Transcriptomic Insights into the Effect of Melatonin in Saccharomyces cerevisiae in the Presence and Absence of Oxidative Stress
Abstract
1. Introduction
2. Materials and Methods
2.1. Yeast Strain and Experimental Conditions
2.2. Intracellular Melatonin Quantification
2.3. Assessment of Global Gene Expression by Microarray Analysis
Microarray Data Analysis
2.4. Gene Expression by qPCR Analysis
2.5. Analysis of Sterols, Fatty Acids and Phospholipids
2.6. Quantification of Mitochondria
2.7. Data Analysis
3. Results and Discussion
3.1. Differential Gene Expression Profiling
3.2. Classification of Differentially Expressed Genes into Functional Categories
3.3. Effect of Melatonin on Transport and Membrane Composition
3.3.1. Intracellular Melatonin
3.3.2. Physiological Changes in the Lipid Composition
3.4. Response to Oxidative Stress
3.5. Effect of Melatonin on the Mitochondria
3.5.1. Gene Validation
3.5.2. Physiological Effect of Melatonin in Mitochondria
3.6. Effect of Melatonin on Cell Signaling
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Lerner, A.B.; Case, J.D.; Takahashi, Y.; Lee, T.H.; Mori, W. Isolation of melatonin, the pineal gland factor that Lightens melanocytes. J. Am. Chem. Soc. 1958, 80, 2587. [Google Scholar] [CrossRef]
- Hardeland, R.; Poeggeler, B. Non-vertebrate melatonin. J. Pineal Res. 2003, 34, 233–241. [Google Scholar] [CrossRef] [PubMed]
- Romero, A.; Ramos, E.; Ríos, C.D.L.; Egea, J.; Del Pino, J.; Reiter, R.J. A review of metal-catalyzed molecular damage: Protection by melatonin. J. Pineal Res. 2014, 56, 343–370. [Google Scholar] [CrossRef] [PubMed]
- Eghbal, M.A.; Eftekhari, A.; Ahmadian, E.; Azarmi, Y.; Parvizpur, A. A review of biological and pharmacological actions of melatonin: oxidant and prooxidant properties. Pharm. Bioprocess. 2016, 4, 069–081. [Google Scholar] [CrossRef]
- Sprenger, J.; Hardeland, R.; Fuhrberg, B.; Han, S.-Z. Melatonin and other 5-methoxylated indoles in yeast: presence in high concentrations and dependence on tryptophan availability. Cytologia 1999, 64, 209–213. [Google Scholar] [CrossRef]
- Rodriguez-Naranjo, M.I.; Gil-Izquierdo, A.; Troncoso, A.M.; Cantos-Villar, E.; Garcia-Parrilla, M.C. Melatonin is synthesised by yeast during alcoholic fermentation in wines. Food Chem. 2011, 126, 1608–1613. [Google Scholar] [CrossRef]
- Rodriguez-Naranjo, M.I.; Torija, M.-J.; Mas, A.; Cantos-Villar, E.; Garcia-Parrilla, M.C. Production of melatonin by Saccharomyces strains under growth and fermentation conditions. J. Pineal Res. 2012, 53, 219–224. [Google Scholar] [CrossRef]
- Vigentini, I.; Gardana, C.; Fracassetti, D.; Gabrielli, M.; Foschino, R.; Simonetti, P.; Tirelli, A.; Iriti, M. Yeast contribution to melatonin, melatonin isomers and tryptophan ethyl ester during alcoholic fermentation of grape musts. J. Pineal Res. 2015, 58, 388–396. [Google Scholar] [CrossRef]
- Fernandez-Cruz, E.; Álvarez-Fernández, M.; Valero, E.; Troncoso, A.M.; Garcia-Parrilla, M.C. Melatonin and derived l-tryptophan metabolites produced during alcoholic fermentation by different wine yeast strains. Food Chem. 2017, 217, 431–437. [Google Scholar] [CrossRef]
- Fernandez-Cruz, E.; Cerezo, A.B.; Cantos-Villar, E.; Troncoso, A.M.; Garcia-Parrilla, M.C. Time course of l -tryptophan metabolites when fermenting natural grape musts: Effect of inoculation treatments and cultivar on the occurrence of melatonin and related indolic compounds. Aust. J. Grape Wine Res. 2018, 25, 92–100. [Google Scholar] [CrossRef]
- Fernandez-Cruz, E.; González, B.; Muñiz-Calvo, S.; Morcillo-Parra, M.Á.; Bisquert, R.; Troncoso, A.M.; Garcia-Parrilla, M.C.; Torija, M.-J.; Guillamón, J.M. Intracellular biosynthesis of melatonin and other indolic compounds in Saccharomyces and non-Saccharomyces wine yeasts. Eur. Food Res. Technol. 2019, 245, 1553–1560. [Google Scholar] [CrossRef]
- Valera, M.J.; Morcillo-Parra, M.Á.; Zagórska, I.; Mas, A.; Beltran, G.; Torija, M.-J. Effects of melatonin and tryptophol addition on fermentations carried out by Saccharomyces cerevisiae and non-Saccharomyces yeast species under different nitrogen conditions. Int. J. Food Microbiol. 2019, 289, 174–181. [Google Scholar] [CrossRef] [PubMed]
- Muñiz-Calvo, S.; Bisquert, R.; Fernandez-Cruz, E.; García-Parrilla, M.C.; Guillamón, J.M. Deciphering the melatonin metabolism in Saccharomyces cerevisiae by the bioconversion of related metabolites. J. Pineal Res. 2019, 66, e12554. [Google Scholar] [CrossRef] [PubMed]
- Bisquert, R.; Muñiz-Calvo, S.; Guillamón, J.M. Protective role of intracellular melatonin against oxidative stress and UV radiation in Saccharomyces cerevisiae. Front. Microbiol. 2018, 9, 318. [Google Scholar] [CrossRef] [PubMed]
- Vázquez, J.; Grillitsch, K.; Daum, G.; Mas, A.; Torija, M.-J.; Beltran, G. Melatonin minimizes the impact of oxidative stress induced by hydrogen peroxide in Saccharomyces and non-conventional yeast. Front. Microbiol. 2018, 9, 1933. [Google Scholar] [CrossRef]
- Vázquez, J.; González, B.; Sempere, V.; Mas, A.; Torija, M.J.; Beltran, G. Melatonin reduces oxidative stress damage induced by hydrogen peroxide in Saccharomyces cerevisiae. Front. Microbiol. 2017, 8, 1066. [Google Scholar] [CrossRef]
- Morcillo-Parra, M.Á.; Valera, M.J.; Beltran, G.; Mas, A.; Torija, M.-J. Glycolytic proteins interact with intracellular melatonin in Saccharomyces cerevisiae. Front. Microbiol. 2019, 10, 2424. [Google Scholar] [CrossRef]
- Morcillo-Parra, M.Á.; González, B.; Beltran, G.; Mas, A.; Torija, M.-J. Melatonin and glycolytic protein interactions are related to yeast fermentative capacity. Food Microbiol. 2020, 87, 103398. [Google Scholar] [CrossRef]
- Moradas-Ferreira, P.; Costa, V. Adaptive response of the yeast Saccharomyces cerevisiae to reactive oxygen species: Defences, damage and death. Redox Rep. 2000, 5, 277–285. [Google Scholar] [CrossRef]
- Costa, V. Oxidative stress and signal transduction in Saccharomyces cerevisiae: Insights into ageing, apoptosis and diseases. Mol. Asp. Med. 2001, 22, 217–246. [Google Scholar] [CrossRef]
- Jamieson, D.J. Oxidative stress responses of the yeast Saccharomyces cerevisiae. Yeast 1998, 14, 1511–1527. [Google Scholar] [CrossRef]
- Cardinali, D.P.; Vigo, D.E. Melatonin, mitochondria, and the metabolic syndrome. Cell. Mol. Life Sci. 2017, 74, 3941–3954. [Google Scholar] [CrossRef]
- Reiter, R.J.; Ma, Q.; Sharma, R. Melatonin in Mitochondria: Mitigating Clear and Present Dangers. Physiology 2020, 35, 86–95. [Google Scholar] [CrossRef] [PubMed]
- Zampol, M.A.; Barros, M.H. Melatonin improves survival and respiratory activity of yeast cells challenged by alpha-synuclein and menadione. Yeast 2017, 35, 281–290. [Google Scholar] [CrossRef] [PubMed]
- Causton, H.C.; Ren, B.; Koh, S.S.; Harbison, C.T.; Kanin, E.; Jennings, E.G.; Lee, T.I.; True, H.L.; Lander, E.S.; Young, R.A. Remodeling of yeast genome expression in response to environmental changes. Mol. Boil. Cell 2001, 12, 323–337. [Google Scholar] [CrossRef] [PubMed]
- Thorpe, G.W.; Fong, C.S.; Alic, N.; Higgins, V.J.; Dawes, I.W. Cells have distinct mechanisms to maintain protection against different reactive oxygen species: Oxidative-stress-response genes. Proc. Natl. Acad. Sci. USA 2004, 101, 6564–6569. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Chen, J.; Liu, J.; Han, B. Transcriptome analysis reveals the oxidative stress response in Saccharomyces cerevisiae. RSC Adv. 2015, 5, 22923–22934. [Google Scholar] [CrossRef]
- Gonzalez, B.; François, J.; Renaud, M. A rapid and reliable method for metabolite extraction in yeast using boiling buffered ethanol. Yeast 1997, 13, 1347–1355. [Google Scholar] [CrossRef]
- De Maeyer, D.; Weytjens, B.; Renkens, J.; De Raedt, L.; Marchal, K. PheNetic: Network-based interpretation of molecular profiling data. Nucleic Acids Res. 2015, 43, W244–W250. [Google Scholar] [CrossRef]
- Carbon, S.; Ireland, A.; Mungall, C.J.; Shu, S.; Marshall, B.; Lewis, S. AmiGO: Online access to ontology and annotation data. Bioinformatics 2008, 25, 288–289. [Google Scholar] [CrossRef]
- Kanehisa, M.; Goto, S.; Kawashima, S.; Nakaya, A. The KEGG databases at GenomeNet. Nucleic Acids Res. 2002, 30, 42–46. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Bioinformatics enrichment tools: Paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 2008, 37, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef] [PubMed]
- Beltran, G.; Novo, M.; Rozès, N.; Mas, A.; Guillamón, J.M. Nitrogen catabolite repression in during wine fermentations. FEMS Yeast Res. 2004, 4, 625–632. [Google Scholar] [CrossRef] [PubMed]
- Teste, M.-A.; Duquenne, M.; François, J.M.; Parrou, J.-L. Validation of reference genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces cerevisiae. BMC Mol. Boil. 2009, 10, 99. [Google Scholar] [CrossRef]
- Vázquez, J.; Grillitsch, K.; Daum, G.; Mas, A.; Beltran, G.; Torija, M.J. The role of the membrane lipid composition in the oxidative stress tolerance of different wine yeasts. Food Microbiol. 2019, 78, 143–154. [Google Scholar] [CrossRef]
- Folch, J.; Lees, M.; Sloane Stanley, G.H. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef]
- Quail, M.A.; Kelly, S.L.; Evans, I.H. The extraction and analysis of sterols from yeast. In Yeast Protocols. Methods in Molecular Biology; Evans, I.H., Ed.; Humana Press: New York, NY, USA, 1996; Volume 53, pp. 123–132. [Google Scholar]
- Rußmayer, H.; Buchetics, M.; Gruber, C.; Valli, M.; Grillitsch, K.; Modarres, G.; Guerrasio, R.; Klavins, K.; Neubauer, S.; Drexler, H.; et al. Systems-level organization of yeast methylotrophic lifestyle. BMC Boil. 2015, 13, 80. [Google Scholar] [CrossRef]
- Athenstaedt, K.; Zweytick, D.; Jandrositz, A.; Kohlwein, S.D.; Daum, G. Identification and characterization of major lipid Particle Proteins of the Yeast Saccharomyces cerevisiae. J. Bacteriol. 1999, 181, 6441–6448. [Google Scholar] [CrossRef]
- Broekhuyse, R. Phospholipids in tissues of the eye I. Isolation, characterization and quantitative analysis by two-dimensional thin-layer chromatography of diacyl and vinyl-ether phospholipids. Biochim. Biophys. Acta 1968, 152, 307–315. [Google Scholar] [CrossRef]
- Boettiger, D.; Huber, F.; Lynch, L.; Blystone, S. Activation of αvβ3-Vitronectin Binding Is a Multistage Process in which Increases in Bond Strength Are Dependent on Y747 and Y759 in the Cytoplasmic Domain of β3. Mol. Boil. Cell 2001, 12, 1227–1237. [Google Scholar] [CrossRef]
- Slominski, R.M.; Reiter, R.J.; Schlabritz-Loutsevitch, N.; Ostrom, R.S.; Slominski, A.T. Melatonin membrane receptors in peripheral tissues: Distribution and functions. Mol. Cell. Endocrinol. 2012, 351, 152–166. [Google Scholar] [CrossRef] [PubMed]
- Galano, A.; Tan, D.X.; Reiter, R.J. Melatonin as a natural ally against oxidative stress: A physicochemical examination. J. Pineal Res. 2011, 51, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Hevia, D.; Gonzalez-Menendez, P.; Quirós-Gonzalez, I.; Miar, A.; Rodriguez-Garcia, A.; Tan, D.-X.; Reiter, R.J.; Mayo, J.C.; Sainz, R.M. Melatonin uptake through glucose transporters: A new target for melatonin inhibition of cancer. J. Pineal Res. 2015, 58, 234–250. [Google Scholar] [CrossRef] [PubMed]
- Huo, X.; Wang, C.; Yu, Z.; Peng, Y.; Wang, S.; Feng, S.; Zhang, S.; Tian, X.; Sun, C.-P.; Liu, K.; et al. Human transporters, PEPT1/2, facilitate melatonin transportation into mitochondria of cancer cells: An implication of the therapeutic potential. J. Pineal Res. 2017, 62, e12390. [Google Scholar] [CrossRef] [PubMed]
- Mayo, J.C.; Aguado, A.; Cernuda-Cernuda, R.; Alvarez-Artime, A.; Cepas, V.; Quirós-González, I.; Hevia, D.; Sainz, R.M. Melatonin uptake by cells: An answer to its relationship with glucose? Molecules 2018, 23, 1999. [Google Scholar] [CrossRef] [PubMed]
- Reiter, R.J.; Tan, D.-X.; Terron, M.P.; Flores-Alvarado, L.J.; Czarnocki, Z. Melatonin and its metabolites: New findings regarding their production and their radical scavenging actions. Acta Biochim. Pol. 2007, 54, 1–9. [Google Scholar] [CrossRef]
- Rodriguez, C.; Mayo, J.C.; Sainz, R.M.; Antolín, I.; Herrera, F.; Martín, V.; Reiter, R.J. Regulation of antioxidant enzymes: A significant role for melatonin. J. Pineal Res. 2004, 36, 1–9. [Google Scholar] [CrossRef]
- Folmer, V.; Pedroso, N.; Matias, A.C.; Lopes, S.C.; Antunes, F.; Cyrne, M.L.; Marinho, H.S. H2O2 induces rapid biophysical and permeability changes in the plasma membrane of Saccharomyces cerevisiae. Biochim. Biophys. Acta 2008, 1778, 1141–1147. [Google Scholar] [CrossRef]
- Henderson, C.M.; Block, D.E. Examining the role of membrane lipid composition in determining the ethanol tolerance of Saccharomyces cerevisiae. Appl. Environ. Microbiol. 2014, 80, 2966–2972. [Google Scholar] [CrossRef]
- Joshua, I.M.; Höfken, T. From lipid homeostasis to differentiation: Old and new functions of the zinc cluster proteins Ecm22, Upc2, Sut1 and Sut2. Int. J. Mol. Sci. 2017, 18, 772. [Google Scholar] [CrossRef] [PubMed]
- Zavrel, M.; Hoot, S.J.; White, T.C. Comparison of sterol import under aerobic and anaerobic conditions in three fungal species, Candida albicans, Candida glabrata, and Saccharomyces cerevisiae. Eukaryot. Cell 2013, 12, 725–738. [Google Scholar] [CrossRef] [PubMed]
- Serrazanetti, D.I.; Patrignani, F.; Russo, A.; Vannini, L.; Siroli, L.; Gardini, F.; Lanciotti, R. Cell membrane fatty acid changes and desaturase expression of Saccharomyces bayanus exposed to high pressure homogenization in relation to the supplementation of exogenous unsaturated fatty acids. Front. Microbiol. 2015, 6, 1105. [Google Scholar] [CrossRef]
- Allan, K.M.; Loberg, M.A.; Chepngeno, J.; Hurtig, J.E.; Tripathi, S.; Kang, M.G.; Allotey, J.K.; Widdershins, A.H.; Pilat, J.M.; Sizek, H.J.; et al. Trapping redox partnerships in oxidant-sensitive proteins with a small, thiol-reactive cross-linker. Free. Radic. Boil. Med. 2016, 101, 356–366. [Google Scholar] [CrossRef]
- Biteau, B.; Labarre, J.; Toledano, M.B. ATP-Dependent Reduction of Cysteine–Sulphinic Acid by S. cerevisiae Sulphiredoxin. Nature 2003, 425, 980–984. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Zhang, K.; Mehmood, M.A.; Zhao, Z.K.; Bai, F.; Zhao, X. Deletion of acetate transporter gene ADY2 improved tolerance of Saccharomyces cerevisiae against multiple stresses and enhanced ethanol production in the presence of acetic acid. Bioresour. Technol. 2017, 245, 1461–1468. [Google Scholar] [CrossRef] [PubMed]
- Alonso-González, C.; Mediavilla, D.; Martínez-Campa, C.; González, A.; Cos, S.; Sanchez-Barcelo, E.J. Melatonin modulates the cadmium-induced expression of MT-2 and MT-1 metallothioneins in three lines of human tumor cells (MCF-7, MDA-MB-231 and HeLa). Toxicol. Lett. 2008, 181, 190–195. [Google Scholar] [CrossRef]
- Reiter, R.J.; Mayo, J.C.; Tan, D.-X.; Sainz, R.M.; Alatorre-Jimenez, M.; Qin, L. Melatonin as an antioxidant: under promises but over delivers. J. Pineal Res. 2016, 61, 253–278. [Google Scholar] [CrossRef]
- Gasch, A.P.; Spellman, P.T.; Kao, C.M.; Carmel-Harel, O.; Eisen, M.B.; Storz, G.; Botstein, D.; Brown, P.O. Genomic expression programs in the response of yeast cells to environmental changes. Mol. Boil. Cell 2000, 11, 4241–4257. [Google Scholar] [CrossRef]
- Boyle, G.M.; Roucou, X.; Nagley, P.; Devenish, R.J.; Prescott, M. Identification of subunit g of yeast mitochondrial F1F0-ATP synthase, a protein required for maximal activity of cytochrome c oxidase. JBIC J. Boil. Inorg. Chem. 1999, 262, 315–323. [Google Scholar] [CrossRef]
- Acuña-Castroviejo, D.; Escames, G.; León, J.; Carazo, A.; Khaldy, H. Mitochondrial regulation by melatonin and its metabolites. In Developments in Tryptophan and Serotonin Metabolism. Advances in Experimental Medicine and Biology; Allegri, G., Costa, C.V.L., Ragazzi, E., Steinhart, H., Varesio, L., Eds.; Springer: Boston, MA, USA, 2003; Volume 527, pp. 549–557. [Google Scholar] [CrossRef]
- Petrosillo, G.; De Benedictis, V.; Ruggiero, F.M.; Paradies, G. Decline in cytochrome c oxidase activity in rat-brain mitochondria with aging. Role of peroxidized cardiolipin and beneficial effect of melatonin. J. Bioenerg. Biomembr. 2013, 45, 431–440. [Google Scholar] [CrossRef] [PubMed]
- Xia, Y.; Chen, S.; Zeng, S.; Zhao, Y.; Zhu, C.; Deng, B.; Zhu, G.; Yin, J.; Wang, W.; Hardeland, R.; et al. Melatonin in macrophage biology: Current understanding and future perspectives. J. Pineal Res. 2019, 66, e12547. [Google Scholar] [CrossRef] [PubMed]
- Martin, M.; Macias, M.; Escames, G.; Reiter, R.; Agapito, M.; Ortiz, G.; Acuña-Castroviejo, D. Melatonin-induced increased activity of the respiratory chain complexes I and IV can prevent mitochondrial damage induced by ruthenium red in vivo. J. Pineal Res. 2000, 28, 242–248. [Google Scholar] [CrossRef] [PubMed]
- Bode, M.; Longen, S.; Morgan, B.; Peleh, V.; Dick, T.P.; Bihlmaier, K.; Herrmann, J.M. Inaccurately assembled cytochrome c oxidase can lead to oxidative stress-induced growth arrest. Antioxidants Redox Signal. 2013, 18, 1597–1612. [Google Scholar] [CrossRef]
- Piccoli, C.; Scrima, R.; Boffoli, D.; Capitanio, N. Control by cytochrome c oxidase of the cellular oxidative phosphorylation system depends on the mitochondrial energy state. Biochem. J. 2006, 396, 573–583. [Google Scholar] [CrossRef]
- Srinivasan, S.; Avadhani, N.G. Cytochrome c oxidase dysfunction in oxidative stress. Free. Radic. Boil. Med. 2012, 53, 1252–1263. [Google Scholar] [CrossRef]
- Büyükavci, M.; Özdemir, Ö.; Buck, S.; Stout, M.; Ravindranath, Y.; Savaşan, S. Melatonin cytotoxicity in human leukemia cells: Relation with its pro-oxidant effect. Fundam. Clin. Pharmacol. 2006, 20, 73–79. [Google Scholar] [CrossRef]
- Osseni, R.A.; Rat, P.; Bogdan, A.; Warnet, J.-M.; Touitou, Y. Evidence of prooxidant and antioxidant action of melatonin on human liver cell line HepG2. Life Sci. 2000, 68, 387–399. [Google Scholar] [CrossRef]
- Bejarano, I.; Espino, J.; Barriga, C.; Reiter, R.J.; Pariente, J.A.; Rodríguez, A.B. Pro-Oxidant effect of melatonin in tumour Leucocytes: Relation with its cytotoxic and pro-apoptotic effects. Basic Clin. Pharmacol. Toxicol. 2010, 108, 14–20. [Google Scholar] [CrossRef]
- Zhang, H.-M.; Zhang, Y.-Q.; Zhang, B.-X. The role of mitochondrial complex III in melatonin-induced ROS production in cultured mesangial cells. J. Pineal Res. 2010, 50, 78–82. [Google Scholar] [CrossRef]
- Hardeland, R. Melatonin and the electron transport chain. Cell. Mol. Life Sci. 2017, 74, 3883–3896. [Google Scholar] [CrossRef] [PubMed]
- Weidberg, H.; Amon, A. MitoCPR—A surveillance pathway that protects mitochondria in response to protein import stress. Science 2018, 360, eaan4146. [Google Scholar] [CrossRef]
- Kolaczkowska, A.; Goffeau, A. Regulation of pleiotropic drug resistance in yeast. Drug Resist. Updat. 1999, 2, 403–414. [Google Scholar] [CrossRef] [PubMed]
- Tan, D.-X.; Manchester, L.C.; Qin, L.; Reiter, R.J. Melatonin: A mitochondrial targeting molecule involving mitochondrial protection and dynamics. Int. J. Mol. Sci. 2016, 17, 2124. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues-Pousada, C.; Menezes, R.; Pimentel, C. The Yap family and its role in stress response. Yeast 2010, 27, 245–258. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues-Pousada, C.; Devaux, F.; Caetano, S.M.; Pimentel, C.; Da Silva, S.; Cordeiro, A.C.; Amaral, C. Yeast AP-1 like transcription factors (Yap) and stress response: A current overview. Microb. Cell 2019, 6, 267–285. [Google Scholar] [CrossRef] [PubMed]
- MacIsaac, K.D.; Wang, T.; Gordon, D.B.; Gifford, D.K.; Stormo, G.D.; Fraenkel, E. An improved map of conserved regulatory sites for Saccharomyces cerevisiae. BMC Bioinform. 2006, 7, 113. [Google Scholar] [CrossRef]
- Hu, Z.; Killion, P.J.; Iyer, V.R. Genetic reconstruction of a functional transcriptional regulatory network. Nat. Genet. 2007, 39, 683–687. [Google Scholar] [CrossRef]
- Batova, M.; Klobučníková, V.; Oblasova, Z.; Gregáň, J.; Zahradnik, P.; Hapala, I.; Šubík, J.; Schüller, C. Chemogenomic and transcriptome analysis identifies mode of action of the chemosensitizing agent CTBT (7-chlorotetrazolo[5,1-c]benzo[1,2,4]triazine). BMC Genom. 2010, 11, 153. [Google Scholar] [CrossRef]
- Liu, H.; Styles, C.; Fink, G. Elements of the yeast pheromone response pathway required for filamentous growth of diploids. Science 1993, 262, 1741–1744. [Google Scholar] [CrossRef]
- Borneman, A.R.; Leigh-Bell, J.A.; Yu, H.; Bertone, P.; Gerstein, M.; Snyder, M. Target hub proteins serve as master regulators of development in yeast. Genes Dev. 2006, 20, 435–448. [Google Scholar] [CrossRef] [PubMed]
- González, B.; Vázquez, J.; Cullen, P.J.; Mas, A.; Beltran, G.; Torija, M.J. Aromatic Amino Acid-Derived Compounds Induce Morphological Changes and Modulate the Cell Growth of Wine Yeast Species. Front. Microbiol. 2018, 9, 670. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Fink, G.R. Feedback control of morphogenesis in fungi by aromatic alcohols. Genes Dev. 2006, 20, 1150–1161. [Google Scholar] [CrossRef] [PubMed]
- Siso, M.I.G.; Becerra, M.; Maceiras, M.L.; Vizoso-Vázquez, Á.; Cerdán, M. The yeast hypoxic responses, resources for new biotechnological opportunities. Biotechnol. Lett. 2012, 34, 2161–2173. [Google Scholar] [CrossRef]
- Lee, S.K.; Chen, X.; Huang, L.; Stargell, L.A. The head module of Mediator directs activation of preloaded RNAPII in vivo. Nucleic Acids Res. 2013, 41, 10124–10134. [Google Scholar] [CrossRef] [PubMed]
- Lorenz, R.T.; Parks, L.W. Regulation of ergosterol biosynthesis and sterol uptake in a sterol-auxotrophic yeast. J. Bacteriol. 1987, 169, 3707–3711. [Google Scholar] [CrossRef] [PubMed]
- Abramova, N.; Sertil, O.; Mehta, S.; Lowry, C.V. Reciprocal regulation of anaerobic and aerobic cell wall mannoprotein gene expression in Saccharomyces cerevisiae. J. Bacteriol. 2001, 183, 2881–2887. [Google Scholar] [CrossRef]
- Bendjilali, N.; MacLeon, S.; Kalra, G.; Willis, S.D.; Hossian, A.K.M.N.; Avery, E.; Wojtowicz, O.; Hickman, M. Time-course analysis of gene expression during the Saccharomyces cerevisiae hypoxic response. G3 Genes Genome Genet. 2016, 7, 221–231. [Google Scholar] [CrossRef]
- Miura, N.; Shinohara, M.; Tatsukami, Y.; Sato, Y.; Morisaka, H.; Kuroda, K.; Ueda, M. Spatial reorganization of Saccharomyces cerevisiae enolase to alter carbon metabolism under hypoxia. Eukaryot. Cell 2013, 12, 1106–1119. [Google Scholar] [CrossRef]
Gene Name | Nucleotide Sequence of Forward Primer (5′ to 3′) | Nucleotide Sequence of Reverse Primer (5′ to 3′) |
---|---|---|
ACT1 | TGGATTCCGGTGATGGTGTT | CGGCCAAATCGATTCTCAA |
ADY2 | TTTCAGCCTTCGCGTTGAC | CTTGCGCTCTCGCATTGA |
ATP20 | GGGTCTTCAACCACCAACTGTT | GGCTCTGCTTATAAAGGTTCGAAT |
CIS1 | CCCATCGGGTTAGTTTCAAAAA | GACATGCTACCCACTCTGCAATAG |
COX2 | TCGTTGTAACAGCTGCTGATGTT | CCAGGAGTAGCATCAACTTTAATACCT |
GDH3 | CACCGGGTTCGGCTTAGTT | GCCGTTTGTTGCATAATCGA |
HEM2 | TTCCGCTATTCATCTCCGATAATCCAG | ACAGACATCGCAAATAATATACAGTTCAGG |
MGA1 | ATGGGCAGTCCCGTCCATTACT | TCGCATCATGTTCACCGTGGGT |
MMT1 | GCGTTGTTTGCGGATGCTA | GCAAAGTCAACAAGTCAGAAACCA |
SDH6 | ACTTCACCACCATTGAACACTTGT | GGGTGTGAAAAGGTGGCAATT |
SRX1 | CCTGTGTTGGATCCTCAA | GGCATAATATAGCGTCTGTC |
TAF10 | ATATTCCAGGATCAGGTCTTCCGTAGC | GTAGTCTTCTCATTCTGTTGATGTTGTTGTTG |
GO Term Molecular Function (p-Value) | % Enrichment | Gene Names |
---|---|---|
Mel vs. Control | ||
Upregulated (227 genes) | ||
Transporter activity (0.00174) Trasmembrane transporter activity (0.01011) | 7.21 | OPT2, MEP1, SWH1, VMA11, YHK8, AGP1, COX5B, FET4, AZR1, LAM5, FET3, PTR2, VMA3, HES1, GAP1, OPT1, FCY21, MPC3, VPS73, STE6, CCC2, YMR279C, AAC3, MAL31, DIP5, COX1, MUP3, HSP30, DUR3 |
Oxireductase activity (0.01995) | 6.96 | YGL039W, HEM14, CUP1-2, COX1, SUR2, MDH2, GPD2, RNR3, HEM13, TSA2, CUP1-1, FRD1, AAD10, EUG1, MPO1, DLD3, HMG2, FET3, YJR149W, YGL185C, GLT1, TDH3, COX5B, SHH4 |
L-serine ammonia-lyase activity (0.02) | 75.00 | YIL168W, CHA1, YIL167W |
Structural constituent of cell wall (0.053) | 16.28 | TIR4, TIR1, SED1, PIR5, DAN1, YBR067C, DAN4 |
Downregulated (422 genes) | ||
Ubiquinol-cytochrome-c-reductase activity (2.11 × 10−5) | 77.78 | COR1, QCR10, QCR8, QCR2, QCR9, QCR6, YEL024W |
Electron transfer activity (2.57 × 10−5) | 28.07 | COX8, COX12, CYT1, QCR9, QCR6, COX4, CYB5, YEL024W, COX5A, QCR2, COR1, CIR2, DRE2, QCR8, CYC1, QCR10, |
Inorganic molecular entity transmembrane transporter (0.09017) | 11.72 | MPH3, MMP1, AQR1, ATP3, ATP14, YBR294W, VBA3,ATP7, OAC1, YLL053C, MIR1, PHO89, COX12, COX8, HNM1, TAT2, YPR124W, PHO84, FEX2, ATP17, CTR3, CTR1, COX4, CTP1, KCH1, PRM6, ATP5, YBR219C,COX5A |
MelH vs. H | ||
Upregulated (498 genes) | ||
Oxireductase activity (2.24 × 10−6) | 15.74 | GDH3, COX8, QCR9, AYR1, ALD3, SDH4, COX5A, GLT1, POX1, COX1, CUP1-2, HYR1, YKL071W, CUP1-1, MPD1, TRX2, CYC7, GPX1, HOM6, FRE6, COX6, DLD3, TRX1, COX3, MXR1, YKL107W, FRE3, COX7, COQ11, GTO1, CTT1, TSC13, GIS1, CIR1, YPR127W, YCR102C, DOT5, TPA1, GAL80, SER33, SUR2, SRX1, PRM4, HBN1, COX2, QCR7, AAD10, FDH1, ETR1, GRX2, GRX1, EUG1, HFD1, YJR096W |
Electron transfer activity (0.00877) | 24.56 | CIR1, GRX2, GRX1, COX7, COX8, QCR9, CYC7, PRM4, COX6, COX5A, QCR7, COX2, COX3, COX1 |
Antioxidant activity (0.01019) | 32.26 | CUP1-2, DOT5, HYR1, GRX2, CUP1-1, GRX1, GPX1, SRX1, GTO1, CTT1 |
Cytochrome-c oxidase activity (0.02878) | 41.18 | COX1, COX3, COX7, COX2, COX5A, COX6, COX8 |
Oxidoreductase activity acting on a sulfur group of donors (0.08819) | 25.64 | TRX1, GTO1, SRX1, PRM4, EUG1, GRX2, MPD1, TRX2, GRX1, MXR1 |
Downregulated (277 genes) | ||
Helicase activity (0.0165) | 14.16 | YRF1-6, YRF1-7, DBP1, ARP5, YRF1-5, YHL050C, MSS116, MPH1, DBP7, YLL067C, YEL077C, YRF1-8, DHH1, SNF2, DBP3, YKU80 |
Category/Element | Mel vs. Control | MelH vs. H | ||
---|---|---|---|---|
Upregulated | Downregulated | Upregulated | Downregulated | |
Complex II of ETC | SHH4 | SDH4, SDH8, SDH6 | ||
Complex III of ETC | RIP1, CYT1, COR1, QCR2, QCR6, QCR9, QCR10, QCR8 | QCR7, QCR9 | ||
Complex IV of ETC | COX1, COX5B | COX5A, COX10, COX15, COX4, COX8, COX12 | COX1, COX2, COX3, COX5A, COX6, COX7, COX8, COX17 | |
Complex V of ETC | ATP3, ATP5, ATP7, ATP17, ATP14 | ATP8, ATP14, ATP15, ATP18, ATP19, ATP20 | ||
Other genes related to ETC | RCF2 | CYC1, CYC3, CYT2, COX10, COX15, NDE1 | RCF1, CYC7, COQ10, COA1, CMC2 | ALD5, COQ1 |
Mitochondrial protection | HSP78 | SOD2, HSP60, GPX2 | CIS1/YLR246C, GDH3, GPX1, TRX1, HYR1 | |
Mitochondrial import | PAM16, PAM18 | TOM7, TIM8, HOT13, PAM17 | XDJ1, MSK1, YJR045C | |
Mitochondria morphology | MIC19, MIC12, FMP30, MDV1 | MIC19, MIC26, GET1 | ||
Mitoribosome | PPE1 | MRPL7, MRPL16, MRPL51, MEPL15, MRPL19, MRPL6, MRPS28, MRP21 | MRPL16, MRPL44, MRPL32, MRPL27, YNL122C, MRP2, MRP17, MRPS5, RSM18, MRPS8 | GEP3, MRP4 |
Mitochondrial translation | RPO41, RMD9, RPM2, MSS116, MTG2 | CBP6, RPM2, RTC6, PET54 | MSS116, MSS51, PET111, PET9 | |
Intergenomic signaling | COR1, QCR2, QCR6, COX5A, COX8, ATP3, ATP5, ATP7, ATP14, ATP17, BNA4, MIR1, SOD2 | COX6, COX5A, COX7, COX8, ATP14, ATP20, QCR7, SDH4 | ||
Mitochondrial transporters | MPC3, AAC3 | MIR1, CTP1, RIM2, YAT1, OAC1 | HSP10, HXT6, OM14, MRS4, CRC1 | MMT1, MDL1, GNP1, ATM1, YHM2 |
TCA cycle | MDH2, CIT2, SHH4 | LSC2 | CIT2, SDH4, SDH8, SDH6 | |
Metabolism (other) | HEM13, HEM14, CHA1, ICT1, SYM1 | GUT2, ARG8, EHT1, CLD1, FOL1, UPS2, DLD1 | YHR208W, AYR1, NCE103, CPT1, HFD1, ETR1 | MAE1, HEM1 |
Other genes ubicated in the mitochondria membrane | RDL1, ISC1 | COQ8, YGR266W, OMS1 | ZEO1, OM45, RDL1 | YBR238C, UTH1 |
Protein modification | MAS2 | PTH2, ISA2 | YTA12, UBX2, PTC5, YME1 | |
Other | ISU1, MMF1, VPS73 | CIR2, UBP16, PUF3, AIF1, AIM36, MIX17, POS5, DRE25 | YBL059W, YPT7, FYV4, ISU2, YSC83, CIR1, AIM19, VPS1, YCR028C-A, ATG9, FMC1, YSP2, MIX14, FMP33, HMF1, ECM10 | PKP1, CAF4 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sunyer-Figueres, M.; Vázquez, J.; Mas, A.; Torija, M.-J.; Beltran, G. Transcriptomic Insights into the Effect of Melatonin in Saccharomyces cerevisiae in the Presence and Absence of Oxidative Stress. Antioxidants 2020, 9, 947. https://doi.org/10.3390/antiox9100947
Sunyer-Figueres M, Vázquez J, Mas A, Torija M-J, Beltran G. Transcriptomic Insights into the Effect of Melatonin in Saccharomyces cerevisiae in the Presence and Absence of Oxidative Stress. Antioxidants. 2020; 9(10):947. https://doi.org/10.3390/antiox9100947
Chicago/Turabian StyleSunyer-Figueres, Mercè, Jennifer Vázquez, Albert Mas, María-Jesús Torija, and Gemma Beltran. 2020. "Transcriptomic Insights into the Effect of Melatonin in Saccharomyces cerevisiae in the Presence and Absence of Oxidative Stress" Antioxidants 9, no. 10: 947. https://doi.org/10.3390/antiox9100947
APA StyleSunyer-Figueres, M., Vázquez, J., Mas, A., Torija, M.-J., & Beltran, G. (2020). Transcriptomic Insights into the Effect of Melatonin in Saccharomyces cerevisiae in the Presence and Absence of Oxidative Stress. Antioxidants, 9(10), 947. https://doi.org/10.3390/antiox9100947