Sauchinone Ameliorates Senescence Through Reducing Mitochondrial ROS Production
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Preparation of Compound Library
2.3. Flow Cytometric Analysis of Reactive Oxygen Species (ROS)
2.4. Cell Proliferation Assay
2.5. Determination of Cell Viability
2.6. Flow Cytometric Analysis of Mitochondrial Membrane Potential (MMP), Mitochondrial Mass, Lysosomal Mass and Autofluorescence
2.7. Analysis of the Extracellular Acidification Rate (ECAR)
2.8. Immunofluorescence
2.9. Analysis and Quantification of Autophagy Flux
2.10. Neutral Comet Assay
2.11. Quantitative Polymerase Chain Reaction (qPCR)
2.12. Transcriptome Expression Profiling
2.13. Preparation of shRNA
2.14. Lenti–Viral Production and Infection
2.15. Statistical Analysis
3. Results
3.1. Sauchinone Reduces Mitochondrial ROS Levels in Senescent Fibroblasts
3.2. Restoration of Mitochondrial Function by Sauchinone in Senescent Fibroblasts
3.3. Sauchinone Removes Dysfunctional Mitochondria Through Mitophagy
3.4. Sauchinone Rejuvenates Senescence-Associated Phenotypes
3.5. Identification of VAMP8 as a Key Regulator in Sauchinone-Induced ROS Reduction
3.6. VAMP8 Knockdown Reduces Mitochondrial ROS Levels and Restores Mitochondrial Function
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hayflick, L. The limited in vitro lifetime of human diploid cell strains. Exp. Cell Res. 1965, 37, 614–636. [Google Scholar] [CrossRef] [PubMed]
- Ziegler, D.V.; Wiley, C.D.; Velarde, M.C. Mitochondrial effectors of cellular senescence: Beyond the free radical theory of aging. Aging Cell 2015, 14, 1–7. [Google Scholar] [CrossRef]
- Childs, B.G.; Durik, M.; Baker, D.J.; van Deursen, J.M. Cellular senescence in aging and age-related disease: From mechanisms to therapy. Nat. Med. 2015, 21, 1424–1435. [Google Scholar] [CrossRef]
- Hwang, E.; Yoon, G.; Kang, H. A comparative analysis of the cell biology of senescence and aging. Cell. Mol. Life Sci. 2009, 66, 2503–2524. [Google Scholar] [CrossRef] [PubMed]
- Boffoli, D.; Scacco, S.C.; Vergari, R.; Solarino, G.; Santacroce, G.; Papa, S. Decline with age of the respiratory chain activity in human skeletal muscle. Biochim. Biophys. Acta (BBA) Mol. Basis Dis. 1994, 1226, 73–82. [Google Scholar] [CrossRef]
- Zorov, D.B.; Juhaszova, M.; Sollott, S.J. Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release. Physiol. Rev. 2014, 94, 909–950. [Google Scholar] [CrossRef]
- Stohs, S.J. The Role of Free Radicals in Toxicity and Disease. J. Basic. Clin. Physiol. Pharmacol. 1995, 6, 205–228. [Google Scholar] [CrossRef] [PubMed]
- Gutowski, M.; Kowalczyk, S. A study of free radical chemistry: Their role and pathophysiological significance. Acta Biochim. Pol. 2013, 60, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Javadi, A.; Nikhbakht, M.R.; Ghasemian Yadegari, J.; Rustamzadeh, A.; Mohammadi, M.; Shirazinejad, A.; Azadbakht, S.; Abdi, Z. In-vivo and in vitro assessments of the radioprotective potential natural and chemical compounds: A review. Int. J. Radiat. Biol. 2023, 99, 155–165. [Google Scholar] [CrossRef]
- Li, Z.; Xu, X.; Leng, X.; He, M.; Wang, J.; Cheng, S.; Wu, H. Roles of reactive oxygen species in cell signaling pathways and immune responses to viral infections. Arch. Virol. 2017, 162, 603–610. [Google Scholar] [CrossRef]
- Ježek, P.; Hlavatá, L. Mitochondria in homeostasis of reactive oxygen species in cell, tissues, and organism. Int. J. Biochem. Cell Biol. 2005, 37, 2478–2503. [Google Scholar] [CrossRef] [PubMed]
- Dan Dunn, J.; Alvarez, L.A.J.; Zhang, X.; Soldati, T. Reactive oxygen species and mitochondria: A nexus of cellular homeostasis. Redox Biol. 2015, 6, 472–485. [Google Scholar] [CrossRef] [PubMed]
- Rahman, T.; Hosen, I.; Islam, M.; Shekhar, H. Oxidative stress and human health. Adv. Biosci. Biotechnol. 2012, 3, 997–1019. [Google Scholar] [CrossRef]
- Birben, E.; Sahiner, U.M.; Sackesen, C.; Erzurum, S.; Kalayci, O. Oxidative Stress and Antioxidant Defense. World Allergy Organ. J. 2012, 5, 9–19. [Google Scholar] [CrossRef]
- Bisht, S.; Dada, R. Oxidative stress: Major executioner in disease pathology, role in sperm DNA damage and preventive strategies. Front. Biosci. (Sch. Ed.) 2017, 9, 420–447. [Google Scholar] [CrossRef]
- Kowalczyk, P.; Sulejczak, D.; Kleczkowska, P.; Bukowska-Ośko, I.; Kucia, M.; Popiel, M.; Wietrak, E.; Kramkowski, K.; Wrzosek, K.; Kaczyńska, K. Mitochondrial Oxidative Stress—A Causative Factor and Therapeutic Target in Many Diseases. Int. J. Mol. Sci. 2021, 22, 13384. [Google Scholar] [CrossRef]
- Chandrasekaran, A.; Idelchik, M.d.P.S.; Melendez, J.A. Redox control of senescence and age-related disease. Redox Biol. 2017, 11, 91–102. [Google Scholar] [CrossRef] [PubMed]
- Elfawy, H.A.; Das, B. Crosstalk between mitochondrial dysfunction, oxidative stress, and age related neurodegenerative disease: Etiologies and therapeutic strategies. Life Sci. 2019, 218, 165–184. [Google Scholar] [CrossRef] [PubMed]
- Iakovou, E.; Kourti, M. A Comprehensive Overview of the Complex Role of Oxidative Stress in Aging, The Contributing Environmental Stressors and Emerging Antioxidant Therapeutic Interventions. Front. Aging Neurosci. 2022, 14, 827900. [Google Scholar] [CrossRef]
- Kudryavtseva, A.V.; Krasnov, G.S.; Dmitriev, A.A.; Alekseev, B.Y.; Kardymon, O.L.; Sadritdinova, A.F.; Fedorova, M.S.; Pokrovsky, A.V.; Melnikova, N.V.; Kaprin, A.D.; et al. Mitochondrial dysfunction and oxidative stress in aging and cancer. Oncotarget 2016, 7, 44879–44905. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.; Manton, K.G. The role of oxidative damage in mitochondria during aging: A review. Front. Biosci. 2004, 9, 1100–1117. [Google Scholar] [CrossRef] [PubMed]
- Wei, Y.H.; Lu, C.Y.; Wei, C.Y.; Ma, Y.S.; Lee, H.C. Oxidative stress in human aging and mitochondrial disease-consequences of defective mitochondrial respiration and impaired antioxidant enzyme system. Chin. J. Physiol. 2001, 44, 1–11. [Google Scholar]
- Cosín-Tomàs, M.; Senserrich, J.; Arumí-Planas, M.; Alquézar, C.; Pallàs, M.; Martín-Requero, Á.; Suñol, C.; Kaliman, P.; Sanfeliu, C. Role of Resveratrol and Selenium on Oxidative Stress and Expression of Antioxidant and Anti-Aging Genes in Immortalized Lymphocytes from Alzheimer’s Disease Patients. Nutrients 2019, 11, 1764. [Google Scholar] [CrossRef] [PubMed]
- Dato, S.; Crocco, P.; D’Aquila, P.; de Rango, F.; Bellizzi, D.; Rose, G.; Passarino, G. Exploring the role of genetic variability and lifestyle in oxidative stress response for healthy aging and longevity. Int. J. Mol. Sci. 2013, 14, 16443–16472. [Google Scholar] [CrossRef]
- Jomova, K.; Raptova, R.; Alomar, S.Y.; Alwasel, S.H.; Nepovimova, E.; Kuca, K.; Valko, M. Reactive oxygen species, toxicity, oxidative stress, and antioxidants: Chronic diseases and aging. Arch. Toxicol. 2023, 97, 2499–2574. [Google Scholar] [CrossRef] [PubMed]
- Isah, T. Stress and defense responses in plant secondary metabolites production. Biol. Res. 2019, 52, 39. [Google Scholar] [CrossRef]
- Weremczuk-Jeżyna, I.; Hnatuszko-Konka, K.; Lebelt, L.; Grzegorczyk-Karolak, I. The Protective Function and Modification of Secondary Metabolite Accumulation in Response to Light Stress in Dracocephalum forrestii Shoots. Int. J. Mol. Sci. 2021, 22, 7965. [Google Scholar] [CrossRef] [PubMed]
- Choi, Y.; Moon, A.; Kim, Y.C. A pinusolide derivative, 15-methoxypinusolidic acid from Biota orientalis inhibits inducible nitric oxide synthase in microglial cells: Implication for a potential anti-inflammatory effect. Int. Immunopharmacol. 2008, 8, 548–555. [Google Scholar] [CrossRef]
- Yoon, J.J.; Lee, H.K.; Kim, H.Y.; Han, B.H.; Lee, H.S.; Lee, Y.J.; Kang, D.G. Sauchinone Protects Renal Mesangial Cell Dysfunction against Angiotensin II by Improving Renal Fibrosis and Inflammation. Int. J. Mol. Sci. 2020, 21, 7003. [Google Scholar] [CrossRef]
- Lim, D.W.; Lee, C.; Kim, I.H.; Kim, Y.T. Anti-inflammatory effects of total isoflavones from Pueraria lobata on cerebral ischemia in rats. Molecules 2013, 18, 10404–10412. [Google Scholar] [CrossRef] [PubMed]
- Yoon, J.H.; Kim, Y.H.; Jeong, E.Y.; Lee, Y.H.; Byun, Y.; Shin, S.S.; Park, J.T. Senescence Rejuvenation through Reduction in Mitochondrial Reactive Oxygen Species Generation by Polygonum cuspidatum Extract: In Vitro Evidence. Antioxidants 2024, 13, 1110. [Google Scholar] [CrossRef] [PubMed]
- Liga, S.; Paul, C. Puerarin—A Promising Flavonoid: Biosynthesis, Extraction Methods, Analytical Techniques, and Biological Effects. Int. J. Mol. Sci. 2024, 25, 5222. [Google Scholar] [CrossRef]
- Huang, L.C.; Lin, W.; Yagami, M.; Tseng, D.; Miyashita-Lin, E.; Singh, N.; Lin, A.; Shih, S.J. Validation of cell density and viability assays using Cedex automated cell counter. Biologicals 2010, 38, 393–400. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.H.; Choi, D.; Jang, G.; Park, J.Y.; Song, E.S.; Lee, H.; Kuk, M.U.; Joo, J.; Ahn, S.K.; Byun, Y.; et al. Targeting regulation of ATP synthase 5 alpha/beta dimerization alleviates senescence. Aging 2022, 14, 678–707. [Google Scholar] [CrossRef]
- Kang, H.T.; Park, J.T.; Choi, K.; Kim, Y.; Choi, H.J.C.; Jung, C.W.; Lee, Y.S.; Park, S.C. Chemical screening identifies ATM as a target for alleviating senescence. Nat. Chem. Biol. 2017, 13, 616–623. [Google Scholar] [CrossRef] [PubMed]
- Kuk, M.U.; Kim, D.; Lee, Y.H.; Yoon, J.H.; Park, J.H.; Lee, Y.J.; So, B.H.; Kim, M.; Kwon, H.W.; Byun, Y.; et al. Synergistic ROS Reduction Through the Co-Inhibition of BRAF and p38 MAPK Ameliorates Senescence. Antioxidants 2024, 13, 1465. [Google Scholar] [CrossRef]
- Li, B.; Lee, D.S.; Choi, H.G.; Kim, K.S.; Kang, D.G.; Lee, H.S.; Jeong, G.S.; Kim, Y.C. Sauchinone suppresses pro-inflammatory mediators by inducing heme oxygenase-1 in RAW264.7 macrophages. Biol. Pharm. Bull. 2011, 34, 1566–1571. [Google Scholar] [CrossRef] [PubMed]
- Yuan, Y.; Zhou, H.; Wu, Q.Q.; Li, F.F.; Bian, Z.Y.; Deng, W.; Zhou, M.Q.; Tang, Q.Z. Puerarin attenuates the inflammatory response and apoptosis in LPS-stimulated cardiomyocytes. Exp. Ther. Med. 2016, 11, 415–420. [Google Scholar] [CrossRef]
- Henderson, L.M.; Chappell, J.B. Dihydrorhodamine 123: A fluorescent probe for superoxide generation? Eur. J. Biochem. 1993, 217, 973–980. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Yu, H.; Man, M.Q.; Hu, L. Aging in the dermis: Fibroblast senescence and its significance. Aging Cell 2024, 23, e14054. [Google Scholar] [CrossRef] [PubMed]
- Jeon, Y.D.; Lee, J.H.; Lee, Y.M.; Kim, D.K. Puerarin inhibits inflammation and oxidative stress in dextran sulfate sodium-induced colitis mice model. Biomed. Pharmacother. 2020, 124, 109847. [Google Scholar] [CrossRef]
- Poivre, M.; Duez, P. Biological activity and toxicity of the Chinese herb Magnolia officinalis Rehder & E. Wilson (Houpo) and its constituents. J. Zhejiang Univ. Sci. B 2017, 18, 194–214. [Google Scholar] [CrossRef]
- Romar, G.A.; Kupper, T.S.; Divito, S.J. Research Techniques Made Simple: Techniques to Assess Cell Proliferation. J. Investig. Dermatol. 2016, 136, e1–e7. [Google Scholar] [CrossRef]
- Hansen, J.; Bross, P. A cellular viability assay to monitor drug toxicity. Methods Mol. Biol. 2010, 648, 303–311. [Google Scholar] [CrossRef]
- Turrens, J.F. Mitochondrial formation of reactive oxygen species. J. Physiol. 2003, 552, 335–344. [Google Scholar] [CrossRef]
- Sherratt, H.S. Mitochondria: Structure and function. Rev. Neurol. 1991, 147, 417–430. [Google Scholar]
- Miwa, S.; Kashyap, S.; Chini, E.; von Zglinicki, T. Mitochondrial dysfunction in cell senescence and aging. J. Clin. Investig. 2022, 132, e158447. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, P.; Moyle, J. Chemiosmotic hypothesis of oxidative phosphorylation. Nature 1967, 213, 137–139. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.H.; Park, J.Y.; Lee, H.; Song, E.S.; Kuk, M.U.; Joo, J.; Oh, S.; Kwon, H.W.; Park, J.T.; Park, S.C. Targeting Mitochondrial Metabolism as a Strategy to Treat Senescence. Cells 2021, 10, 3003. [Google Scholar] [CrossRef] [PubMed]
- Mookerjee, S.A.; Nicholls, D.G.; Brand, M.D. Determining Maximum Glycolytic Capacity Using Extracellular Flux Measurements. PLoS ONE 2016, 11, e0152016. [Google Scholar] [CrossRef] [PubMed]
- Rabinowitz, J.D.; Enerbäck, S. Lactate: The ugly duckling of energy metabolism. Nat. Metab. 2020, 2, 566–571. [Google Scholar] [CrossRef]
- Li, X.; Yang, Y.; Zhang, B.; Lin, X.; Fu, X.; An, Y.; Zou, Y.; Wang, J.-X.; Wang, Z.; Yu, T. Lactate metabolism in human health and disease. Signal Transduct. Target. Ther. 2022, 7, 305. [Google Scholar] [CrossRef] [PubMed]
- Picca, A.; Faitg, J.; Auwerx, J.; Ferrucci, L.; D’Amico, D. Mitophagy in human health, ageing and disease. Nat. Metab. 2023, 5, 2047–2061. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Klionsky, D.J. Mitochondria removal by autophagy. Autophagy 2011, 7, 297–300. [Google Scholar] [CrossRef] [PubMed]
- Hanna, R.A.; Quinsay, M.N.; Orogo, A.M.; Giang, K.; Rikka, S.; Gustafsson, Å.B. Microtubule-associated protein 1 light chain 3 (LC3) interacts with Bnip3 protein to selectively remove endoplasmic reticulum and mitochondria via autophagy. J. Biol. Chem. 2012, 287, 19094–19104. [Google Scholar] [CrossRef] [PubMed]
- Shintani, T.; Klionsky, D.J. Autophagy in health and disease: A double-edged sword. Science 2004, 306, 990–995. [Google Scholar] [CrossRef] [PubMed]
- Kuk, M.U.; Lee, H.; Song, E.S.; Lee, Y.H.; Park, J.Y.; Jeong, S.; Kwon, H.W.; Byun, Y.; Park, S.C.; Park, J.T. Functional restoration of lysosomes and mitochondria through modulation of AKT activity ameliorates senescence. Exp. Gerontol. 2023, 173, 112091. [Google Scholar] [CrossRef]
- Park, J.Y.; Lee, H.; Song, E.S.; Lee, Y.H.; Kuk, M.U.; Ko, G.; Kwon, H.W.; Byun, Y.; Park, J.T. Restoration of Lysosomal and Mitochondrial Function Through p38 Mitogen-Activated Protein Kinase Inhibition Ameliorates Senescence. Rejuvenation Res. 2022, 25, 291–299. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.W.; Kuk, M.U.; Choy, H.E.; Park, S.C.; Park, J.T. Mitochondrial metabolic reprograming via BRAF inhibition ameliorates senescence. Exp. Gerontol. 2019, 126, 110691. [Google Scholar] [CrossRef] [PubMed]
- Checa, J.; Aran, J.M. Reactive Oxygen Species: Drivers of Physiological and Pathological Processes. J. Inflamm. Res. 2020, 13, 1057–1073. [Google Scholar] [CrossRef] [PubMed]
- González-Gualda, E.; Baker, A.G.; Fruk, L.; Muñoz-Espín, D. A guide to assessing cellular senescence in vitro and in vivo. FEBS J. 2021, 288, 56–80. [Google Scholar] [CrossRef] [PubMed]
- Huang, W.; Hickson, L.J.; Eirin, A.; Kirkland, J.L.; Lerman, L.O. Cellular senescence: The good, the bad and the unknown. Nat. Rev. Nephrol. 2022, 18, 611–627. [Google Scholar] [CrossRef] [PubMed]
- Tohma, H.; Hepworth, A.R.; Shavlakadze, T.; Grounds, M.D.; Arthur, P.G. Quantification of Ceroid and Lipofuscin in Skeletal Muscle. J. Histochem. Cytochem. 2011, 59, 769–779. [Google Scholar] [CrossRef]
- Brunk, U.T.; Terman, A. Lipofuscin: Mechanisms of age-related accumulation and influence on cell function. Free Radic. Biol. Med. 2002, 33, 611–619. [Google Scholar] [CrossRef]
- Freund, A.; Laberge, R.M.; Demaria, M.; Campisi, J. Lamin B1 loss is a senescence-associated biomarker. Mol. Biol. Cell 2012, 23, 2066–2075. [Google Scholar] [CrossRef]
- Wang, A.S.; Ong, P.F.; Chojnowski, A.; Clavel, C.; Dreesen, O. Loss of lamin B1 is a biomarker to quantify cellular senescence in photoaged skin. Sci. Rep. 2017, 7, 15678. [Google Scholar] [CrossRef] [PubMed]
- Golubtsova, N.N.; Filippov, F.N.; Gunin, A.G. Lamin B1 and lamin B2 in human skin in the process of aging. Adv. Gerontol. 2016, 29, 222–228. [Google Scholar] [CrossRef]
- Dingjan, I.; Paardekooper, L.M.; Verboogen, D.R.J.; von Mollard, G.F.; Ter Beest, M.; van den Bogaart, G. VAMP8-mediated NOX2 recruitment to endosomes is necessary for antigen release. Eur. J. Cell Biol. 2017, 96, 705–714. [Google Scholar] [CrossRef]
- Lee, H.C.; Yin, P.H.; Chi, C.W.; Wei, Y.H. Increase in mitochondrial mass in human fibroblasts under oxidative stress and during replicative cell senescence. J. Biomed. Sci. 2002, 9, 517–526. [Google Scholar] [CrossRef] [PubMed]
- Passos, J.F.; Saretzki, G.; Ahmed, S.; Nelson, G.; Richter, T.; Peters, H.; Wappler, I.; Birket, M.J.; Harold, G.; Schaeuble, K.; et al. Mitochondrial dysfunction accounts for the stochastic heterogeneity in telomere-dependent senescence. PLoS Biol. 2007, 5, e110. [Google Scholar] [CrossRef] [PubMed]
- Tirichen, H.; Yaigoub, H.; Xu, W.; Wu, C.; Li, R.; Li, Y. Mitochondrial Reactive Oxygen Species and Their Contribution in Chronic Kidney Disease Progression Through Oxidative Stress. Front. Physiol. 2021, 12, 627837. [Google Scholar] [CrossRef]
- Choksi, K.B.; Nuss, J.E.; Deford, J.H.; Papaconstantinou, J. Age-related alterations in oxidatively damaged proteins of mouse skeletal muscle mitochondrial electron transport chain complexes. Free Radic. Biol. Med. 2008, 45, 826–838. [Google Scholar] [CrossRef]
- Choksi, K.B.; Boylston, W.H.; Rabek, J.P.; Widger, W.R.; Papaconstantinou, J. Oxidatively damaged proteins of heart mitochondrial electron transport complexes. Biochim. Biophys. Acta 2004, 1688, 95–101. [Google Scholar] [CrossRef]
- Nakai, K.; Tsuruta, D. What Are Reactive Oxygen Species, Free Radicals, and Oxidative Stress in Skin Diseases? Int. J. Mol. Sci. 2021, 22, 10799. [Google Scholar] [CrossRef]
- Lee, Y.H.; Kuk, M.U.; So, M.K.; Song, E.S.; Lee, H.; Ahn, S.K.; Kwon, H.W.; Park, J.T.; Park, S.C. Targeting Mitochondrial Oxidative Stress as a Strategy to Treat Aging and Age-Related Diseases. Antioxidants 2023, 12, 934. [Google Scholar] [CrossRef] [PubMed]
- Stout, R.; Birch-Machin, M.A. Mitochondria’s Role in Skin Ageing. Biology 2019, 8, 29. [Google Scholar] [CrossRef]
- Nolfi-Donegan, D.; Braganza, A.; Shiva, S. Mitochondrial electron transport chain: Oxidative phosphorylation, oxidant production, and methods of measurement. Redox Biol. 2020, 37, 101674. [Google Scholar] [CrossRef]
- Zhao, R.Z.; Jiang, S.; Zhang, L.; Yu, Z.B. Mitochondrial electron transport chain, ROS generation and uncoupling (Review). Int. J. Mol. Med. 2019, 44, 3–15. [Google Scholar] [CrossRef]
- Liu, S.; Yao, S.; Yang, H.; Liu, S.; Wang, Y. Autophagy: Regulator of cell death. Cell Death Dis. 2023, 14, 648. [Google Scholar] [CrossRef]
- Salminen, A.; Kaarniranta, K. Regulation of the aging process by autophagy. Trends Mol. Med. 2009, 15, 217–224. [Google Scholar] [CrossRef]
- Charlton, N.C.; Mastyugin, M.; Török, B.; Török, M. Structural Features of Small Molecule Antioxidants and Strategic Modifications to Improve Potential Bioactivity. Molecules 2023, 28, 1057. [Google Scholar] [CrossRef]
- Inchingolo, A.D.; Inchingolo, A.M.; Malcangi, G.; Avantario, P.; Azzollini, D.; Buongiorno, S.; Viapiano, F.; Campanelli, M.; Ciocia, A.M.; De Leonardis, N.; et al. Effects of Resveratrol, Curcumin and Quercetin Supplementation on Bone Metabolism—A Systematic Review. Nutrients 2022, 14, 3519. [Google Scholar] [CrossRef]
- Košinová, P.; Berka, K.; Wykes, M.; Otyepka, M.; Trouillas, P. Positioning of Antioxidant Quercetin and Its Metabolites in Lipid Bilayer Membranes: Implication for Their Lipid-Peroxidation Inhibition. J. Phys. Chem. B 2012, 116, 1309–1318. [Google Scholar] [CrossRef] [PubMed]
- Rossi, M.; Caruso, F.; Antonioletti, R.; Viglianti, A.; Traversi, G.; Leone, S.; Basso, E.; Cozzi, R. Scavenging of hydroxyl radical by resveratrol and related natural stilbenes after hydrogen peroxide attack on DNA. Chem. Biol. Interact. 2013, 206, 175–185. [Google Scholar] [CrossRef] [PubMed]
- Fabris, S.; Momo, F.; Ravagnan, G.; Stevanato, R. Antioxidant properties of resveratrol and piceid on lipid peroxidation in micelles and monolamellar liposomes. Biophys. Chem. 2008, 135, 76–83. [Google Scholar] [CrossRef]
- Santiko, E.B.; Babu, S.B.; Zhang, F.; Wu, C.-L.; Lin, T.-C.; Abe, M. Synthesis, Characterization, and Application of a Cyclic Stilbene Derivative with Simultaneous Two-photon Absorption Character. Chem. Lett. 2023, 52, 846–849. [Google Scholar] [CrossRef]
- Park, G.; Kim, H.G.; Sim, Y.; Sung, S.H.; Oh, M.S. Sauchinone, a lignan from Saururus chinensis, protects human skin keratinocytes against ultraviolet B-induced photoaging by regulating the oxidative defense system. Biol. Pharm. Bull. 2013, 36, 1134–1139. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Zou, Y.; Peng, T.; Wang, G.; Wen, X.; Liu, S.; Sun, Y.; Zhang, S.; Gao, Y.; Wang, L. A new strategy for isoflavone C-glycoside synthesis: The total synthesis of puerarin. J. Carbohydr. Chem. 2018, 37, 461–470. [Google Scholar] [CrossRef]
- Juan, C.A.; Pérez de la Lastra, J.M.; Plou, F.J.; Pérez-Lebeña, E. The Chemistry of Reactive Oxygen Species (ROS) Revisited: Outlining Their Role in Biological Macromolecules (DNA, Lipids and Proteins) and Induced Pathologies. Int. J. Mol. Sci. 2021, 22, 4642. [Google Scholar] [CrossRef]
- Feshin, V.P.; Feshina, E.V. Influence of the Lone Electron Pairs of the Ether Oxygen Atom on the Electron Density Distribution in α-Chloro Ethers. Russ. J. Gen. Chem. 2001, 71, 1793–1796. [Google Scholar] [CrossRef]
- Ronsisvalle, S.; Panarello, F.; Longhitano, G.; Siciliano, E.A.; Montenegro, L.; Panico, A. Natural Flavones and Flavonols: Relationships among Antioxidant Activity, Glycation, and Metalloproteinase Inhibition. Cosmetics 2020, 7, 71. [Google Scholar] [CrossRef]
- Paredes-Gonzalez, X.; Fuentes, F.; Su, Z.Y.; Kong, A.N. Apigenin reactivates Nrf2 anti-oxidative stress signaling in mouse skin epidermal JB6 P + cells through epigenetics modifications. Aaps J. 2014, 16, 727–735. [Google Scholar] [CrossRef] [PubMed]
- Peng-fei, L.; Fu-gen, H.; Bin-bin, D.; Tian-sheng, D.; Xiang-lin, H.; Ming-qin, Z. Purification and antioxidant activities of baicalin isolated from the root of huangqin (Scutellaria baicalensis gcorsi). J. Food Sci. Technol. 2013, 50, 615–619. [Google Scholar] [CrossRef] [PubMed]
- Hu, Q.; Hou, S.; Xiong, B.; Wen, Y.; Wang, J.; Zeng, J.; Ma, X.; Wang, F. Therapeutic Effects of Baicalin on Diseases Related to Gut-Brain Axis Dysfunctions. Molecules 2023, 28, 6501. [Google Scholar] [CrossRef]
- Guo, L.T.; Wang, S.Q.; Su, J.; Xu, L.X.; Ji, Z.Y.; Zhang, R.Y.; Zhao, Q.W.; Ma, Z.Q.; Deng, X.Y.; Ma, S.P. Baicalin ameliorates neuroinflammation-induced depressive-like behavior through inhibition of toll-like receptor 4 expression via the PI3K/AKT/FoxO1 pathway. J. Neuroinflamm. 2019, 16, 95. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Pitcher, L.E.; Yousefzadeh, M.J.; Niedernhofer, L.J.; Robbins, P.D.; Zhu, Y. Cellular senescence: A key therapeutic target in aging and diseases. J. Clin. Investig. 2022, 132, e158450. [Google Scholar] [CrossRef]
- Kirkland, J.L.; Tchkonia, T. Senolytic drugs: From discovery to translation. J. Intern. Med. 2020, 288, 518–536. [Google Scholar] [CrossRef]
- Zhang, L.; Pitcher, L.E.; Prahalad, V.; Niedernhofer, L.J.; Robbins, P.D. Targeting cellular senescence with senotherapeutics: Senolytics and senomorphics. FEBS J. 2023, 290, 1362–1383. [Google Scholar] [CrossRef]
- Blagosklonny, M.V. Paradoxes of senolytics. Aging 2018, 10, 4289–4293. [Google Scholar] [CrossRef]
- Zoico, E.; Nori, N.; Darra, E.; Tebon, M.; Rizzatti, V.; Policastro, G.; De Caro, A.; Rossi, A.P.; Fantin, F.; Zamboni, M. Senolytic effects of quercetin in an in vitro model of pre-adipocytes and adipocytes induced senescence. Sci. Rep. 2021, 11, 23237. [Google Scholar] [CrossRef] [PubMed]
- Chen, R.; Lin, J.; Hong, J.; Han, D.; Zhang, A.D.; Lan, R.; Fu, L.; Wu, Z.; Lin, J.; Zhang, W.; et al. Potential toxicity of quercetin: The repression of mitochondrial copy number via decreased POLG expression and excessive TFAM expression in irradiated murine bone marrow. Toxicol. Rep. 2014, 1, 450–458. [Google Scholar] [CrossRef]
- Buczyńska, A.; Sidorkiewicz, I.; Krętowski, A.J.; Adamska, A. Examining the clinical relevance of metformin as an antioxidant intervention. Front. Pharmacol. 2024, 15, 1330797. [Google Scholar] [CrossRef]
- Le Pelletier, L.; Mantecon, M.; Gorwood, J.; Auclair, M.; Foresti, R.; Motterlini, R.; Laforge, M.; Atlan, M.; Fève, B.; Capeau, J.; et al. Metformin alleviates stress-induced cellular senescence of aging human adipose stromal cells and the ensuing adipocyte dysfunction. eLife 2021, 10, e62635. [Google Scholar] [CrossRef] [PubMed]
- Soukas, A.A.; Hao, H.; Wu, L. Metformin as Anti-Aging Therapy: Is It for Everyone? Trends Endocrinol. Metab. 2019, 30, 745–755. [Google Scholar] [CrossRef] [PubMed]
Target | Orientation | Sequence (5′–3′) | Size (bp) |
---|---|---|---|
36B4 (Accession number: NM_053275) | Forward | CAGCAAGTGGGAAGGTGTAATCC | 23 |
Reverse | CCCATTCTATCATCAACGGGTACAA | 25 | |
p16 (Accession number: NM_000077.5) | Forward | CTCGTGCTGATGCTACTGAGGA | 22 |
Reverse | GGTCGGCGCAGTTGGGCTCC | 20 | |
Lamin A (Accession number: NM_170707) | Forward | ATGAGGACCAGGTGGAGCAGTA | 22 |
Reverse | ACCAGGTTGCTGTTCCTCTCAG | 22 | |
Lamin B1 (Accession number: NM_005573) | Forward | GAGAGCAACATGATGCCCAAGTG | 23 |
Reverse | GTTCTTCCCTGGCACTGTTGAC | 22 | |
Lamin B2 (Accession number: NM_032737) | Forward | AGAAGTCCTCGGTGATGCGTGA | 22 |
Reverse | CATCACGTAGCAGCCTCTTGAG | 22 | |
VAMP8 (Accession number: NM_003761) | Forward | AAGGTGGAGGAAATGATCTGGTG | 23 |
Reverse | GGAGGGAGTTAAGAATATTATGACCCAGAAT | 31 |
Target | Orientation | Sequence (5′–3′) | Size (bp) |
---|---|---|---|
VAMP8 shRNA (1) | Forward | CCGGGTGGAGGGAGTTAAGAATATTTTCAAGAGAAATATTCTTAACTCCCTCCACTTTTTG | 61 |
Reverse | AATTCAAAAAGTGGAGGGAGTTAAGAATATTTTCAAGAGAAATATTCTTAACTCCCTCCAC | 61 | |
VAMP8 shRNA (2) | Forward | CCGGGCCACTGGTGCCTTCTCTTAATTCAAGAGATTAAGAGAAGGCACCAGTGGCTTTTTG | 61 |
Reverse | AATTCAAAAAGCCACTGGTGCCTTCTCTTAATTCAAGAGATTAAGAGAAGGCACCAGTGGC | 61 | |
VAMP8 shRNA (3) | Forward | CCGGGCCAGTGAAGGTGGAGGAAATTTCAAGAGAATTTCCTCCACCTTCACTGGCTTTTTG | 61 |
Reverse | AATTCAAAAAGCCAGTGAAGGTGGAGGAAATTTCAAGAGAATTTCCTCCACCTTCACTGGC | 61 |
Compound Name | Structure | Molecular Formula | Bioactivity |
---|---|---|---|
Molecular Weight (Da) | |||
Pinusolide | C21H30O4 | Anti-inflammation [28] | |
346.46 | |||
Sauchinone | C20H20O6 | Anti-inflammation and antioxidants [29] | |
356.37 | |||
Puerarin | C21H20O9 | Anti-inflammation and antioxidants [41] | |
416.38 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kuk, M.U.; Lee, Y.H.; Kim, D.; Lee, K.S.; Park, J.H.; Yoon, J.H.; Lee, Y.J.; So, B.; Kim, M.; Kwon, H.W.; et al. Sauchinone Ameliorates Senescence Through Reducing Mitochondrial ROS Production. Antioxidants 2025, 14, 259. https://doi.org/10.3390/antiox14030259
Kuk MU, Lee YH, Kim D, Lee KS, Park JH, Yoon JH, Lee YJ, So B, Kim M, Kwon HW, et al. Sauchinone Ameliorates Senescence Through Reducing Mitochondrial ROS Production. Antioxidants. 2025; 14(3):259. https://doi.org/10.3390/antiox14030259
Chicago/Turabian StyleKuk, Myeong Uk, Yun Haeng Lee, Duyeol Kim, Kyeong Seon Lee, Ji Ho Park, Jee Hee Yoon, Yoo Jin Lee, Byeonghyeon So, Minseon Kim, Hyung Wook Kwon, and et al. 2025. "Sauchinone Ameliorates Senescence Through Reducing Mitochondrial ROS Production" Antioxidants 14, no. 3: 259. https://doi.org/10.3390/antiox14030259
APA StyleKuk, M. U., Lee, Y. H., Kim, D., Lee, K. S., Park, J. H., Yoon, J. H., Lee, Y. J., So, B., Kim, M., Kwon, H. W., Byun, Y., Lee, K. Y., & Park, J. T. (2025). Sauchinone Ameliorates Senescence Through Reducing Mitochondrial ROS Production. Antioxidants, 14(3), 259. https://doi.org/10.3390/antiox14030259