Influence of Dietary Astaxanthin on the Hepatic Oxidative Stress Response Caused by Episodic Hyperoxia in Rainbow Trout
Abstract
:1. Introduction
2. Material and Methods
2.1. Diets and Fish
2.2. Proximate Composition
2.3. Plasma Cortisol, Glucose, and Triglycerides, and Hepatic Glycogen Determination
2.4. Skin and Muscle Color Analysis
2.5. Astaxanthin Extraction and Quantification
2.6. Thiobarbituric Acid Reactive Substances
2.7. Liver Antioxidant Enzyme Activity
2.8. Liver Glutathione
2.9. Gene Expression Assays
2.10. Statistical Analysis
3. Results
3.1. Growth and Whole Body Composition
3.2. Skin and Muscle Color and Liver and Muscle Astaxanthin (AX)
3.3. Plasma Cortisol, Plasma Glucose, Hepatic Glycogen, and Plasma Triglycerides
3.4. Thiobarbituric Acid-Reactive Substance (TBARS) in Flesh and Liver
3.5. Hepatic Antioxidant Enzyme Activity
3.6. Hepatic Glutathione
3.7. Hepatic Gene Expression
3.8. Skin and Muscle Redness Correlation
4. Discussion
4.1. Dietary AX and Episodic Hyperoxia on Physiological Response
4.2. Control of Antioxidant Enzymes by Episodic Hyperoxia and Dietary AX
4.3. Control of Glutathione Metabolism by Episodic Hyperoxia and Dietary AX
4.4. Antioxidant Defenses and Tissue Color
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Halliwell, B.; Gutteridge, J.M.C. Free Radicals in Biology and Medicine; Oxford University Press: Oxford, UK, 2007. [Google Scholar]
- Lushchak, V.I. Environmentally induced oxidative stress in aquatic animals. Aquatic. Toxicol. 2011, 101, 13–30. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez-Concepcion, M.; Avalos, J.; Bonet, M.L.; Boronat, A.; Gomez-Gomez, L.; Hornero-Mendez, D.; Limon, M.C.; Meléndez-Martínez, A.J.; Olmedilla-Alonso, B.; Palou, A.; et al. A global perspective on carotenoids: Metabolism, biotechnology, and benefits for nutrition and health. Prog. Lipid. Res. 2018, 70, 62–93. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tacon, A.G.J. Speculative review of possible carotenoid function in fish. Prog. Fish Cult. 1981, 43, 205–208. [Google Scholar] [CrossRef]
- McGraw, K.J. Mechanics of Carotenoid-Based Coloration. In Bird Coloration I: Mechanisms and Measurements; Hill, G.E., McGraw, K.J., Eds.; Harvard University Press: Cambridge, MA, USA, 2006. [Google Scholar]
- Choubert, G.; Storebakken, T. Dose response to astaxanthin and canthaxanthin pigmentation of rainbow trout fed various dietary carotenoid concentrations. Aquaculture 1989, 81, 69–77. [Google Scholar] [CrossRef]
- Bjerkeng, B.; Peisker, M.; Von Schwartzenberg, K.; Ytrestøyl, T.; Åsgård, T. Digestibility and muscle retention of astaxanthin in Atlantic salmon, Salmo salar, fed diets with the red yeast Phaffia rhodozyma in comparison with synthetic formulated astaxanthin. Aquaculture 2007, 269, 476–489. [Google Scholar] [CrossRef]
- Hama, S.; Uenishi, A.; Yamada, T.; Ohgita, H.; Tsuchiya, E.; Yamashita, K. Scavenging of hydroxyl radicals in aqueous solution by astaxanthin encapsulated in liposomes. Biol. Pharm. Bull. 2012, 35, 2238–2242. [Google Scholar] [CrossRef] [Green Version]
- Kurashige, M.; Okimasu, E.; Inoue, M.; Utsumi, K. Inhibition of oxidative injury of biological membranes by astaxanthin. Physiol. Chem. Phys. Med. NMR 1990, 22, 27–38. [Google Scholar]
- Amar, E.C.; Kiron, V.; Satoh, S.; Watanabe, T. Influence of various dietary synthetic carotenoids on bio-defence mechanisms in rainbow trout, Oncorhynchus mykiss (Walbaum). Aquac. Res. 2001, 32, 162–163. [Google Scholar] [CrossRef]
- Rahman, M.M.; Khosravi, S.; Chang, K.H.; Lee, S. Effects of dietary inclusion of astaxanthin on growth, muscle pigmentation and antioxidant capacity of juvenile rainbow trout (Oncorhynchus mykiss). Prev. Nutr. Food Sci. 2016, 21, 281–288. [Google Scholar] [CrossRef] [Green Version]
- Elia, A.C.; Prearo, M.; Dörr, A.J.M.; Pacini, N.; Magara, G.; Brizio, P.; Abete, M.C. Effects of astaxanthin and canthaxanthin on oxidative stress biomarkers in rainbow trout. J. Toxicol. Environ. Health 2019, 82, 760–768. [Google Scholar] [CrossRef]
- Sallam, A.E.; Mansour, A.T.; Srour, T.M.; Goda, A.M.A. Effects of different carotenoid supplementation sources with or without sodium taurocholate on growth, feed utilization, carotenoid content and antioxidant status in fry of the European seabass, Dicentrarchus labrax. Aquac. Res. 2017, 48, 3848–3858. [Google Scholar] [CrossRef]
- Pham, M.A.; Byun, H.G.; Kim, K.D.; Lee, S.M. Effects of dietary carotenoid source and level on growth, skin pigmentation, antioxidant activity and chemical composition of juvenile olive flounder Paralichthys olivaceus. Aquaculture 2014, 431, 65–72. [Google Scholar] [CrossRef]
- Wang, Y.J.; Chein, Y.H.; Pan, C.H. Effect of dietary supplementation of carotenoid on survival, growth, pigmentation, and antioxidant capacity of characins, Hyphessobrycon callistus. Aquaculture 2006, 261, 641–648. [Google Scholar] [CrossRef]
- Pan, C.H.; Chien, Y.H.; Wang, Y.J. Antioxidant defence to ammonia stress of characins (Hyphessobrycon eques Steindachner) fed diets supplemented with carotenoids. Aquac. Nutr. 2011, 17, 258–266. [Google Scholar] [CrossRef]
- Rama, S.; Manjabhat, S.N. Protective effect of shrimp carotenoids against ammonia stress in common carp, Cyprinus carpio. Ecotoxicol. Environ. Saf. 2014, 107, 207–213. [Google Scholar] [CrossRef]
- Parolini, M.; Iacobuzio, R.; Possenti, C.D.; Bassano, B.; Pennati, R.; Saino, S. Carotenoid-based skin coloration signals antioxidant defenses in the brown trout (Salmo trutta). Hydrobiologia 2018, 815, 267–280. [Google Scholar] [CrossRef]
- Ritola, O.; Tossavainen, K.; Kiuru, T.; Lindström-Seppä, P.; Mölsä, H. Effects of continuous and episodic hyperoxia on stress and hepatic glutathione levels in one summer old rainbow trout (Oncorhynchus mykiss). J. Appl. Ichthyol. 2002, 18, 159–164. [Google Scholar] [CrossRef]
- Wood, C.M. Branchial ion and acid—base transfer in freshwater teleost fish: Environmental hyperoxia as a probe. Physiol. Zool. 1991, 64, 68–102. [Google Scholar] [CrossRef] [Green Version]
- Pérez-Rodríguez, L.; Mougeot, F.; Alonso-Álvarez, C. Carotenoid-based coloration predicts resistance to oxidative damage during an immune challenge. J. Exp. Biol. 2010, 213, 1685–1690. [Google Scholar] [CrossRef] [Green Version]
- EFSA Panel on Additives and Products or Substances used in Animal Feed. Scientific Opinion on the safety and efficacy of astaxanthin (CAROPHYLL® Pink 10% CWS) for salmonids and ornamental fish. EFSA J. 2014, 12, 3725. [Google Scholar] [CrossRef]
- Folch, J.; Lees, M.S.; Stanley, G.H.S. A simple method for the isolation and purification of total lipids from animal tissue. J. Biol. Chem. 1957, 226, 479–509. [Google Scholar]
- Good, C.A.; Kramer, H.; Somogyi, M. The determination of glycogen. J. Biol. Chem. 1933, 100, 485–491. [Google Scholar]
- International Commission on Illumination. Official Recommendations on Uniform Colour Space, Colour Difference Equations and Metric Colour Terms; Suppl. No. 2 to CIE Publication No.15, Colorimetry; International Commission on Illumination: Vienna, Austria, 1976. [Google Scholar]
- García-de Blas, E.; Mateo, R.; Alonso-Alvarez, C. Accumulation of dietary carotenoids, retinoids and tocopherol in the internal tissues of a bird: A hypothesis for the cost of producing colored ornaments. Oecologia 2015, 177, 259–271. [Google Scholar] [CrossRef] [PubMed]
- Koski, P.; Pakarinen, M.; Nakari, T.; Soivio, A.; Hartikainen, K. Treatment with thiamine hydrochloride and astaxanthin for the prevention of yolk-sac mortality in Baltic salmon fry (M74 syndrome). Dis. Aquat. Org. 1999, 37, 209–220. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Burk, R.F.; Trumble, M.J.; Lawrence, R.A. Rat hepatic cytosolic GSH-dependent enzyme protection against lipid peroxidation in the NADPH microsomal lipid peroxidation system. Biochim. Biophys. Acta 1980, 618, 35–41. [Google Scholar] [CrossRef]
- Fontagné-Dicharry, S.; Lataillade, E.; Surget, A. Antioxidant defense system is altered by dietary oxidized lipid in first-feeding rainbow trout (Oncorhynchus mykiss). Aquaculture 2014, 424, 220–227. [Google Scholar] [CrossRef]
- Lowry, O.H.; Rosebrough, N.J.; Farr, A.L. Protein measurement with the Folin-phenol reagent. J. Biol. Chem. 1951, 193, 265–275. [Google Scholar]
- Fontagné-Dicharry, S.; Larroquet, L.; Dias, K.; Cluzeaud, M.; Heraud, C.; Corlay, D. Effects of dietary oxidized fish oil supplementation on oxidative stress and antioxidant defense system in juvenile rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immun. 2018, 74, 43–51. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Surai, P.F.; Fisinin, V.; Karadas, F. Antioxidant systems in chick embryo development. Part 1. Vitamin E, carotenoids and selenium. Anim. Nutr. 2016, 2, 1–11. [Google Scholar] [CrossRef]
- Amar, E.C.; Kiron, V.; Akutsu, T.; Satoh, S.; Watanabe, T. Resistance of rainbow trout Oncorhynchus mykiss to infectious hematopoietic necrosis virus (IHNV) experimental infection following ingestion of natural and synthetic carotenoids. Aquaculture 2012, 330, 148–155. [Google Scholar] [CrossRef]
- Baker, R.T.M.; Pfeiffer, A.M.; Schöner, F.J.; Smith-Lemmon, L. Pigmentation efficacy of astaxanthin and canthaxanthin in fresh-water reared Atlantic salmon, Salmo salar. Anim. Feed Sci. Technol. 2002, 99, 97–106. [Google Scholar] [CrossRef]
- Kalinowski, C.T.; Robaina, L.; Fernandez-Palacios, H.; Schuchardt, D.; Izquierdo, M.S. Effect of different carotenoid sources and their dietary levels on red porgy (Pagrus pagrus) growth and skin colour. Aquaculture 2005, 244, 223–231. [Google Scholar] [CrossRef] [Green Version]
- Pickering, A.D.; Pottinger, T.G. Stress responses and disease resistance in salmonid fish: Effects of chronic elevation of plasma cortisol. Fish Physiol. Biochem. 1989, 7, 253–258. [Google Scholar] [CrossRef] [PubMed]
- Barton, B.A.; Iwama, G.K. Physiological changes in fish from stress in aquaculture with emphasis on the response and effects of corticosteroids. Ann. Rev. Fish Dis. 1991, 1, 3–26. [Google Scholar] [CrossRef]
- Barton, B.A. Stress in fishes: A diversity of responses with particular reference to changes in circulating corticosteroids. Integ. Comp. Biol. 2002, 42, 517–552. [Google Scholar] [CrossRef] [PubMed]
- Van der Boon, J.; van den Thillart, G.E.; Addink, A.D. The effects of cortisol on intermediary metabolism in teleost fish. Comp. Biochem. Physiol. Part A Physiol. 1991, 100, 47–53. [Google Scholar] [CrossRef]
- Morales, A.E.; Cardenete, G.; Abellán, E.; García-Rejón, L. Stress-related physiological responses to handling in the common dentex (Dentex dentex Linnaeus, 1758). Aquac. Res. 2005, 36, 33–40. [Google Scholar] [CrossRef]
- Shoemaker, C.A.; Klesius, P.H.; Lim, C.; Yildirim, M. Feed deprivation of channel catfish, Ictalurus punctatus (Rafinesque), influences organosomatic indices, chemical composition and susceptibility to Flavobacterium columnare. J. Fish Dis. 2003, 26, 553–561. [Google Scholar] [CrossRef]
- Lim, K.C.; Yusoff, F.M.; Shariff, M.; Kamarudin, M.S.; Nagao, N. Dietary supplementation of astaxanthin enhances hemato-biochemistry and innate immunity of Asian seabass, Lates calcarifer (Bloch, 1790). Aquaculture 2019, 512, 734339. [Google Scholar] [CrossRef]
- Ursoniu, S.; Sahebkar, A.; Serban, M.C.; Banach, M. Lipid profile and glucose changes after supplementation with astaxanthin: A systematic review and meta-analysis of randomized controlled trials. Arch. Med. Sci. 2015, 11, 253–266. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ikeuchi, M.; Koyama, T.; Takahashi, J.; Yazawa, K. Effects of astaxanthin supplementation on exercise-induced fatigue in mice. Biol. Pharm. Bull. 2006, 29, 2106–2110. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aoi, W.; Naito, Y.; Takanami, Y.; Ishii, T.; Kawai, Y.; Akagiri, S.; Kato, Y.; Osawa, T.; Yoshikawa, T. Astaxanthin improves muscle lipid metabolism in exercise via inhibitory effect of oxidative CPT I modification. Biochem. Biophys. Res. Commun. 2008, 366, 892–897. [Google Scholar] [CrossRef] [PubMed]
- Page, G.I.; Russell, P.M.; Davies, S.J. Dietary carotenoid pigment supplementation influences hepatic lipid and mucopolysaccharide levels in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. B 2005, 142, 398–402. [Google Scholar] [CrossRef] [PubMed]
- Storey, K.B. Oxidative stress: Animal adaptations in nature. Braz. J. Med. Biol. Res. 1996, 29, 1715–1733. [Google Scholar]
- Berntssen, M.H.; Lundebye, A.K.; Hamre, K. Tissue lipid peroxidative responses in Atlantic salmon (Salmo salar L.) parr fed high levels of dietary copper and cadmium. Fish Physiol. Biochem. 2000, 23, 35–48. [Google Scholar] [CrossRef]
- Lushchak, V.I.; Bagnyukova, T.V.; Lushchak, O.V.; Storey, J.M.; Storey, K.B. Hypoxia and recovery perturb free radical processes and antioxidant potential in common carp (Cyprinus carpio) tissues. Int. J. Biochem. Cell Biol. 2005, 37, 1319–1330. [Google Scholar] [CrossRef]
- Lygren, B.; Hamre, K.; Waagbø, R. Effect of induced hyperoxia on the antioxidant status of Atlantic salmon Salmo salar L. fed three different levels of dietary vitamin E. Aquac. Res. 2000, 31, 401–407. [Google Scholar] [CrossRef]
- Brambilla, F.; Forchino, A.; Antonini, M.; Rimoldi, S.; Terova, G.; Saroglia, M. Effect of dietary Astaxanthin sources supplementation on muscle pigmentation and lipid peroxidation in rainbow trout (Oncorhynchus mykiss). Ital. J. Anim. Sci. 2009, 8, 845–847. [Google Scholar] [CrossRef]
- Liu, F.; Shi, H.Z.; Guo, Q.S.; Yu, Y.B.; Wang, A.M.; Lv, F.; Shen, W.B. Effects of astaxanthin and emodin on the growth, stress resistance and disease resistance of yellow catfish (Pelteobagrus fulvidraco). Fish Shellfish Immunol. 2016, 51, 125–135. [Google Scholar] [CrossRef]
- Nordgarden, U.; Ørnsrud, R.; Hansen, T.; Hemre, G.I. Seasonal changes in selected muscle quality parameters in Atlantic salmon (Salmo salar L.) reared under natural and continuous light. Aquac. Nutr. 2003, 9, 161–168. [Google Scholar] [CrossRef]
- Page, G.I.; Davies, S.J. Tissue astaxanthin and canthaxanthin distribution in rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar). Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2006, 143, 125–132. [Google Scholar] [CrossRef] [PubMed]
- Ritola, O.; Livingstone, D.R.; Peters, L.D. Lindström-Seppä, P. Antioxidant processes are affected in juvenile rainbow trout (Oncorhynchus mykiss) exposed to ozone and oxygen supersaturated water. Aquaculture 2002, 210, 1–19. [Google Scholar] [CrossRef]
- Olsvik, P.A.; Lie, K.K.; Jordal, A.E.O.; Nilsen, T.O.; Hordvik, I. Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon. BMC Mol. Biol. 2005, 6, 21. [Google Scholar] [CrossRef] [Green Version]
- Olsvik, P.A.; Kristensen, T.; Waagbø, R.; Rosseland, B.O.; Tollefsen, K.E.; Toften, H. Effects of hypo- and hyperoxia on transcription levels five stress genes and the glutathione system in liver of Atlantic cod Gadus morhua. J. Exp. Biol. 2006, 209, 2893–2901. [Google Scholar] [CrossRef] [Green Version]
- Salas-Leiton, E.; Cánovas-Conesa, B.; Zerolo, R.; López-Barea, J.; Cañavate, J.P.; Alhama, J. Proteomics of Juvenile Senegal Sole (Solea senegalensis) Affected by Gas Bubble Disease in Hyperoxygenated Ponds. Mar. Biotechnol. 2009, 11, 473–487. [Google Scholar] [CrossRef]
- Hoffmann, C.; Dietrich, M.; Herrmann, A.K.; Schacht, T.; Albrecht, P.; Methner, A. Dimethyl fumarate induces glutathione recycling by upregulation of glutathione reductase. Oxid. Med. Cell Longev. 2017, 2017, 8. [Google Scholar] [CrossRef]
- Cappellini, M.D.; Fiorelli, G. Glucose-6-phosphate dehydrogenase deficiency. Lancet 2008, 371, 64–74. [Google Scholar] [CrossRef]
- Nóbrega-Pereira, S.; Fernandez-Marcos, P.J.; Brioche, T.; Gomez-Cabrera, M.C.; Salvador-Pascual, A.; Flores, J.M.; Serrano, M. G6PD protects from oxidative damage and improves healthspan in mice. Nat. Commun. 2016, 7, 10894. [Google Scholar] [CrossRef] [Green Version]
- Tang, H.Y.; Ho, H.Y.; Wu, P.R.; Chen, S.H.; Kuypers, F.A.; Cheng, M.L. Inability to maintain GSH pool in G6PD-deficient red cells causes futile AMPK activation and irreversible metabolic disturbance. Antioxid. Redox Signal. 2015, 22, 744–759. [Google Scholar] [CrossRef] [Green Version]
- Wu, G.; Fang, Y.Z.; Yang, S.; Lupton, J.R.; Turner, N.D. Glutathione metabolism and its implications for health. J. Nutr. 2004, 134, 489–492. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Steullet, P.; Cabungcal, J.H.; Kulak, A.; Kraftsik, R.; Chen, Y.; Dalton, T.P. Redox dysregulation affects the ventral but not dorsal hippocampus: Impairment of parvalbumin neurons, gamma oscillations, and related behaviors. J. Neurosci. 2010, 30, 2547–2558. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dose, J.; Matsugo, S.; Yokokawa, H.; Koshida, Y.; Okazaki, S.; Seidel, U.; Eggersdorfer, M.; Rimbach, G.; Esatbeyoglu, T. Free radical scavenging and cellular antioxidant properties of astaxanthin. Int. J. Mol. Sci. 2016, 17, 103. [Google Scholar] [CrossRef] [PubMed]
- Nordberg, J.; Arnér, E.S. Reactive oxygen species, antioxidants, and the mammalian thioredoxin system. Free Radic. Biol. Med. 2001, 31, 1287–1312. [Google Scholar] [CrossRef]
Diet | CTRL | ASTA |
---|---|---|
Norwegian herring meal a | 23 | 23 |
Wheat gluten meal b | 10 | 10 |
Soybean meal c | 20 | 20 |
Rapeseed meal c | 10 | 10 |
Fish oil a | 19 | 19 |
Whole wheat meal c | 11.8 | 11.8 |
Dibasic calcium phosphate | 2 | 2 |
Soybean lecithin d | 2 | 2 |
Vitamins premix e | 1 | 1 |
Minerals premix f | 1 | 1 |
Cellulose | 0.2 | 0.1 |
Free astaxanthin g | - | 0.1 |
Proximate composition | ||
Dry matter (DM, %) | 97.4 | 97.3 |
Crude protein (% DM) | 41.8 | 40.8 |
Total lipid (% DM) | 23.7 | 22.9 |
Starch (% DM) | 7.4 | 9.1 |
Ash (% DM) | 9.6 | 9.2 |
Gross energy (kJ g−1 DM) | 24.1 | 23.9 |
Gene | Accession Number | Forward Primer Sequence | Reverse Primer Sequence | Amplicon Size |
---|---|---|---|---|
sod1 | AF469663.1 | tggtcctgtgaagctgattg | ttgtcagctcctgcagtcac | 201 |
sod2 | CA352127.1 | tccctgacctgacctacgac | ggcctcctccattaaacctc | 201 |
cat | BX087110.3 | tgatgtcacacaggtgcgta | gtgggctcagtgttgttgag | 195 |
gpx1a | HE687021.1 | aatgtggcgtcactctgagg | caattctcctgatggccaaa | 131 |
gpx4b | CA344428.1 | ttggaggtcaggagccaggt | accctttcccttgggctgtt | 152 |
gr | HF969248.1 | ctaagcgcagcgtcatagtg | acacccctgtctgacgacat | 108 |
gclc | GSONMT00065033001 | caaccaactggcagacaatg | cctttgacaaggggatgaga | 189 |
gstπ | BX302932.3 | tcgctgactggacgaaagga | cgaaggtcctcaacgccatc | 196 |
tr | HF969247.1 | acaaaatcaaggcgaccaac | ggcagagagaacaggtcgtc | 148 |
sepp1 | EE605178 | gcccaaacaggaagatgtgt | gggcagggagatatggtagg | 100 |
nrf2 | CA360709.1 | tgagctgcagcaatgtctga | gttgggcaatgggtagaagc | 124 |
keap1α | GSONMT00034445001 | gctacgtgatgtctgcccct | ggtacctcatagcggccagt | 116 |
nfκb | BX880658.3 | cagcgtcctaccaggctaaagagat | gctgttcgatccatccgcactat | 181 |
iκbα | BT074199.1 | agagacagactgcgctccac | cggccttcagtagcctctct | 72 |
g6pd | EF551311.1 | ctcatggtcctcaggtttg | agagagcatctggagcaagt | 177 |
gcka | GSONMT00033781001 | ctgcccacctacgtctgt | gtcatggcgtcctcagagat | 174 |
gckb | GSONMT00012878001 | tctgtgctagagacagccc | cattttgacgctggactcct | 150 |
pgm1X1 | GSONMT00077832001 | gaagagagtttcggcacagg | cctccacactctgcttcctc | 106 |
pgm1X2 | GSONMT00077952001 | aaagcatggcttcttcgtca | tggacaatgtggctaaagcc | 148 |
pgm1X3 | GSONMT00016899001 | tgatggtgacggtgatcgta | ggctttagccacattgtcca | 181 |
g6pcb1 | GSONMG00066036001 a | agggacagttcgaaaatggag | ccagagagggaagaagatgaag | 138 |
g6pcb2 | GSONMG00013076001 b | cctgcggaacaccttctttg | tcaatttgtggcgctgatgag | 195 |
ef1α | AF498320.1 | tcctcttggtcgtttcgctg | acccgagggacatcctgtg | 159 |
Environment | Normoxia | |
---|---|---|
Diet | CTRL | ASTA |
Final weight (g) | 848 ± 50 | 872 ± 50 |
DGI a | 3.2 ± 0.2 | 3.3 ± 0.2 |
SGR b | 1.2 ± 0.1 | 1.2 ± 0.1 |
VSI c | 14.9 ± 1.2 | 11.4 ± 1.2 |
HSI d | 1.3 ± 0.1 | 1.0 ± 0.1 |
CF e | 1.9 ± 0.0 | 1.9 ± 0.0 |
FCR f | 1.1 ± 0.1 | 1.1 ± 0.1 |
Whole-body composition | ||
DM (%) | 36.0 ± 0.6 | 36.6 ± 0.3 |
Crude protein (%) | 17.1 ± 0.2 | 16.6 ± 0.1 |
Total lipid (%) | 16.9 ± 0.7 | 17.7 ± 0.1 |
Ash (%) | 1.9 ± 0.1 | 2.0 ± 0.1 |
Environment | Normoxia | Hyperoxia | ||
---|---|---|---|---|
Diet | N-CTRL | N-ASTA | H-CTRL | H-ASTA |
Skin | ||||
Lightness (L*) | 54.7 ± 2.2 | 55.5 ± 1.5 | 57.9 ± 2.0 | 54.4 ± 2.1 |
Redness (a*) | 6.8 ± 0.3 b | 10.3 ± 0.5 a | 6.7 ± 0.4 b | 10.3 ± 0.4 a |
Yellowness (b*) | 1.7 ± 0.7 | 0.5 ± 0.6 | 1.4 ± 0.5 | 1.7 ± 0.6 |
Muscle | ||||
Lightness (L*) | 42.5 ± 0.4 a | 35.5 ± 0.4 b | 42.2 ± 0.5 a | 34.7 ± 0.4 b |
Redness (a*) | 1.5 ± 0.2 b | 12.4 ± 0.4 a,B | 1.2 ± 0.1 b | 15.2 ± 0.3 a,A |
Yellowness (b*) | 1.6 ± 0.3 b | 8.2 ± 0.5 a,B | 2.6 ± 0.3 b | 13.3 ± 0.4 a,A |
Astaxanthin | ||||
Muscle | 0.1 ± 0.0 b | 4.9 ± 0.4 a | 0.1 ± 0.0 b | 6.0 ± 0.6 a |
Liver | 0.1 ± 0.0 b | 1.4 ± 0.13 a,B | 0.0 ± 0.0 b | 1.1 ± 0.1 a,A |
Plasma | 0.1 ± 0.0 b | 5.9 ± 0.4 a | 0.1 ± 0.0 b | 5.8 ± 0.6 a |
Antioxidant Enzymes | Diet | Environment | Two way ANOVA | ||||
---|---|---|---|---|---|---|---|
CTRL | ASTA | Normoxia | Hyperoxia | D | E | DxE | |
CAT (U mg pt−1) | 1152.9 ± 85.4 | 1227.7 ± 85.7 | 1307.4 ± 95.8 a | 1073.2 ± 63.3 b | ns | * | ns |
Total GPX (mU mg pt−1) | 39.7 ± 2.9 | 42.0 ± 2.5 | 43.6 ± 2.7 | 38.3 ± 2.5 | ns | ns | ns |
Se-GPX (mU mg pt−1) | 23.0 ± 2.0 | 23.8 ± 2.0 | 22.4 ± 2.5 | 24.4 ± 1.3 | ns | ns | ns |
NS-GPX (mU mg pt−1) | 16.7 ± 1.8 | 18.1 ± 2.6 | 21.3 ± 2.3 a | 13.5 ± 1.7 b | ns | * | ns |
SOD (U mg pt−1) | 51.6 ± 3.6 | 54.0 ± 3.8 | 59.7 ± 2.9 a | 45.9 ± 3.7 b | ns | ** | ns |
GR (mU mg pt−1) | 9.6 ± 0.5 a | 11.8 ± 0.7 b | 11.9 ± 0.6 y | 9.5 ± 0.7 x | ** | ** | ns |
GST (mU mg pt−1) | 705.2 ± 34.6 | 715.1 ± 39.1 | 762.7 ± 38.6 a | 657.6±30.3 b | ns | * | ns |
Glutathione | Diet | Environment | Two way ANOVA | ||||
---|---|---|---|---|---|---|---|
CTRL | ASTA | Normoxia | Hyperoxia | D | E | DxE | |
tGSH | 1.70 ± 0.04 | 1.69 ± 0.04 | 1.68 ± 0.04 | 1.71 ± 0.04 | ns | ns | ns |
GSSG | 0.35 ± 0.01 b | 0.32 ± 0.01 a | 0.33 ± 0.01 | 0.34 ± 0.01 | * | ns | ns |
GSH | 1.35 ± 0.03 | 1.37 ± 0.04 | 1.35 ± 0.04 | 1.37 ± 0.03 | ns | ns | ns |
GSH/GSSG | 3.96 ± 0.16 a | 4.37 ± 0.13 b | 4.21 ± 0.18 | 4.12 ± 0.13 | * | ns | ns |
OSI | 40.97 ± 1.2 b | 37.68 ± 1.0 a | 39.11 ± 1.31 | 39.54 ± 1.01 | * | ns | ns |
Gene | Diet | Environment | Two-way ANOVA | ||||
---|---|---|---|---|---|---|---|
N-CTRL | N-ASTA | Normoxia | Hyperoxia | D | E | DxE | |
Antioxidant enzymes | |||||||
sod1 | 1.3 ± 0.2 | 1.2 ± 0.1 | 1.1 ± 0.1 | 1.4 ± 0.2 | ns | ns | ns |
sod2 | 1.0 ± 0.1 | 1.1 ± 0.1 | 1.1 ± 0.1 | 1.0 ± 0.1 | ns | ns | ns |
cat | 1.1 ± 0.1 | 1.1 ± 0.1 | 1.1 ± 0.1 | 1.2 ± 0.1 | ns | ns | ns |
gpx1a | 1.0 ± 0.1 | 1.1 ± 0.1 | 0.9 ± 0.0 a | 1.0 ± 0.1 b | ns | * | ns |
gpx4b | 0.9 ± 0.2 | 1.3 ± 0.1 | 1.1 ± 0.1 | 1.0 ± 0.1 | ns | ns | ns |
gr | 1.0 ± 0.1 a | 1.4 ± 0.1 b | 1.2 ± 0.1 | 1.1 ± 0.2 | ** | ns | ns |
gclc | 1.0 ± 0.1 a | 1.3 ± 0.1 b | 1.2 ± 0.1 | 1.1 ± 0.1 | * | ns | ns |
gstπ | 1.0 ± 0.1 | 1.1 ± 0.1 | 1.0 ± 0.1 | 1.1 ± 0.1 | ns | ns | ns |
tr | 1.2 ± 0.1 a | 1.6 ± 0.1 b | 1.3 ± 0.1 | 1.5 ± 0.1 | * | ns | ns |
sepp1 | 0.9 ± 0.1 | 0.9 ± 0.1 | 1.0 ± 0.1 a | 0.8 ± 0.1 b | ns | * | ns |
Transcription factors | |||||||
nrf2 | 1.0 ± 0.1 | 1.1 ± 0.1 | 1.0 ± 0.1 | 1.0 ± 0.1 | ns | ns | ns |
keap1α | 1.2 ± 0.1 | 1.3 ± 0.1 | 1.2 ± 0.1 | 1.3 ± 0.2 | ns | ns | ns |
nfκb | 1.0 ± 0.1 | 1.0 ± 0.1 | 1.1 ± 0.1 | 1.0 ± 0.1 | ns | ns | ns |
iκbi | 1.0 ± 0.1 | 1.0 ± 0.1 | 1.2 ± 0.1 b | 0.9 ± 0.1 a | ns | * | ns |
Gene | Diet | Environment | Two-way ANOVA | ||||
---|---|---|---|---|---|---|---|
CTRL | ASTA | Normoxia | Hyperoxia | D | E | DxE | |
Glucose metabolism | |||||||
g6pd | 1.0 ± 0.1 a | 1.5 ± 0.1 b | 1.4 ± 0.1 y | 1.1 ± 0.1 x | ** | * | ns |
gcka | 38.0 ± 21.3 | 72.3 ± 27.6 | 45.1 ± 26.0 | 65.2 ± 23.1 | ns | ns | ns |
gckb | 2.4 ± 0.7 a | 7.3 ± 1.7 b | 5.9 ± 1.6 | 3.6 ± 1.0 | ** | ns | ns |
pgm1X1 | 1.0 ± 0.1 | 1.3 ± 0.2 | 1.2 ± 0.2 | 1.1 ± 0.2 | ns | ns | ns |
pgm1X2 | 0.9 ± 0.1 | 0.9 ± 0.1 | 1.1 ± 0.1 | 0.7 ± 0.1 | ns | ** | ns |
pgm1X3 | 0.9 ± 0.1 | 0.9 ± 0.1 | 1.1 ± 0.1 | 0.8 ± 0.1 | ns | ** | ns |
g6pcb1 | 1.3 ± 0.2 | 1.0 ± 0.1 | 1.0 ± 0.2 | 1.2 ± 0.2 | ns | ns | ns |
g6pcb2 | 1.9 ± 0.5 | 2.9 ± 0.6 | 2.2 ± 0.7 | 2.6 ± 0.5 | ns | ns | ns |
Oxidative Stress Response | Redness a*-Values | |
---|---|---|
Muscle | Skin | |
Hepatic AX | 0.85 ** | 0.62 ** |
Hepatic GR activity | ns | 0.40 * |
Hepatic OSI | 0.36 * | 0.27 |
Hepatic TBARS | −0.36 * | −0.34 * |
Muscle TBARS | −0.42 * | −0.30 ** |
Hepatic gr mRNA level | 0.45 ** | 0.39 * |
Hepatic gclc mRNA level | 0.36 * | 0.25 |
Hepatic tr mRNA level | 0.42 * | 0.34 * |
Hepatic g6pd mRNA level | 0.38 * | 0.35 * |
Hepatic gckb mRNA level | 0.36 * | 0.24 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kalinowski, C.T.; Larroquet, L.; Véron, V.; Robaina, L.; Izquierdo, M.S.; Panserat, S.; Kaushik, S.; Fontagné-Dicharry, S. Influence of Dietary Astaxanthin on the Hepatic Oxidative Stress Response Caused by Episodic Hyperoxia in Rainbow Trout. Antioxidants 2019, 8, 626. https://doi.org/10.3390/antiox8120626
Kalinowski CT, Larroquet L, Véron V, Robaina L, Izquierdo MS, Panserat S, Kaushik S, Fontagné-Dicharry S. Influence of Dietary Astaxanthin on the Hepatic Oxidative Stress Response Caused by Episodic Hyperoxia in Rainbow Trout. Antioxidants. 2019; 8(12):626. https://doi.org/10.3390/antiox8120626
Chicago/Turabian StyleKalinowski, Carmen Tatiana, Laurence Larroquet, Vincent Véron, Lidia Robaina, María Soledad Izquierdo, Stéphane Panserat, Sachi Kaushik, and Stéphanie Fontagné-Dicharry. 2019. "Influence of Dietary Astaxanthin on the Hepatic Oxidative Stress Response Caused by Episodic Hyperoxia in Rainbow Trout" Antioxidants 8, no. 12: 626. https://doi.org/10.3390/antiox8120626
APA StyleKalinowski, C. T., Larroquet, L., Véron, V., Robaina, L., Izquierdo, M. S., Panserat, S., Kaushik, S., & Fontagné-Dicharry, S. (2019). Influence of Dietary Astaxanthin on the Hepatic Oxidative Stress Response Caused by Episodic Hyperoxia in Rainbow Trout. Antioxidants, 8(12), 626. https://doi.org/10.3390/antiox8120626