Next Article in Journal
Peripheral Oxygen Saturation Targets and Hyperoxemia in Critical Care: Influence of pH, FiO2, and Respiratory Failure
Previous Article in Journal
Integrative Multi-Omics Mendelian Randomization Reveals Oxidative Stress Mechanisms in Major Depressive Disorder, Bipolar Disorder, and Schizophrenia
Previous Article in Special Issue
Cross-Species Insights into In Vitro Maturation Defects of the Oocyte and Identification of Crucial Regulators for Sheep Oocyte Maturation
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antioxidants
Volume 15
Issue 2
10.3390/antiox15020234
antioxidants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

BDNF Promotes In Vitro Maturation of Sheep Oocytes by Alleviating Oxidative Stress and Endoplasmic Reticulum Stress

by
Ning Zhang
1,2,3,
Yukun Song
1,2,3,
Xitong Han
1,2,3,
Nan Zhang
1,2,3 and
Jiaxin Zhang
1,2,3,*
1
College of Animal Science, Inner Mongolia Agricultural University, Hohhot 010018, China
2
Inner Mongolia Key Laboratory of Sheep & Goat Genetics, Breeding and Reproduction, Hohhot 010018, China
3
Key Laboratory of Mutton Sheep & Goat Genetics and Breeding, Ministry of Agriculture and Rural Affairs, Hohhot 010018, China
*
Author to whom correspondence should be addressed.
Antioxidants 2026, 15(2), 234; https://doi.org/10.3390/antiox15020234
Submission received: 13 January 2026 / Revised: 6 February 2026 / Accepted: 8 February 2026 / Published: 11 February 2026
(This article belongs to the Special Issue Redox Regulation in Animal Reproduction)
Browse Figures
Versions Notes

Abstract

In vitro maturation (IVM) is highly susceptible to influences of the culture environment, which can lead to increased intracellular reactive oxygen species (ROS) levels and thereby induce a stress response in oocytes, ultimately reducing the developmental potential of early embryos. Brain-derived neurotrophic factor (BDNF) is an ovarian endocrine factor that can enhance the function of follicular granulosa cells and promote oocyte maturation, but the specific pathways remain unclear. We supplemented IVM cultures of sheep oocytes with BDNF and examined aspects of oocyte nuclear and cytoplasmic maturation. The addition of 50 ng/mL BDNF promoted the expansion of cumulus cells and increased the rates of first polar body extrusion, cleavage, and blastocyst formation. Compared with untreated controls, BDNF-treated oocytes had improved Ca2+ homeostasis, enhanced expression of antioxidant genes, decreased ROS levels and expression of endoplasmic reticulum stress genes, and increased mitochondrial membrane potential, mitochondrial biogenesis, and numbers of cells with proper distributions of mitochondria and endoplasmic reticulum. Further analysis indicated that BDNF affected oocyte maturation by increasing the numbers of transzonal projections and gap junctions during the IVM process. In summary, the addition of BDNF during the IVM process improved sheep oocyte maturation and embryo development by reducing oxidative stress and endoplasmic reticulum stress. These findings deepen our understanding of the regulatory mechanisms of BDNF during IVM and provide experimental data to improve in vitro embryo production from sheep oocytes.

1. Introduction

In vitro maturation (IVM) of oocytes is the first and most critical step in the process of in vitro embryo production [1]. The quality of oocytes directly affects the fertilization rate, early embryonic development, pregnancy maintenance, and fetal development in mammals [2]. Reactive oxygen species (ROS) directly impair oocyte quality through the induction of oxidative stress (OS) [3]. In vivo, the stable physiological environment and follicular fluid provide abundant antioxidant factors to neutralize ROS generation. However, during IVM culture of oocytes, the IVM medium typically contains comparatively lower levels of antioxidant enzymes compared with the maternal environment, leading to ROS accumulation. This disruption of redox homeostasis ultimately triggers OS [4,5]. Previous studies have shown that an imbalance of ROS in oocytes leads to apoptosis, mitochondrial dysfunction, DNA damage, lipid peroxidation, and other damages that hinder oocyte maturation [6,7]. In addition, the endoplasmic reticulum (ER) serves as a central site for intracellular calcium storage and protein folding [8], and ROS accumulation disrupts ER function, impairing protein folding and processing, leading to the misfolded proteins and triggering ER stress (ERS), which ultimately compromises oocyte maturation [9,10].
Brain-derived neurotrophic factor (BDNF) is a widely expressed neurotrophic factor that plays a critical role in supporting neuronal survival and differentiation [11]. BDNF exhibits anti-inflammatory and antioxidant properties by suppressing the expression of pro-inflammatory factors and upregulating anti-inflammatory factors, thereby improving the inflammatory microenvironment [12,13]. BDNF also acts as an ovarian endocrine factor. BDNF is upregulated during the luteinizing hormone (LH) surge, and there is substantial evidence demonstrating its critical role in ovarian follicular development. By binding to its specific receptor, tyrosine kinase receptor B (TrkB), BDNF activates downstream signaling pathways and participates extensively in key physiological processes including steroidogenesis, granulosa cell proliferation, folliculogenesis, oocyte maturation, and ovulation. These mechanisms underscore its essential regulatory functions in ovarian physiology. Dysregulated BDNF expression is closely associated with ovarian pathologies such as premature ovarian insufficiency and polycystic ovary syndrome [14,15,16]. In mice, BDNF secreted by granulosa cells and cumulus cells promotes extrusion of the first polar body (PBI) of oocytes in a paracrine manner, and it also promotes the development of fertilized eggs into pre-implantation embryos. These two effects mediated by BDNF are specifically blocked by K252a, an inhibitor of the tropomyosin receptor kinase 2 (NTRK2) receptor [17]. Studies using immunofluorescence and confocal laser microscopy showed that BDNF can promote the developmental ability of mouse oocytes during IVM by improving the structure and position of the meiotic spindle and the distribution of cortical granules at meiosis [18]. BDNF is also a regulator of human oocyte maturation and early embryonic development [19]. In a previous study, BDNF increased the proportion of blastocysts formed after parthenogenetic activation of matured bovine oocytes [20]. Furthermore, gonadotropins were shown to promote BDNF expression in human granulosa cells. Treatment of immature oocytes with BDNF increased the number of oocytes reaching the metaphase II stage [21]. As a potential candidate for improving the efficiency of in vitro embryo production from pigs, the addition of BDNF to IVM medium increased PBI extrusion and enhanced development, increasing the number of oocytes achieving the blastocyst stage after in vitro fertilization (IVF) and somatic cell nuclear transfer [22]. Notably, during human oocyte maturation, cAMP acts as a key messenger that stimulates cumulus cells to increase their output of BDNF in a dose-dependent manner [19].
Despite extensive evidence from animal studies that BDNF can promote IVM of oocytes, the precise regulatory mechanisms underlying its role in IVM of sheep oocytes remain unclear. In this study, we investigated the effects and potential mechanisms of BDNF supplementation to the IVM medium during IVM of sheep oocytes. We examined the extent of cumulus expansion and the nuclear maturation rate of cumulus-oocyte complexes (COCs) treated with BDNF, as well as the levels of ROS, ERS, and mitochondrial function in sheep oocytes treated with BDNF. We also measured the expression of genes related to OS and ERS. Finally, we evaluated the developmental ability of embryos based on the cleavage rate, blastocyst formation rate, and total cell count during the in vitro culture stage.

2. Materials and Methods

2.1. In Vitro Maturation (IVM)

Sheep ovaries were collected from a slaughterhouse, placed in normal saline at 37 °C, and transported to the laboratory within 2 h. A sterile 10 mL syringe was used to aspirate COCs from antral follicles with a diameter of 3–5 mm. The COCs were washed, and a stereomicroscope was used to select COCs with three or more layers of cumulus cells for subsequent experiments. Collected COCs were cultured in TCM-199 maturation medium (Cat# 12340030, Gibco, Grand Island, NY, USA) consisting of 10% fetal bovine serum (FBS; Cat# FSP500, ExCell Bio, Shanghai, China), 1% penicillin and streptomycin mixture (PS; Cat# 15140122, Gibco), 0.02 IU/mL follicle stimulating hormone (FSH; Cat# B2506171, NSHF, Ningbo, China), 0.02 IU/mL LH (Cat# B2307061,NSHF), 1 μg/mL 17β-estradiol (Cat# E8875, Sigma-Aldrich, St. Louis, MO, USA), and 0.1 mmol/L cysteine (Cat# C7352, Sigma-Aldrich) under mineral oil at 38.6 °C in a humidified atmosphere of 5% CO2 for 24 h. Three experimental groups were cultured in the same IVM medium as the control group but with the addition of 10 ng/mL, 50 ng/mL, or 100 ng/mL BDNF (Cat# 450-02-10UG, PeproTech, Cranbury, NJ, USA).

2.2. Sperm Preparation, In Vitro Fertilization (IVF), and In Vitro Culture (IVC)

After 24 h of culture, cumulus cells were removed by hyaluronidase. Frozen thawed spermatozoa from the same ejaculate of one ram was used across all experimental procedures. Prior to fertilization, sperm preparation was performed using the “swim-up” method [23]. Briefly, the thawed semen was gently layered at the bottom of a centrifuge tube containing IVF medium (synthetic oviductal fluid supplemented with 2% essential amino acids, 1% non-essential amino acids, 3 mg/mL bovine serum albumin (BSA) (Cat# A6003, Sigma-Aldrich), 2% estrous sheep serum, and 6 IU/mL heparin (Cat# H3149, Sigma-Aldrich). The tube was then incubated at 38.5 °C in a humidified atmosphere of 5% CO2 for 30 min. After the swim-up process, the upper layer containing motile sperm was carefully aspirated and centrifuged at 1500 rpm for 5 min. The supernatant was discarded, and the sperm pellet was resuspended in IVF medium to achieve a final concentration of 1 × 10 7 sperm/mL. The sperm suspension was then added to the COCs, and fertilization was carried out at 38.6 °C in a humidified atmosphere of 5% CO2 for 18–20 h. Following fertilization, cumulus cells and externally attached sperm were completely removed by gentle pipetting. The fertilized zygotes were placed in embryo development medium (mSOFaa + 3 mg·mL−1 BSA) and cultured at 38.6 °C in an environment with 5% CO2, 5% O2, 90% N2, and saturated humidity. The developmental stage was defined as Day 0 starting at IVF (co-incubation of gametes). Cleavage rates and blastocyst formation rates were recorded at Day 2 and Day 7, respectively.

2.3. Cumulus Expansion Index (CEI)

After 24 h of IVM, each oocyte was graded as follows: grade 0, no cumulus expansion; grade 1, expansion of 1–2 layers; grade 2, radial expansion of outer cumulus granulosa cells; grade 3, full expansion except for corona radiata; grade 4, complete expansion. The CEI was then calculated according to the previously reported method [24]: CEI = [(number of grade 0 oocytes × 0) + (number of grade 1 oocytes × 1) + (number of grade 2 oocytes × 2) + (number of grade 3 oocytes × 3) + (number of grade 4 oocytes × 4)] ÷ total number of oocytes.

2.4. First Polar Body Rate

After 24 h of IVM, cumulus cells around the oocytes were removed with hyaluronidase. The oocytes were then washed with oocyte washing solution, and a stereomicroscope was used to count the number of oocytes with PBI as mature nuclear oocytes.

2.5. Total Number of Cells in Blastocysts

Blastocysts collected on the 7th day of development were fixed in 4% paraformaldehyde and permeabilized with 0.3% Triton X-100 (Cat# P0096, Beyotime, Biotechnology, Shanghai, China) for 30 min. Subsequently, the blastocysts were stained with 10 μg/mL Hoechst 33342 (Cat# C1022, Beyotime) and incubated at 37 °C in the dark for 15 min. The stained blastocysts were placed on a glass slide and examined and photographed using an Eclipse Ti2-LAPP inverted fluorescence microscope (Nikon, Tokio, Japan). The total cell counts within the blastocysts were determined using ImageJ 1.54f software (NIH, New York, NY, USA).

2.6. Detection of ROS and Glutathione (GSH) Levels in Oocytes

After 24 h of IVM, ROS and GSH levels in oocytes were measured using the ROS Assay Kit with DCFH-DA (Cat# S0033S, Beyotime) and CellTracker Blue CMAC (Cat# C2110, Thermo Fisher Scientific, Waltham, MA, USA). The oocytes were incubated in DCFH-DA (1:1000) and CellTracker Blue CMAC (1:1000) droplets at 37 °C under light-protected conditions for 30 min. Subsequently, the cells were washed three times with 0.1% PVA (Cat# P-8136, Sigma-Aldrich) in PBS (Cat# 20012027, Gibco) and then immediately observed and imaged using a confocal laser scanning microscope (FV10i-DOC, Olympus, Tokyo, Japan). The fluorescence signal intensity of each oocyte group was analyzed using ImageJ software.

2.7. Detection of Mitochondrial and ER Distributions in Oocytes

Mitochondrial and ER distribution patterns in oocytes were detected using MitoTracker™ (Cat# M7512, Thermo Fisher) and ER-Tracker™ Green (Cat# E34251, Thermo Fisher) according to the manufacturer’s instructions. The collected oocytes were washed three times with 0.1% PVA in PBS, permeabilized with membrane-breaking solution for 2 min, and then incubated with MitoTracker™ (1:1000) and ER-Tracker™ Green (1:1000) under light-protected conditions at 37 °C for 30 min. Fluorescence distribution patterns were observed using a confocal laser scanning microscope.

2.8. Detection of Mitochondrial Membrane Potential (MMP) in Oocytes

MMP in oocytes was evaluated using JC-1 staining (Cat# C2006, Beyotime) according to the manufacturer’s protocol. Collected oocytes were washed three times with 0.1% PVA in PBS, incubated with JC-1 working solution under light-protected conditions at 37 °C for 20 min, and then washed three times with JC-1 staining buffer. Fluorescence intensity was detected using a confocal laser scanning microscope. The red/green fluorescence ratio was employed to analyze MMP levels.

2.9. Detection of Calcium Ion Levels in Oocytes

To measure [Ca2+]i levels, oocytes were incubated with 5 μM Fluo-3 AM (Cat# S1056, Beyotime) at 38.5 °C for 30 min, followed by washing three times with 0.1% PVA in PBS. To measure [Ca2+]ER levels, oocytes were incubated with 10 μM Fluo-4 AM (Cat# S1061M, Beyotime) at 37 °C in the dark for 20 min and then washed three times with 0.1% PVA in PBS. To measure [Ca2+]m levels, oocytes were incubated with 10 μM Rhod-2 AM (Cat# R1244, Thermo Fisher) at 37 °C in the dark for 20 min, followed by washing with 0.1% PVA in PBS. The fluorescence intensity was detected and analyzed using a confocal microscope.

2.10. Analysis of Transzonal Projections (TZPs) in Oocytes

TZPs play a role in the structural integrity of the cumulus-oocyte complex, which is essential for regulating gene expression in the oocyte. To visualize TZPs in oocytes, they were freed of the granulosa or cumulus cells by physical disruption [25]. The number of TZPs in oocytes was detected using the Rhodamine Phalloidin Kit (Cat# ab235138, Abcam, Cambridge, UK). Briefly, after IVM (0 h, 8 h, 12 h, or 24 h), cumulus cells were removed. Oocytes were fixed in 4% paraformaldehyde for 30 min. Oocytes were then transferred to a membrane permeabilization solution (1% Triton X-100 in PBS) and blocking (PBS containing 1% BSA) for 2 h. After several washes, oocytes were then incubated with 1’ Working Solution (1:1000) at 37 °C in the dark for 2 h to label the F-actin cytoskeleton, washed three times with 0.1% PVA- in PBS, and immediately observed under a laser confocal microscope. Analysis of TZP was performed as previously described [26]. To quantify the number of total TZPs per oocyte, images were analyzed using ImageJ in a confocal optical section obtained at the equatorial plane of the oocyte. Using four arcs set 90° apart around the oocyte circumference, the number of TZPs in the zona pellucida was manually counted within one quarter of the arc regions from maximum-intensity projections (10-μm thick z-stack) of equatorial sections (of consistent depth) obtained from rhodamine phalloidin-stained oocytes. In detail, images were acquired as z-stacks with optical sections taken every 1 μm using 546/575 nm excitation/emission under a 40× objective (exposure time 300–400 ms, laser power 10–15%).

2.11. Real-Time Fluorescence Quantitative PCR (qRT-PCR)

Cumulus cells and oocytes were collected 0 h, 8 h, 12 h, and 24 h after IVM. The cell samples were processed using the Single Cell Sequence Specific Amplification Kit (Cat# P621, Vazyme Biotech Co. Ltd., Nanjing, China). Briefly, 4 μL amplification reagent (2.5 μL 2× Reaction Mix, 0.5 μL 0.1 M primer mixture, 0.1 μL RT/Taq enzyme, and 0.9 μL ddH2O) was added to the sample. The sample was immediately placed in a −80 °C refrigerator for 2 min, centrifuged for 2 min, and placed in a PCR machine. The sample was incubated at 50 °C for 60 min and then at 95 °C for 3 min, followed by 18 cycles of 95 °C for 15 s and 60 °C for 15 min. After the reaction was completed, the sample was diluted 1:10 and either placed at 4 °C for quantitative tests or stored at −20 °C.
Processed samples were subjected to qRT-PCR detection using the TB Green® Ex TaqTMII Kit (Cat# RR830B, TaKaRa Bio, San Jose, CA, USA). The reaction system included 5 μL TB Green® Ex TaqTMII, 3 μL ddH2O, 1 μL upstream and downstream primer mixture, and 1 μL sample. The following parameters were used for qRT-PCR: pre-denaturation at 95 °C for 30 s, PCR with 40 cycles of 95 °C for 5 s and 60 °C for 30 s, and melting curve analysis with 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s. The qPCR primer sequences are shown in Table 1 (Sangon Biotech, Shanghai, China). GAPDH and β-actin were used as internal reference genes, and the 2−△△Ct method was used to analyze quantitative mRNA data.

2.12. Statistical Analysis

Each experiment was performed with at least three replicates. Data are represented as the mean ± standard error (SEM). Differences between two or multiple groups were analyzed by using independent Student’s t-test and one-way ANOVA with SPSS 18.0 software (SPSS Inc., Chicago, IL, USA), respectively. ANOVA followed by Tukey’s Honestly Significant Difference (HSD) was used to determine statistical differences between groups. The chi-square test was used to evaluate the differences in cleavage rate and blastocyst rate between the two groups. All statistical analyses were conducted using SPSS statistical software. Results were plotted using GraphPad Prism 9 software (GraphPad, La Jolla, CA, USA). The threshold for statistical significance in all tests was p < 0.05.

3. Results

3.1. BDNF Treatment Affects the In Vitro Maturation of Sheep Oocytes

COCs were incubated for 24 h in IVM medium alone (control) or supplemented with 10 ng/mL BDNF, 50 ng/mL BDNF, or 100 ng/mL BDNF. After 24 h of IVM, the degree of cumulus expansion was observed (Figure 1A). The results showed that the cumulus cells of all the COCs had diffused. There was no difference in CEI between the control (2.74 ± 0.16) COCs and the COCs treated with 10 ng/mL BDNF (3.01 ± 0.17); however, the COCs treated with 50 ng/mL BDNF (3.35 ± 0.23) or 100 ng/mL BDNF (3.74 ± 0.12) had a significantly higher CEI than the control (p < 0.05 for each comparison; Figure 1B). The PBI extrusion rate was determined using a microscope (Figure 1A). The results are shown in Figure 1C. The PBI extrusion rates in the oocytes treated with 50 ng/mL BDNF (79.51 ± 2.09%) or 100 ng/mL BDNF (80.62 ± 3.16%) were both significantly higher than that of the control (68.93 ± 1.97%; p < 0.05 for each comparison), but there was no significant difference between these two groups. Therefore, 50 ng/mL BDNF was selected to treat the oocytes in subsequent experiments.
We examined the expression levels of genes related to cumulus expansion and apoptosis in COCs. Compared with the control, the BDNF-treated COCs significantly upregulated mRNA levels of cumulus expansion-related genes (PTX3, DUSP1, PTGS2, TNFAIP6; p < 0.05) (Figure 1D), reduced mRNA levels of apoptosis-related genes (Caspase3, Caspase9; p < 0.05), and an increased mRNA level of the anti-apoptosis gene BCL2 (p < 0.05) (Figure 1E). In summary, treatment with 50 ng/mL BDNF significantly promoted oocyte maturation and inhibited apoptosis.

3.2. BDNF Reduces Oxidative Stress in Oocytes

After 24 h of IVM, the levels of ROS and GSH in oocytes were detected using DCFH-DA and Cell Tracker Blue CMAC. As shown in Figure 2, compared with the control, oocytes treated with 50 ng/mL BDNF had lower intracellular ROS levels (p < 0.05; Figure 2A,B) and higher GSH levels (p < 0.05; Figure 2C,D). These results indicate that BDNF can reduce the ROS produced by sheep oocytes during IVM, thereby alleviating OS. Thus, the above demonstrated that BDNF can alleviate OS in sheep oocytes during IVM.

3.3. BDNF Enhances the Antioxidant Capacity of Oocytes

Oocyte OS inevitably occurs during IVM, and mitochondria serve as one of the primary sites generating ROS. Mitochondrial distribution patterns in oocytes were detected using MitoTracker staining. Based on previous reports [27], the mitochondrial distribution in oocytes was categorized as proper, characterized by uniform dispersion throughout the entire cytoplasm, or abnormal, manifested as heterogeneous aggregation within specific cytoplasmic regions. The experimental results showed that there was no significant difference in the percentage of cells with a proper distribution of mitochondria between the control and oocytes treated with 50 ng/mL BDNF (Figure 3A,B). The expression of antioxidant genes in oocytes was detected by qRT-PCR, and the results are shown in Figure 3C. The mRNA levels of antioxidant genes, including SOD2, CAT, GPX1, and PRDX1, were increased in oocytes treated with 50 ng/mL BDNF compared with those in control oocytes (Figure 2C; p < 0.05). Thus, these results suggest that BDNF primarily enhances the oocyte’s antioxidant capacity.

3.4. BDNF Regulates Mitochondrial Function in Oocytes

Mitochondria are important organelles in oocytes and are crucial for oocyte maturation. We evaluated the function of mitochondria by measuring the MMP in oocytes. Compared with the untreated control, oocytes treated with 50 ng/mL BDNF had a significantly elevated MMP (p < 0.05; Figure 4A,B). Concurrently, we analyzed the mitochondrial biogenesis in oocytes by qRT-PCR. NADH dehydrogenase subunit 5 (ND5) is frequently used as a reliable molecular marker for assessing mitochondrial biogenesis [28]. As shown in Figure 4C, BDNF treatment markedly increased the mRNA levels of ND5, indicating enhanced mitochondrial biogenesis during IVM. These results indicate that BDNF promotes mitochondrial functional activation during oocyte maturation.

3.5. BDNF Alleviates Endoplasmic Reticulum Stress in Oocytes

The ER plays an important role in oocyte maturation. Conditions such as hypoxia, viral infection, calcium depletion, and other stresses can disrupt intracellular homeostasis, triggering ERS. We measured the distribution of the ER in oocytes using ER-Tracker Green dye. Based on previous reports [29], the distribution of the ER in oocytes can be categorized into two situations: proper, characterized by an even distribution throughout the cytoplasm of the oocyte, and abnormal, characterized by an uneven distribution in the peripheral region. As shown in Figure 5A,B, oocytes treated with 50 ng/mL BDNF had a significantly higher rate of proper ER distribution during IVM compared with the control. In addition, oocytes treated with 50 ng/mL BDNF had significantly lower mRNA levels of ERS-related genes, including CHOP10, GRP78, and ATF4, compared with control oocytes (Figure 5C; p < 0.05). These concurrent improvements in ER architecture and reduction in ERS markers indicate that BDNF alleviates ER stress during oocyte maturation.

3.6. BDNF Regulates Ca2+ Levels in Oocytes

The ER and mitochondria are recognized as critical organelles for maintaining Ca2+ homeostasis. Intracellular Ca2+ levels serve as a fundamental regulator of diverse cellular processes, including metabolism, proliferation, differentiation, and apoptosis. During IVM of oocytes, the culture environment induces elevated ROS production, triggering OS. Excessive ROS accumulation disrupts Ca2+ equilibrium in oocytes, thereby exacerbating both OS and ERS. To elucidate the mechanistic impact of BDNF on oocyte maturation, we conducted quantitative assessments of Ca2+ levels in the mitochondrial, ER, and cytoplasmic compartments. Compared with the control, oocytes treated with 50 ng/mL BDNF exhibited a significant reduction in mitochondrial Ca2+ [Ca2+]m (Figure 6A,B; p < 0.05), and increased levels of [Ca2+]ER (Figure 6A,D; p < 0.05). In contrast, BDNF treatment did not significantly alter the cytosolic Ca2+ level ([Ca2+]i) compared to the control (Figure 6A,C; p > 0.05). Thus, BDNF treatment triggered a redistribution of Ca2+, decreasing mitochondrial levels while increasing ER stores during oocyte maturation.

3.7. BDNF Regulates TZP Structure

During the IVM process, approximately 6 h to 8 h after the oocytes are separated from the follicles, the oocytes resume meiosis, and TZPs begin to be gradually lost. We employed rhodamine phalloidin staining to examine structural and quantitative changes in TZPs during IVM of sheep oocytes. As shown in Figure 7A,B, TZP numbers progressively decreased from 8 h onward. BDNF treatment increased the TZP quantity at 8 h (p < 0.05); however, the BDNF-treated oocytes exhibited fewer TZPs than control oocytes at 12 h (p < 0.05). After 24 h of IVM, both groups showed reduced TZP numbers compared with earlier time points, with no significant difference between control oocytes and BDNF-treated oocytes.
Gap junctions, a ubiquitous form of intercellular communication between adjacent cells, are composed of transmembrane proteins called connexins. GJA1 and GJA4 are the two most critical connexin isoforms expressed in mammalian ovarian follicles. We quantified the mRNA expression levels of GJA1 and GJA4. Compared with the control, BDNF treatment significantly downregulated GJA1 expression, while markedly upregulating GJA4 expression (Figure 7C; p < 0.05 for each comparison). These results suggest that BDNF can regulate oocyte-cumulus cell communication during maturation.

3.8. BDNF Treatment Affects Early Embryonic Development in Sheep

After IVM, oocytes were subjected to IVF and embryonic culture. As shown in Table 2, oocytes that were treated with 50 ng/mL BDNF during IVM exhibited significantly higher rates of cleavage (88.64 ± 3.90%) and blastocyst formation (37.27 ± 1.60%) compared with control oocytes (79.80 ± 4.72%; 23.74 ± 0.70%; p < 0.05 for each comparison). Furthermore, quantification of total blastocyst cell numbers revealed a significant increase in the BDNF-treated group relative to the control (Figure 8A,B; p < 0.05). Therefore, supplementing 50 ng/mL BDNF during in vitro maturation can significantly improve the blastocyst formation and quality, leading to enhanced in vitro embryo production efficiency.

4. Discussion

BDNF has been shown to exert beneficial effects on in vitro-matured oocytes; however, the underlying molecular mechanisms are insufficiently characterized. We first determined the impacts of different concentrations of BDNF on the IVM of sheep oocytes, and we then investigated the specific regulatory pathways that were affected by the BDNF treatment. We found that 50 ng/mL BDNF promoted cumulus expansion and PBI extrusion of sheep oocytes during IVM. Previous studies showed that adding BDNF to the IVM culture medium can increase the PBI extrusion rate in mice, cattle, and wild boars [20,22]. Zhao et al. [30] also found that 10 ng/mL BDNF could bind the receptor TrkB and increase the maturation rate of buffalo oocytes. Cumulus cells protect oocytes from OS and reduce apoptosis. Complete cumulus expansion is crucial for the cytoplasmic and nuclear maturation of oocytes [31,32,33,34,35,36,37]. The degree of cumulus expansion is determined by the expression of specific genes, such as HAS2, TNFAIP6, VCAN, and PTX3 [38]. We found that mRNA levels of the cumulus expansion-related genes PTX3, DUSP1, PTGS2, and TNFAIP6 were increased in BDNF-treated oocytes compared with those in control oocytes, which is largely consistent with the results of a previous study of buffalo oocytes [30]. In addition, BDNF treatment increased the expression of the anti-apoptotic gene BCL2 and decreased the mRNA levels of the apoptotic genes Caspase3 and Caspase9 in oocytes. Based on these results, we hypothesize that treatment with 50 ng/mL BDNF promotes oocyte maturation and improves oocyte quality through cumulus expansion.
Unlike the in vivo environment, standard in vitro oocyte culture employs a gas mixture of 5% CO2 in air (20% O2), creating a significantly higher oxygen partial pressure [39]. Therefore, oocytes that mature in vitro are highly susceptible to high ROS levels, which can lead to OS, poor oocyte quality, and abnormal embryonic development [40,41]. GSH is one of the main antioxidants in cells. Its main function is to protect against the damage of OS and maintain the redox balance within cells [42]. We found that BDNF treatment lowered ROS levels but elevated GSH levels relative to the control group. Mitochondria serve as the primary sites of ATP synthesis during oocyte maturation. As meiosis resumes, the mitochondria undergo spatial reorganization within the oocyte, progressively migrating from cortical regions toward the cytoplasmic center. Uniform intracellular distribution of mitochondria is a critical indicator of cytoplasmic maturation in oocytes [43,44,45,46]. We found that BDNF had no effect on the uniform distribution of oocytes, but it significantly increased the MMP and the mitochondrial biogenesis. It is well established that SOD, CAT, and GPX constitute the primary antioxidant defense system, whereas PRDX belongs to secondary defense mechanisms. During cellular OS, these enzymes orchestrate the elimination of ROS to maintain intracellular redox homeostasis, thereby safeguarding cellular integrity against oxidative damage [47]. We found that the mRNA levels of SOD2, CAT, GPX1, and PRDX1 in BDNF-treated oocytes were increased compared with those in control oocytes. This further demonstrates that BDNF can reduce ROS levels in sheep oocytes and resist OS-induced damage during IVM by enhancing mitochondrial function and increasing the activity of antioxidant enzymes.
The ER is the main site for protein synthesis and is also one of the sites where ROS are produced. When cells experience conditions such as hypoxia, viral infection, or OS, misfolded proteins accumulate in the lumen of the ER, thereby inducing ERS [48,49]. In response to ERS, the unfolded protein response (UPR) is activated as a signaling cascade to restore homeostasis within the ER [50,51]. The UPR is mediated by three key ER transmembrane sensors: IRE1α, PERK, and ATF6 [52]. Normally, the ER chaperone GRP78 is a master regulator, and its expression increases with the severity of ER stress [53]. Substantial experimental evidence indicates that maintaining ER homeostasis is a key mechanism for folliculogenesis and oocyte maturation [54,55]. We found that BDNF restored the spatial organization of ER in oocytes, which was concomitant with transcriptional downregulation of the ERS-related genes CHOP10, GRP78, and ATF4. Collectively, these findings suggest a molecular mechanism whereby BDNF ameliorates the ERS burden in oocytes through targeted suppression of the GRP78-ATF4-CHOP10 signaling axis.
Mitochondria and the ER mediate the transport of intracellular calcium ions, which function as key second messengers to participate in stress responses [56]. Following its release from the ER via channels such as IP3R or RyR during ERS, calcium fluxes into mitochondria, where elevated levels contribute to increased ROS production [57]. We found that treatment of oocytes with BDNF decreased the level of [Ca2+]m and increased the level of [Ca2+]ER, which is consistent with previous findings that OS damage and ERS can disrupt calcium ion levels in oocytes.
Cumulus cells and oocytes communicate through multiple pathways to meet the nutrient demands of oocyte maturation [58]. One key structure is the TZP, which extends from cumulus cells, traverses the zona pellucida, and contacts the oolemma to establish direct communication [59]. These TZPs are crucial for regulating the growth, development, and meiosis of oocytes [60]. TZPs start to retract within a few hours after the start of IVM, which promotes the resumption of oocyte meiosis [61]. BDNF enhances the sensitivity of cumulus cells to gonadotropins. On one hand, cAMP promotes BDNF secretion in cumulus cells. On the other hand, the combined action of BDNF and FSH activates the downstream cAMP/PKA/CREB signaling pathway, while cAMP is transported from cumulus cells to oocytes [62]. We found that after 8 h of IVM, the number of TZPs began to decrease significantly. Compared with the control, BDNF-treated cells maintained a higher level of TZPs at this stage, which prolonged the meiotic resumption time and promoted cytoplasmic maturation. The reduction of TZPs diminished cAMP transport to oocytes, facilitating meiotic resumption. These findings indicate that the timing of TZP retraction plays a crucial role in oocyte maturation. Additionally, we examined gap junction genes and found that BDNF upregulated their mRNA expression levels. This enhancement promoted material exchange between cumulus cells and oocytes, thereby improving early embryonic developmental competence.

5. Conclusions

This study reveals a potential molecular mechanism by which BDNF promotes successful IVM of sheep oocytes. BDNF increases the PBI ejection rate and the cumulus expansion of oocytes, reduces OS and ERS, improves mitochondrial function, enhances material exchange between cumulus cells and oocytes, and promotes the maturation of oocytes and the development of early embryos.

Author Contributions

N.Z. (Ning Zhang): Writing—original draft, Visualization, Software, Formal analysis, Data curation. Y.S.: Data curation, Visualization. X.H.: Visualization. N.Z. (Nan Zhang): Visualization. J.Z.: Writing—review and editing, Project administration, Funding acquisition, Formal analysis, Supervision, Resources, Data curation. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by grants from the Science and Technology Plan of Inner Mongolia Autonomous Region (No. 2025KYPT0035) and the 12th Inner Mongolia “Grassland Talent” High-level Talent Training Project (2023).

Institutional Review Board Statement

All experimental protocols involving animal care and sample collection were approved by the Ethics Committee of Experimental Animals of Inner Mongolia Agricultural University, Inner Mongolia Autonomous Region, China (No. NND2025238).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Jiang, Y.; He, Y.; Pan, X.; Wang, P.; Yuan, X.; Ma, B. Advances in Oocyte Maturation In Vivo and In Vitro in Mammals. Int. J. Mol. Sci. 2023, 24, 9059. [Google Scholar] [CrossRef]
  2. Pytel, A.T.; Żyżyńska-Galeńska, K.; Gajewski, Z.; Papis, K. Factors defining developmental competence of bovine oocytes collected for in vitro embryo production. Biol. Reprod. 2024, 111, 1–10. [Google Scholar] [CrossRef] [PubMed]
  3. Sunuwar, S.; Heo, Y.S. Reactive Oxygen Species in Embryo Development: Sources, Impacts, and Implications for In Vitro Culture Systems. Life 2026, 16, 136. [Google Scholar] [CrossRef]
  4. Vašková, J.; Klepcová, Z.; Špaková, I.; Urdzík, P.; Štofilová, J.; Bertková, I.; Kľoc, M.; Rabajdová, M. The Importance of Natural Antioxidants in Female Reproduction. Antioxidants 2023, 12, 907. [Google Scholar] [CrossRef]
  5. Rakha, S.I.; Elmetwally, M.A.; El-Sheikh Ali, H.; Balboula, A.; Mahmoud, A.M.; Zaabel, S.M. Importance of Antioxidant Supplementation during In Vitro Maturation of Mammalian Oocytes. Vet. Sci. 2022, 9, 439. [Google Scholar] [CrossRef] [PubMed]
  6. Combelles, C.M.; Gupta, S.; Agarwal, A. Could oxidative stress influence the in-vitro maturation of oocytes? Reprod. Biomed. Online 2009, 18, 864–880. [Google Scholar] [CrossRef]
  7. Kala, M.; Shaikh, M.V.; Nivsarkar, M. Equilibrium between anti-oxidants and reactive oxygen species: A requisite for oocyte development and maturation. Reprod. Med. Biol. 2017, 16, 28–35. [Google Scholar] [CrossRef] [PubMed]
  8. Li, X.; Tian, Y.; Zuo, N.; Tang, J.; Cheng, S.; Li, L.; Tan, J.; Zhang, J.; Shen, W. Cyanidin-3-O-glucoside protects Zearalenone-induced in vitro maturation disorders of porcine oocytes by alleviating NOX4-dependent oxidative stress and endoplasmic reticulum stress in cumulus cells. Chemosphere 2024, 358, 142153. [Google Scholar] [CrossRef]
  9. Lin, T.; Lee, J.E.; Kang, J.W.; Shin, H.Y.; Lee, J.B.; Jin, D.I. Endoplasmic Reticulum (ER) Stress and Unfolded Protein Response (UPR) in Mammalian Oocyte Maturation and Preimplantation Embryo Development. Int. J. Mol. Sci. 2019, 20, 409. [Google Scholar] [CrossRef]
  10. Kang, X.; Wang, J.; Yan, L. Endoplasmic reticulum in oocytes: Spatiotemporal distribution and function. J. Assist. Reprod. Genet. 2023, 40, 1255–1263. [Google Scholar] [CrossRef]
  11. Miranda, M.; Morici, J.F.; Zanoni, M.B.; Bekinschtein, P. Brain-Derived Neurotrophic Factor: A Key Molecule for Memory in the Healthy and the Pathological Brain. Front. Cell Neurosci. 2019, 13, 363. [Google Scholar] [CrossRef]
  12. Numakawa, T.; Kajihara, R. The Role of Brain-Derived Neurotrophic Factor as an Essential Mediator in Neuronal Functions and the Therapeutic Potential of Its Mimetics for Neuroprotection in Neurologic and Psychiatric Disorders. Molecules 2025, 30, 848. [Google Scholar] [CrossRef]
  13. Maiworm, M. The relevance of BDNF for neuroprotection and neuroplasticity in multiple sclerosis. Front. Neurol. 2024, 15, 1385042. [Google Scholar] [CrossRef] [PubMed]
  14. Dissen, G.A.; Garcia-Rudaz, C.; Ojeda, S.R. Role of neurotrophic factors in early ovarian development. Semin. Reprod. Med. 2009, 27, 24–31. [Google Scholar] [CrossRef] [PubMed]
  15. Dorfman, M.D.; Garcia-Rudaz, C.; Alderman, Z.; Kerr, B.; Lomniczi, A.; Dissen, G.A.; Castellano, J.M.; Garcia-Galiano, D.; Gaytan, F.; Xu, B.; et al. Loss of Ntrk2/Kiss1r signaling in oocytes causes premature ovarian failure. Endocrinology 2014, 155, 3098–3111. [Google Scholar] [CrossRef]
  16. Chen, S.; Wang, F.; Liu, Z.; Zhao, Y.; Jiang, Y.; Chen, L.; Li, C.; Zhou, X. Brain-derived neurotrophic factor promotes proliferation and progesterone synthesis in bovine granulosa cells. J. Cell Physiol. 2019, 234, 8776–8787. [Google Scholar] [CrossRef] [PubMed]
  17. Kawamura, K.; Kawamura, N.; Mulders, S.M.; Sollewijn Gelpke, M.D.; Hsueh, A.J. Ovarian brain-derived neurotrophic factor (BDNF) promotes the development of oocytes into preimplantation embryos. Proc. Natl. Acad. Sci. USA 2005, 102, 9206–9211. [Google Scholar] [CrossRef]
  18. Zhang, L.; Li, J.; Su, P.; Xiong, C. The role of brain-derived neurotrophic factor in mouse oocyte maturation in vitro. J. Huazhong Univ. Sci. Technol. Med. Sci. 2010, 30, 781–785. [Google Scholar] [CrossRef]
  19. Seifer, D.B.; Feng, B.; Shelden, R.M.; Chen, S.; Dreyfus, C.F. Brain-derived neurotrophic factor: A novel human ovarian follicular protein. J. Clin. Endocrinol. Metab. 2002, 87, 655–659. [Google Scholar] [CrossRef]
  20. Yi, K.L.; Zhou, X.; Shi, D.S.; Chen, H.H.; Qin, Q.L.; Chen, Y.; Li, C.J.; Zhao, Z.H.; Xing, S.Y. The mRNA expression of brain-derived neurotrophic factor in oocytes and embryos and its effects on the development of early embryos in cattle. Animal 2008, 2, 1786–1794. [Google Scholar] [CrossRef]
  21. Anderson, R.A.; Bayne, R.A.; Gardner, J.; De Sousa, P.A. Brain-derived neurotrophic factor is a regulator of human oocyte maturation and early embryo development. Fertil. Steril. 2010, 93, 1394–1406. [Google Scholar] [CrossRef]
  22. Lee, E.; Jeong, Y.I.; Park, S.M.; Lee, J.Y.; Kim, J.H.; Park, S.W.; Hossein, M.S.; Jeong, Y.W.; Kim, S.; Hyun, S.H.; et al. Beneficial effects of brain-derived neurotropic factor on in vitro maturation of porcine oocytes. Reproduction 2007, 134, 405–414. [Google Scholar] [CrossRef]
  23. Zhang, N.; Zhao, C.; Sun, Y.; Song, Y.; Guo, Y.; Sun, W.; Wang, Z.; Zhang, J. Cyclic guanosine monophosphate (cGMP) improves freezing tolerance of sheep embryos by reducing lipid content. Theriogenology 2026, 250, 117685. [Google Scholar] [CrossRef]
  24. Yu, X.; Li, Z.; Zhao, X.; Hua, L.; Liu, S.; He, C.; Yang, L.; Davis, J.S.; Liang, A. Anti-Müllerian Hormone Inhibits FSH-Induced Cumulus Oocyte Complex In Vitro Maturation and Cumulus Expansion in Mice. Animals 2022, 12, 1209. [Google Scholar] [CrossRef]
  25. El-Hayek, S.; Yang, Q.; Abbassi, L.; FitzHarris, G.; Clarke, H.J. Mammalian Oocytes Locally Remodel Follicular Architecture to Provide the Foundation for Germline-Soma Communication. Curr. Biol. 2018, 28, 1124–1131.e3. [Google Scholar] [CrossRef] [PubMed]
  26. Yuan, Y.; Spate, L.D.; Redel, B.K.; Tian, Y.; Zhou, J.; Prather, R.S.; Roberts, R.M. Quadrupling efficiency in production of genetically modified pigs through improved oocyte maturation. Proc. Natl. Acad. Sci. USA 2017, 114, E5796–E5804. [Google Scholar] [CrossRef]
  27. Li, Y.; Shi, S.; Yuan, J.; Xiao, X.; Ji, D.; Pan, J.; Min, Z.; Wang, H.; Sha, H.; Ji, Y. Mitochondrial aggregation caused by cytochalasin B compromises the efficiency and safety of three-parent embryo. Mol. Hum. Reprod. 2022, 28, gaac036. [Google Scholar] [CrossRef]
  28. Manto, K.; Ustun Yilmaz, S.; Pala Kara, Z.; Kara, H.; Tokat, F.; Akyerli, C.B.; Uras, C.; Muftuoglu, M.; Özbek, U. Association of Mitochondrial DNA Copy Number Variations with Triple-Negative Breast Cancer: A Potential Biomarker Study. Diseases 2025, 13, 175. [Google Scholar] [CrossRef]
  29. FitzHarris, G.; Marangos, P.; Carroll, J. Changes in endoplasmic reticulum structure during mouse oocyte maturation are controlled by the cytoskeleton and cytoplasmic dynein. Dev. Biol. 2007, 305, 133–144. [Google Scholar] [CrossRef] [PubMed]
  30. Zhao, X.; Du, F.; Liu, X.; Ruan, Q.; Wu, Z.; Lei, C.; Deng, Y.; Luo, C.; Jiang, J.; Shi, D.; et al. Brain-derived neurotrophic factor (BDNF) is expressed in buffalo (Bubalus bubalis) ovarian follicles and promotes oocyte maturation and early embryonic development. Theriogenology 2019, 130, 79–88. [Google Scholar] [CrossRef] [PubMed]
  31. Sutton, M.L.; Cetica, P.D.; Beconi, M.T.; Kind, K.L.; Gilchrist, R.B.; Thompson, J.G. Influence of oocyte-secreted factors and culture duration on the metabolic activity of bovine cumulus cell complexes. Reproduction 2003, 126, 27–34. [Google Scholar] [CrossRef] [PubMed][Green Version]
  32. Tatemoto, H.; Sakurai, N.; Muto, N. Protection of porcine oocytes against apoptotic cell death caused by oxidative stress during In vitro maturation: Role of cumulus cells. Biol. Reprod. 2000, 63, 805–810. [Google Scholar] [CrossRef] [PubMed]
  33. Walter, J.; Monthoux, C.; Fortes, C.; Grossmann, J.; Roschitzki, B.; Meili, T.; Riond, B.; Hofmann-Lehmann, R.; Naegeli, H.; Bleul, U. The bovine cumulus proteome is influenced by maturation condition and maturational competence of the oocyte. Sci. Rep. 2020, 10, 9880. [Google Scholar] [CrossRef]
  34. Salustri, A.; Garlanda, C.; Hirsch, E.; De Acetis, M.; Maccagno, A.; Bottazzi, B.; Doni, A.; Bastone, A.; Mantovani, G.; Beck Peccoz, P.; et al. PTX3 plays a key role in the organization of the cumulus oophorus extracellular matrix and in in vivo fertilization. Development 2004, 131, 1577–1586. [Google Scholar] [CrossRef]
  35. Sayutti, N.; Abu, M.A.; Ahmad, M.F. PCOS and Role of Cumulus Gene Expression in Assessing Oocytes Quality. Front. Endocrinol. 2022, 13, 843867. [Google Scholar] [CrossRef]
  36. Sugiura, K.; Su, Y.Q.; Eppig, J.J. Targeted suppression of Has2 mRNA in mouse cumulus cell-oocyte complexes by adenovirus-mediated short-hairpin RNA expression. Mol. Reprod. Dev. 2009, 76, 537–547. [Google Scholar] [CrossRef]
  37. Yung, Y.; Ophir, L.; Yerushalmi, G.M.; Baum, M.; Hourvitz, A.; Maman, E. HAS2-AS1 is a novel LH/hCG target gene regulating HAS2 expression and enhancing cumulus cells migration. J. Ovarian Res. 2019, 12, 21. [Google Scholar] [CrossRef]
  38. Nagyová, E.; Němcová, L.; Camaioni, A. Cumulus Extracellular Matrix Is an Important Part of Oocyte Microenvironment in Ovarian Follicles: Its Remodeling and Proteolytic Degradation. Int. J. Mol. Sci. 2022, 23, 54. [Google Scholar] [CrossRef]
  39. Jia, Z.; Yang, X.; Liu, K. Treatment of cattle oocytes with C-type natriuretic peptide before in vitro maturation enhances oocyte mitochondrial function. Anim. Reprod. Sci. 2021, 225, 106685. [Google Scholar] [CrossRef] [PubMed]
  40. Jiang, W.J.; Liu, W.; Li, Y.H.; Jiang, H.; Xu, Y.N.; Kim, N.H. Citrinin impairs pig oocyte maturation by inducing oxidative stress and apoptosis. Toxicon 2022, 205, 84–90. [Google Scholar] [CrossRef]
  41. Jiang, W.J.; Hu, L.L.; Ren, Y.P.; Lu, X.; Luo, X.Q.; Li, Y.H.; Xu, Y.N. Podophyllotoxin affects porcine oocyte maturation by inducing oxidative stress-mediated early apoptosis. Toxicon 2020, 176, 15–20. [Google Scholar] [CrossRef]
  42. Liu, N.; Si, X.; Ji, Y.; Yang, Q.; Bai, J.; He, Y.; Jia, H.; Song, Z.; Chen, J.; Yang, L.; et al. l-Proline improves the cytoplasmic maturation of mouse oocyte by regulating glutathione-related redox homeostasis. Theriogenology 2023, 195, 159–167. [Google Scholar] [CrossRef]
  43. Sánchez, F.; Romero, S.; De Vos, M.; Verheyen, G.; Smitz, J. Human cumulus-enclosed germinal vesicle oocytes from early antral follicles reveal heterogeneous cellular and molecular features associated with in vitro maturation capacity. Hum. Reprod. 2015, 30, 1396–1409. [Google Scholar] [CrossRef]
  44. Ge, H.; Tollner, T.L.; Hu, Z.; Dai, M.; Li, X.; Guan, H.; Shan, D.; Zhang, X.; Lv, J.; Huang, C.; et al. The importance of mitochondrial metabolic activity and mitochondrial DNA replication during oocyte maturation in vitro on oocyte quality and subsequent embryo developmental competence. Mol. Reprod. Dev. 2012, 79, 392–401. [Google Scholar] [CrossRef]
  45. Van Blerkom, J.; Caltrider, K. Sperm attachment and penetration competence in the human oocyte: A possible aetiology of fertilization failure involving the organization of oolemmal lipid raft microdomains influenced by the ΔΨm of subplasmalemmal mitochondria. Reprod. Biomed. Online 2013, 27, 690–701. [Google Scholar] [CrossRef]
  46. Dalton, C.M.; Szabadkai, G.; Carroll, J. Measurement of ATP in single oocytes: Impact of maturation and cumulus cells on levels and consumption. J. Cell Physiol. 2014, 229, 353–361. [Google Scholar] [CrossRef] [PubMed]
  47. Lu, J.; Wang, Z.; Cao, J.; Chen, Y.; Dong, Y. A novel and compact review on the role of oxidative stress in female reproduction. Reprod. Biol. Endocrinol. 2018, 16, 80. [Google Scholar] [CrossRef] [PubMed]
  48. Huang, N.; Yu, Y.; Qiao, J. Dual role for the unfolded protein response in the ovary: Adaption and apoptosis. Protein Cell 2017, 8, 14–24. [Google Scholar] [CrossRef] [PubMed]
  49. Guzel, E.; Arlier, S.; Guzeloglu-Kayisli, O.; Tabak, M.S.; Ekiz, T.; Semerci, N.; Larsen, K.; Schatz, F.; Lockwood, C.J.; Kayisli, U.A. Endoplasmic Reticulum Stress and Homeostasis in Reproductive Physiology and Pathology. Int. J. Mol. Sci. 2017, 18, 792. [Google Scholar] [CrossRef]
  50. Walter, P.; Ron, D. The unfolded protein response: From stress pathway to homeostatic regulation. Science 2011, 334, 1081–1086. [Google Scholar] [CrossRef]
  51. Wang, M.; Kaufman, R.J. Protein misfolding in the endoplasmic reticulum as a conduit to human disease. Nature 2016, 529, 326–335. [Google Scholar] [CrossRef]
  52. Kim, P. Understanding the Unfolded Protein Response (UPR) Pathway: Insights into Neuropsychiatric Disorders and Therapeutic Potentials. Biomol. Ther. 2024, 32, 183–191. [Google Scholar] [CrossRef]
  53. Bhattarai, K.R.; Riaz, T.A.; Kim, H.R.; Chae, H.J. The aftermath of the interplay between the endoplasmic reticulum stress response and redox signaling. Exp. Mol. Med. 2021, 53, 151–167. [Google Scholar] [CrossRef]
  54. Khatun, H.; Wada, Y.; Konno, T.; Tatemoto, H.; Yamanaka, K.I. Endoplasmic reticulum stress attenuation promotes bovine oocyte maturation in vitro. Reproduction 2020, 159, 361–370. [Google Scholar] [CrossRef] [PubMed]
  55. Gwon, M.A.; Kim, M.J.; Kang, H.G.; Joo, Y.E.; Jeon, S.B.; Jeong, P.S.; Kim, S.U.; Sim, B.W.; Koo, D.B.; Song, B.S. Cadmium exposure impairs oocyte meiotic maturation by inducing endoplasmic reticulum stress in vitro maturation of porcine oocytes. Toxicol. Vitr. 2023, 91, 105615. [Google Scholar] [CrossRef]
  56. Panda, S.; Behera, S.; Alam, M.F.; Syed, G.H. Endoplasmic reticulum & mitochondrial calcium homeostasis: The interplay with viruses. Mitochondrion 2021, 58, 227–242. [Google Scholar] [CrossRef]
  57. Zhuan, Q.; Li, J.; Du, X.; Zhang, L.; Meng, L.; Luo, Y.; Zhou, D.; Liu, H.; Wan, P.; Hou, Y.; et al. Antioxidant procyanidin B2 protects oocytes against cryoinjuries via mitochondria regulated cortical tension. J. Anim. Sci. Biotechnol. 2022, 13, 95. [Google Scholar] [CrossRef]
  58. Russell, D.L.; Gilchrist, R.B.; Brown, H.M.; Thompson, J.G. Bidirectional communication between cumulus cells and the oocyte: Old hands and new players? Theriogenology 2016, 86, 62–68. [Google Scholar] [CrossRef] [PubMed]
  59. Fushii, M.; Yamada, R.; Lee, J.; Miyano, T. Reestablishment of transzonal projections and growth of bovine oocytes in vitro. J. Reprod. Dev. 2021, 67, 300–306. [Google Scholar] [CrossRef] [PubMed]
  60. Eppig, J. Mouse oocytes control metabolic co-operativity between oocytes and cumulus cells. Reprod. Fertil. Dev. 2005, 17, 1–2. [Google Scholar] [CrossRef]
  61. Clarke, H.J. Transzonal projections: Essential structures mediating intercellular communication in the mammalian ovarian follicle. Mol. Reprod. Dev. 2022, 89, 509–525. [Google Scholar] [CrossRef] [PubMed]
  62. Coticchio, G.; Dal Canto, M.; Mignini Renzini, M.; Guglielmo, M.C.; Brambillasca, F.; Turchi, D.; Novara, P.V.; Fadini, R. Oocyte maturation: Gamete-somatic cells interactions, meiotic resumption, cytoskeletal dynamics and cytoplasmic reorganization. Hum. Reprod. Update 2015, 21, 427–454. [Google Scholar] [CrossRef] [PubMed]
Antioxidants 15 00234 g001
Figure 1. Effects of BDNF on Sheep Oocyte Maturation, Cumulus Expansion, and Apoptosis-Related Gene Expression. (A) In vitro maturation status of the control and the BDNF-treated groups. Cumulus expansion in cumulus-oocyte complexes and first polar body (PBI) extrusion in denuded oocytes was observed under a stereomicroscope (Control, n = 103; 10 ng/mL BDNF, n = 119; 50 ng/mL BDNF, n = 122; 100 ng/mL BDNF, n = 129; three biological replicates in each group). Scale bars: 250 μm (left), 100 μm (right). (B) Cumulus expansion index (CEI). (C) PBI extrusion rate. (D) mRNA levels of cumulus expansion-related genes (five biological replicates in each group). (E) mRNA levels of apoptosis-related genes (five biological replicates in each group). * p < 0.05, ** p < 0.01. ns = no significance.
Figure 1. Effects of BDNF on Sheep Oocyte Maturation, Cumulus Expansion, and Apoptosis-Related Gene Expression. (A) In vitro maturation status of the control and the BDNF-treated groups. Cumulus expansion in cumulus-oocyte complexes and first polar body (PBI) extrusion in denuded oocytes was observed under a stereomicroscope (Control, n = 103; 10 ng/mL BDNF, n = 119; 50 ng/mL BDNF, n = 122; 100 ng/mL BDNF, n = 129; three biological replicates in each group). Scale bars: 250 μm (left), 100 μm (right). (B) Cumulus expansion index (CEI). (C) PBI extrusion rate. (D) mRNA levels of cumulus expansion-related genes (five biological replicates in each group). (E) mRNA levels of apoptosis-related genes (five biological replicates in each group). * p < 0.05, ** p < 0.01. ns = no significance.
Antioxidants 15 00234 g001
Antioxidants 15 00234 g002
Figure 2. ROS and GSH levels in mature sheep oocytes treated with BDNF. (A) Representative images of ROS in oocytes. Scale bar, 50 μm. (B) Fluorescence intensity of ROS signals (Control, n = 45; 50 ng/mL BDNF, n = 52; three biological replicates in each group). (C) Representative images of GSH in oocytes. Scale bar, 50 μm. (D) Fluorescence intensity of GSH signals (Control, n = 52; 50 ng/mL BDNF, n = 56; three biological replicates in each group). * p < 0.05, ** p < 0.01.
Figure 2. ROS and GSH levels in mature sheep oocytes treated with BDNF. (A) Representative images of ROS in oocytes. Scale bar, 50 μm. (B) Fluorescence intensity of ROS signals (Control, n = 45; 50 ng/mL BDNF, n = 52; three biological replicates in each group). (C) Representative images of GSH in oocytes. Scale bar, 50 μm. (D) Fluorescence intensity of GSH signals (Control, n = 52; 50 ng/mL BDNF, n = 56; three biological replicates in each group). * p < 0.05, ** p < 0.01.
Antioxidants 15 00234 g002
Antioxidants 15 00234 g003
Figure 3. BDNF enhances the antioxidant capacity of oocytes. (A) Representative images of the mitochondrial distribution in oocytes. Type I represents the proper distribution; Type II represents the abnormal distribution. Scale bar, 10 μm. (B) Mitochondrial distribution patterns (Control, n = 38; 50 ng/mL BDNF, n = 42; three biological replicates in each group). (C) Relative mRNA expression levels of antioxidant genes in oocytes analyzed by quantitative real-time PCR (five biological replicates in each group). * p < 0.05, ** p < 0.01. ns = no significance.
Figure 3. BDNF enhances the antioxidant capacity of oocytes. (A) Representative images of the mitochondrial distribution in oocytes. Type I represents the proper distribution; Type II represents the abnormal distribution. Scale bar, 10 μm. (B) Mitochondrial distribution patterns (Control, n = 38; 50 ng/mL BDNF, n = 42; three biological replicates in each group). (C) Relative mRNA expression levels of antioxidant genes in oocytes analyzed by quantitative real-time PCR (five biological replicates in each group). * p < 0.05, ** p < 0.01. ns = no significance.
Antioxidants 15 00234 g003
Antioxidants 15 00234 g004
Figure 4. BDNF enhances the mitochondrial function of matured sheep oocytes. (A) Representative images of the mitochondrial membrane potential of oocytes. The red fluorescence represents J aggregates, and the green fluorescence represents JC-1 monomers. The mitochondrial membrane potential is expressed as the ratio of red/green fluorescence intensity. Scale bar, 100 μm. (B) Quantitative analysis of the mitochondrial membrane potential (Control, n = 67; 50 ng/mL BDNF, n = 74; three biological replicates in each group). (C) Relative quantitative analysis of the ND5 mRNA levelin oocytes (five biological replicates in each group). * p < 0.05, ** p < 0.01.
Figure 4. BDNF enhances the mitochondrial function of matured sheep oocytes. (A) Representative images of the mitochondrial membrane potential of oocytes. The red fluorescence represents J aggregates, and the green fluorescence represents JC-1 monomers. The mitochondrial membrane potential is expressed as the ratio of red/green fluorescence intensity. Scale bar, 100 μm. (B) Quantitative analysis of the mitochondrial membrane potential (Control, n = 67; 50 ng/mL BDNF, n = 74; three biological replicates in each group). (C) Relative quantitative analysis of the ND5 mRNA levelin oocytes (five biological replicates in each group). * p < 0.05, ** p < 0.01.
Antioxidants 15 00234 g004
Antioxidants 15 00234 g005
Figure 5. BDNF alleviates endoplasmic reticulum stress (ERS) in mature sheep oocytes. (A) Representative images of the endoplasmic reticulum (ER) distribution in oocytes. Type I represents the proper distribution, and Type II represents the abnormal distribution. Scale bar, 10 μm. (B) Analysis of the ER distribution (Control, n = 32; 50 ng/mL BDNF, n = 38; three biological replicates in each group). (C) Relative levels of mRNA expression of ERS genes in oocytes detected by qRT-PCR (five biological replicates in each group). * p < 0.05, ** p < 0.01.
Figure 5. BDNF alleviates endoplasmic reticulum stress (ERS) in mature sheep oocytes. (A) Representative images of the endoplasmic reticulum (ER) distribution in oocytes. Type I represents the proper distribution, and Type II represents the abnormal distribution. Scale bar, 10 μm. (B) Analysis of the ER distribution (Control, n = 32; 50 ng/mL BDNF, n = 38; three biological replicates in each group). (C) Relative levels of mRNA expression of ERS genes in oocytes detected by qRT-PCR (five biological replicates in each group). * p < 0.05, ** p < 0.01.
Antioxidants 15 00234 g005
Antioxidants 15 00234 g006
Figure 6. The effect of BDNF on Ca2+ in sheep oocytes. (A) Representative images of fluorescent staining of [Ca2+]m, [Ca2+]i, and [Ca2+]ER. Scale bar, 50 μm. (B) Fluorescent intensity of [Ca2+]m (Control, n = 30; 50 ng/mL BDNF, n = 32). (C) Fluorescent intensity of [Ca2+]i (Control, n = 28; 50 ng/mL BDNF, n = 32; three biological replicates in each group). (D) Fluorescent intensity of [Ca2+]ER (Control, n = 34; 50 ng/mL BDNF, n = 33; three biological replicates in each group). ** p < 0.01. ns = no significance.
Figure 6. The effect of BDNF on Ca2+ in sheep oocytes. (A) Representative images of fluorescent staining of [Ca2+]m, [Ca2+]i, and [Ca2+]ER. Scale bar, 50 μm. (B) Fluorescent intensity of [Ca2+]m (Control, n = 30; 50 ng/mL BDNF, n = 32). (C) Fluorescent intensity of [Ca2+]i (Control, n = 28; 50 ng/mL BDNF, n = 32; three biological replicates in each group). (D) Fluorescent intensity of [Ca2+]ER (Control, n = 34; 50 ng/mL BDNF, n = 33; three biological replicates in each group). ** p < 0.01. ns = no significance.
Antioxidants 15 00234 g006
Antioxidants 15 00234 g007
Figure 7. BDNF affects TZP structure. (A) Representative images of transzonal projection (TZP) staining during the in vitro maturation (IVM) process. Scale bar, 5 μm. (B) Quantitative analysis of TZPs at each time point during IVM. The number of intact TZPs at each time point was compared (Control, n = 25; 50 ng/mL BDNF, n = 25; three biological replicates in each group). (C) Relative quantitative analysis of the mRNA levels of gap junction genes in cumulus cells (five biological replicates in each group). * p < 0.05; ** p < 0.01. ns = no significance.
Figure 7. BDNF affects TZP structure. (A) Representative images of transzonal projection (TZP) staining during the in vitro maturation (IVM) process. Scale bar, 5 μm. (B) Quantitative analysis of TZPs at each time point during IVM. The number of intact TZPs at each time point was compared (Control, n = 25; 50 ng/mL BDNF, n = 25; three biological replicates in each group). (C) Relative quantitative analysis of the mRNA levels of gap junction genes in cumulus cells (five biological replicates in each group). * p < 0.05; ** p < 0.01. ns = no significance.
Antioxidants 15 00234 g007
Antioxidants 15 00234 g008
Figure 8. The effect of BDNF treatment during in vitro maturation on the total number of blastocyst cells. (A) Representative images of the total number of blastocyst cells. Scale bar, 100 μm. (B) Bar chart of the total number of blastocyst cells (Control, n = 28; 50 ng/mL BDNF, n = 34; three biological replicates in each group). ** p < 0.01.
Figure 8. The effect of BDNF treatment during in vitro maturation on the total number of blastocyst cells. (A) Representative images of the total number of blastocyst cells. Scale bar, 100 μm. (B) Bar chart of the total number of blastocyst cells (Control, n = 28; 50 ng/mL BDNF, n = 34; three biological replicates in each group). ** p < 0.01.
Antioxidants 15 00234 g008
Table 1. Primer sequences for qRT-PCR.
Table 1. Primer sequences for qRT-PCR.
GenePrimer SequencesProduct Length (bp)Accession Numbers
β-actinF: GTCATCACCATCGGCAATGA
R: CGTGAATGCCGCAGGATT		71XM_060405599.1
GAPDHF: AGTGTCGCTGTTGAAGTCG
R: GAAACCTGCCAAGTATGATG		121NM_001190390.1
BAXF: GACAGGGGCCCTTTTGCTT
R: TCAGACACTCGCTCAGCTTC		128XM_027978592.3
BCL2F: ATGCCTTTGTGGAGCTGTATGG
R: ACTGAGCAGTGCCTTCAGAGACA		80XM_012103831.5
CASP3F: TTCAGAGGGGACTGTTGCAG
R: CAGTCCAGTTCTGTGCCTCG		83XM_060406953.1
CASP9F: CCAGAGGAGCTGAGAGTGATG
R: TTCCCTTGGCTCTGTCCTGAG		196XM_060396596.1
FASF: GCGACGGAGATATGCCAGAATG
R: AGGATGAGGAGGAGGAGGATCA		334NM_001123003.1
P53F: GGGTGGAAGGGAATTTACGC
R: CCACGAGAGTCTTCCAGTGT		199XM_042255225.2
ND5F: TAGCCCAAAATCTCCCACTCTC
R: CATCATTCCCTTGCGGTACTA		182NC_0091941.1
HAS2F: GGGTTCTTCCCTTTCTTTCT
R: CCACCCAGCTTTGTTTATTG		240XM_004011666.5
DUSP1F: GCCACCATCTGCCTCGCTTAC
R: GCTTCTCCTCTGCTTCACGAACTC		84XM_004016868.5
PTGESF: ACGACATGGAGACCATCTACC
R: TAGGCCACGGTGTGTATCAT		130XM_027966307.2
PTX3F: CTCTCTGGTCTGCAGTGTCG
R: TGTCCCACTCGGAGTTCTCA		144XM_004003220.5
TNFAIP6F: CAAGCAGTTAGAGGCAGCCAG
R: CTCCTTTGCATGTGGGTTGTAG		199XM_004004704.4
GJA1F: ATGAGCAGTCTGCCTTTCGT
R: TCTGCTTCAAGTGCATGTCC		249XM_004011159.5
GJA4F: CGACGAGCAGTCGGATTT
R: AGATGACATGGCCCAGGTAG		155XM_027967582.2
PRDX1F: CAGATGGTCAGTTCAAGGAT
R: CAGGTGACAGAAGTGAGAAT		191XM_004001918.4
CATF: CCATCTGAAAGACGCACAGC
R: ATGCGGGAGCCATACTCAG		84XM_060400055.1
GPX1F: GCAACCAGTTTGGGCATCAG
R: GCCATTCACCTCGCACTTTT		123XM_004018462.5
SOD2F: TCACAGCATCTTCTGGACAA
R: TGCTCCTTATTGAAGCCAAG		170NM_001280703.1
CHOP10F: AGGACCACCAGAGGTCACAC
R: TGCCACTTTCCTTTCGTTTT		193NM_001078163.1
GRP78F: TGAAACTGTGGGAGGTGTCA
R: TCGAAAGTTCCCAGAAGGTG		171XM_024998380.2
ATF4F: CGAGGTGTTTGTGGGGGACT
R: AGGAGCCTGCCTTAGCCTTG		149XM_012158819.3
Table 2. The effect of BDNF on early embryonic development of sheep oocytes.
Table 2. The effect of BDNF on early embryonic development of sheep oocytes.
GroupsNo. of OocytesNo. of Cleavages
(Mean ± SEM, %)		No. of Blastocysts
(Mean ± SEM, %)
Control198158 (79.80 ± 4.72) b47 (23.74 ± 0.70) b
50 ng/mL BDNF220195 (88.64 ± 3.90) a82 (37.27 ± 1.60) a
Note: Percentage of cleavages = No. of cleavages/No. of oocytes; Percentage of blastocysts = No. of blastocysts/No. of oocytes. Different superscript values of a and b represent significant differences between groups (p < 0.05). Each experiment was independently repeated five times.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, N.; Song, Y.; Han, X.; Zhang, N.; Zhang, J. BDNF Promotes In Vitro Maturation of Sheep Oocytes by Alleviating Oxidative Stress and Endoplasmic Reticulum Stress. Antioxidants 2026, 15, 234. https://doi.org/10.3390/antiox15020234

AMA Style

Zhang N, Song Y, Han X, Zhang N, Zhang J. BDNF Promotes In Vitro Maturation of Sheep Oocytes by Alleviating Oxidative Stress and Endoplasmic Reticulum Stress. Antioxidants. 2026; 15(2):234. https://doi.org/10.3390/antiox15020234

Chicago/Turabian Style

Zhang, Ning, Yukun Song, Xitong Han, Nan Zhang, and Jiaxin Zhang. 2026. "BDNF Promotes In Vitro Maturation of Sheep Oocytes by Alleviating Oxidative Stress and Endoplasmic Reticulum Stress" Antioxidants 15, no. 2: 234. https://doi.org/10.3390/antiox15020234

APA Style

Zhang, N., Song, Y., Han, X., Zhang, N., & Zhang, J. (2026). BDNF Promotes In Vitro Maturation of Sheep Oocytes by Alleviating Oxidative Stress and Endoplasmic Reticulum Stress. Antioxidants, 15(2), 234. https://doi.org/10.3390/antiox15020234

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop