
- Vazquez, J.; Grillitsch, K.; Daum, G.; Mas, A.; Torija, M.J.; Beltran, G. Melatonin Minimizes the Impact of Oxidative Stress Induced by Hydrogen Peroxide in Saccharomyces and Non-conventional Yeast. Front. Microbiol. 2018, 9, 1933. [Google Scholar] [CrossRef]
- Farr, R.L.; Lismont, C.; Terlecky, S.R.; Fransen, M. Peroxisome biogenesis in mammalian cells: The impact of genes and environment. Biochim. Biophys. Acta. 2016, 1863, 1049–1060. [Google Scholar] [CrossRef]
- Lee, S.H.; Oh, H.J.; Kim, M.J.; Setyawan, E.M.N.; Lee, B.C. Interaction of the EGFR signaling pathway with porcine cumulus oocyte complexes and oviduct cells in a coculture system. J. Cell. Physiol. 2019, 234, 4030–4043. [Google Scholar] [CrossRef]
- Vanderhyden, B.C.; Caron, P.J.; Buccione, R.; Eppig, J.J. Developmental pattern of the secretion of cumulus expansion-enabling factor by mouse oocytes and the role of oocytes in promoting granulosa cell differentiation. Dev. Biol. 1990, 140, 307–317. [Google Scholar] [CrossRef]
- Jin, J.X.; Lee, S.; Khoirinaya, C.; Oh, A.; Kim, G.A.; Lee, B.C. Supplementation with spermine during in vitro maturation of porcine oocytes improves early embryonic development after parthenogenetic activation and somatic cell nuclear transfer. J. Anim. Sci. 2016, 94, 963–970. [Google Scholar] [CrossRef] [PubMed]
- Lolicato, F.; Brouwers, J.F.; de Lest, C.H.; Wubbolts, R.; Aardema, H.; Priore, P.; Roelen, B.A.; Helms, J.B.; Gadella, B.M. The cumulus cell layer protects the bovine maturing oocyte against fatty acid-induced lipotoxicity. Biol. Reprod. 2015, 92, 16. [Google Scholar] [CrossRef]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef]
- Pertea, M.; Kim, D.; Pertea, G.M.; Leek, J.T.; Salzberg, S.L. Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nat. Protoc. 2016, 11, 1650–1667. [Google Scholar] [CrossRef]
- Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.C.; Mendell, J.T.; Salzberg, S.L. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [PubMed]
- Raudvere, U.; Kolberg, L.; Kuzmin, I.; Arak, T.; Adler, P.; Peterson, H.; Vilo, J. g:Profiler: A web server for functional enrichment analysis and conversions of gene lists (2019 update). Nucleic Acids Res. 2019, 47, W191–W198. [Google Scholar] [CrossRef]
- Lee, S.; Jin, J.X.; Taweechaipaisankul, A.; Kim, G.A.; Lee, B.C. Stimulatory Effects of Melatonin on Porcine In Vitro Maturation Are Mediated by MT2 Receptor. Int. J. Mol. Sci. 2018, 19, 1581. [Google Scholar] [CrossRef]
- Park, H.J.; Park, J.Y.; Kim, J.W.; Yang, S.G.; Jung, J.M.; Kim, M.J.; Kang, M.J.; Cho, Y.H.; Wee, G.; Yang, H.Y.; et al. Melatonin improves the meiotic maturation of porcine oocytes by reducing endoplasmic reticulum stress during in vitro maturation. J. Pineal Res. 2018, 64. [Google Scholar] [CrossRef]
- Mayo, J.C.; Aguado, A.; Cernuda-Cernuda, R.; Alvarez-Artime, A.; Cepas, V.; Quiros-Gonzalez, I.; Hevia, D.; Sainz, R.M. Melatonin Uptake by Cells: An Answer to Its Relationship with Glucose? Molecules 2018, 23, 1999. [Google Scholar] [CrossRef]
- Reppert, S.M. Melatonin receptors: Molecular biology of a new family of G protein-coupled receptors. J. Biol. Rhythms. 1997, 12, 528–531. [Google Scholar] [CrossRef]
- Cho, M.K.; Kim, W.D.; Ki, S.H.; Hwang, J.I.; Choi, S.; Lee, C.H.; Kim, S.G. Role of Galpha12 and Galpha13 as novel switches for the activity of Nrf2, a key antioxidative transcription factor. Mol. Cell. Biol. 2007, 27, 6195–6208. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kwak, S.S.; Yoon, J.D.; Cheong, S.A.; Jeon, Y.; Lee, E.; Hyun, S.H. The new system of shorter porcine oocyte in vitro maturation (18 hours) using >/=8 mm follicles derived from cumulus-oocyte complexes. Theriogenology 2014, 81, 291–301. [Google Scholar] [CrossRef]
- Ma, R.; Li, H.; Zhang, Y.; Lin, Y.; Qiu, X.; Xie, M.; Yao, B. The toxic effects and possible mechanisms of Brusatol on mouse oocytes. PLoS ONE 2017, 12, e0177844. [Google Scholar] [CrossRef]
- Belli, M.; Shimasaki, S. Molecular Aspects and Clinical Relevance of GDF9 and BMP15 in Ovarian Function. Vitam. Horm. 2018, 107, 317–348. [Google Scholar] [CrossRef]
- Li, Y.; Wang, J.; Zhang, Z.; Yi, J.; He, C.; Wang, F.; Tian, X.; Yang, M.; Song, Y.; He, P.; et al. Resveratrol compares with melatonin in improving in vitro porcine oocyte maturation under heat stress. J. Anim. Sci. Biotechnol. 2016, 7, 33. [Google Scholar] [CrossRef]
- Yang, L.; Wang, Q.; Cui, M.; Li, Q.; Mu, S.; Zhao, Z. Effect of Melatonin on the In Vitro Maturation of Porcine Oocytes, Development of Parthenogenetically Activated Embryos, and Expression of Genes Related to the Oocyte Developmental Capability. Animals 2020, 10, 209. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.M.; Wang, N.; Hao, H.S.; Li, C.Y.; Zhao, Y.H.; Yan, C.L.; Wang, H.Y.; Du, W.H.; Wang, D.; Liu, Y.; et al. Melatonin improves the fertilization capacity and developmental ability of bovine oocytes by regulating cytoplasmic maturation events. J. Pineal Res. 2018, 64, e12445. [Google Scholar] [CrossRef] [PubMed]
- Guerin, P.; El Mouatassim, S.; Menezo, Y. Oxidative stress and protection against reactive oxygen species in the pre-implantation embryo and its surroundings. Hum. Reprod. Update 2001, 7, 175–189. [Google Scholar] [CrossRef]
- Jansen, G.A.; Wanders, R.J. Alpha-oxidation. Biochim. Biophys. Acta 2006, 1763, 1403–1412. [Google Scholar] [CrossRef]
- Wanders, R.J.; Jansen, G.A.; Skjeldal, O.H. Refsum disease, peroxisomes and phytanic acid oxidation: A review. J. Neuropathol. Exp. Neurol. 2001, 60, 1021–1031. [Google Scholar] [CrossRef]
- Dunning, K.R.; Cashman, K.; Russell, D.L.; Thompson, J.G.; Norman, R.J.; Robker, R.L. Beta-oxidation is essential for mouse oocyte developmental competence and early embryo development. Biol. Reprod. 2010, 83, 909–918. [Google Scholar] [CrossRef] [PubMed]
- Dunning, K.R.; Russell, D.L.; Robker, R.L. Lipids and oocyte developmental competence: The role of fatty acids and beta-oxidation. Reproduction 2014, 148, R15–R27. [Google Scholar] [CrossRef]
- Agrawal, G.; Shang, H.H.; Xia, Z.J.; Subramani, S. Functional regions of the peroxin Pex19 necessary for peroxisome biogenesis. J. Biol. Chem. 2017, 292, 11547–11560. [Google Scholar] [CrossRef] [PubMed]
- You, L.; Chen, J.; Liu, W.; Xiang, Q.; Luo, Z.; Wang, W.; Xu, W.; Wu, K.; Zhang, Q.; Liu, Y.; et al. Enterovirus 71 induces neural cell apoptosis and autophagy through promoting ACOX1 downregulation and ROS generation. Virulence 2020, 11, 537–553. [Google Scholar] [CrossRef]
- Schrader, M.; Fahimi, H.D. Peroxisomes and oxidative stress. Biochim. Biophys. Acta 2006, 1763, 1755–1766. [Google Scholar] [CrossRef]
- Sacksteder, K.A.; Jones, J.M.; South, S.T.; Li, X.; Liu, Y.; Gould, S.J. PEX19 binds multiple peroxisomal membrane proteins, is predominantly cytoplasmic, and is required for peroxisome membrane synthesis. J. Cell Biol. 2000, 148, 931–944. [Google Scholar] [CrossRef]
- Miller, C.J.; Gounder, S.S.; Kannan, S.; Goutam, K.; Muthusamy, V.R.; Firpo, M.A.; Symons, J.D.; Paine, R., 3rd; Hoidal, J.R.; Rajasekaran, N.S. Disruption of Nrf2/ARE signaling impairs antioxidant mechanisms and promotes cell degradation pathways in aged skeletal muscle. Biochim. Biophys. Acta 2012, 1822, 1038–1050. [Google Scholar] [CrossRef]
- Yang, T.; Zhao, Z.; Liu, T.; Zhang, Z.; Wang, P.; Xu, S.; Lei, X.G.; Shan, A. Oxidative stress induced by Se-deficient high-energy diet implicates neutrophil dysfunction via Nrf2 pathway suppression in swine. Oncotarget 2017, 8, 13428–13439. [Google Scholar] [CrossRef] [PubMed][Green Version]








| Genes | Primer Sequences (5′–3′) | Product Size (bp) | Accession No. |
|---|---|---|---|
| GAPDH | F: GTCGGTTGTGGATCTGACCT R: TTGACGAAGTGGTCGTTGAG | 207 | NM_001206359 |
| MT2 | F: AGCTGCCTTAACGCCATCAT R: ATTGTCGCCCAGTCAGTGAG | 219 | XM 021063941.1 |
| catalase | F: AGGGAGAGGCGGTTTATTGC R: GGACTCGTTGGTGAAGCTCA | 117 | NM_214301.2 |
| NRF2 | F: GCCCAGTCTTCATTGCTCCT R: AGCTCCTCCCAAACTTGCTC | 115 | XM_013984303 |
| PEX3 | F: AATGCATCTTCCTGGGGACG R: ATACTGTCGTCGTGCTTGGG | 125 | NM_001244185.1 |
| PEX5 | F: CAGGCGGAGAATGAGCAAGA R: GGACTCGTTGGTGAAGCTCA | 117 | XM_013988424.2 |
| PEX19 | F: CCAGCACTTCACCCATCAGT R: TAGACGACACTCCTGCCTCA | 144 | XM_001928869.5 |
| PPARγ | F: CTCAATCTATCGGGCCCACC R: TTTATCCCCACAGACACGGC | 192 | XM_005669783.3 |
| PHYH | F: CCCTTCAGGCCCAGCAATAA R: GCCTTTGTGAGTTCCTGGGA | 102 | NM_001113447.1 |
| BAX | F: CATGAAGACAGGGGCCCTTT R: CATCCTCTGCAGCTCCATGT | 181 | XM_003127290 |
| BCL2 | F: AATGTCTCAGAGCAACCGGG R: GGGGCCTCAGTTCTGTTCTC | 193 | NM_214285 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, E.H.; Ridlo, M.R.; Lee, B.C.; Kim, G.A. Melatonin-Nrf2 Signaling Activates Peroxisomal Activities in Porcine Cumulus Cell-Oocyte Complexes. Antioxidants 2020, 9, 1080. https://doi.org/10.3390/antiox9111080
Kim EH, Ridlo MR, Lee BC, Kim GA. Melatonin-Nrf2 Signaling Activates Peroxisomal Activities in Porcine Cumulus Cell-Oocyte Complexes. Antioxidants. 2020; 9(11):1080. https://doi.org/10.3390/antiox9111080
Chicago/Turabian StyleKim, Eui Hyun, Muhammad Rosyid Ridlo, Byeong Chun Lee, and Geon A. Kim. 2020. "Melatonin-Nrf2 Signaling Activates Peroxisomal Activities in Porcine Cumulus Cell-Oocyte Complexes" Antioxidants 9, no. 11: 1080. https://doi.org/10.3390/antiox9111080
APA StyleKim, E. H., Ridlo, M. R., Lee, B. C., & Kim, G. A. (2020). Melatonin-Nrf2 Signaling Activates Peroxisomal Activities in Porcine Cumulus Cell-Oocyte Complexes. Antioxidants, 9(11), 1080. https://doi.org/10.3390/antiox9111080

