Protective Effects of Tormentic Acid on Unilateral Ureteral Obstruction-Induced Renal Injury, Inflammation, and Fibrosis: A Comprehensive Approach to Reducing Oxidative Stress, Apoptosis, and Ferroptosis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Experiments
2.2. Biochemical Measurements
2.3. Histological Evaluation and Immunohistochemical (IHC) Analysis
2.4. Immunofluorescent (IF) Staining
2.5. TUNEL Staining
2.6. Western Blotting
2.7. qRT-PCR
2.8. Statistical Analysis
3. Results
3.1. TA Ameliorates Renal Injury and Preserves Renal Function in a UUO-Induced CKD Model
3.2. TA Attenuates Inflammatory Responses, MAP Kinase Pathway Activation, and ER Stress in UUO Mice
3.3. TA Reduces Fibrosis, Reverses EMT, and Inhibits Smad2/3 Activation in UUO-Induced Kidney Injury
3.4. TA Alleviates Oxidative DNA Damage and Lipid Peroxidation in UUO-Induced Kidney Injury
3.5. TA Inhibited Apoptosis and Ferroptosis in UUO-Induced Kidney Injury
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Webster, A.C.; Nagler, E.V.; Morton, R.L.; Masson, P. Chronic Kidney Disease. Lancet 2017, 389, 1238–1252. [Google Scholar] [CrossRef]
- Frąk, W.; Dąbek, B.; Balcerczyk-Lis, M.; Motor, J.; Radzioch, E.; Młynarska, E.; Rysz, J.; Franczyk, B. Role of Uremic Toxins, Oxidative Stress, and Renal Fibrosis in Chronic Kidney Disease. Antioxidants 2024, 13, 687. [Google Scholar] [CrossRef] [PubMed]
- Verma, S.; Singh, P.; Khurana, S.; Ganguly, N.K.; Kukreti, R.; Saso, L.; Rana, D.S.; Taneja, V.; Bhargava, V. Implications of oxidative stress in chronic kidney disease: A review on current concepts and therapies. Kidney Res. Clin. Pract. 2021, 40, 183–193. [Google Scholar] [CrossRef]
- Liu, B.C.; Tang, T.T.; Lv, L.L.; Lan, H.Y. Renal tubule injury: A driving force toward chronic kidney disease. Kidney Int. 2018, 93, 568–579. [Google Scholar] [CrossRef] [PubMed]
- Sanz, A.B.; Sanchez-Niño, M.D.; Ramos, A.M.; Ortiz, A. Regulated cell death pathways in kidney disease. Nat. Rev. Nephrol. 2023, 19, 281–299. [Google Scholar] [CrossRef]
- Li, S.; Han, Q.; Liu, C.; Wang, Y.; Liu, F.; Pan, S.; Zuo, L.; Gao, D.; Chen, K.; Feng, Q.; et al. Role of ferroptosis in chronic kidney disease. Cell Commun. Signal. 2024, 22, 113. [Google Scholar] [CrossRef]
- Jang, H.S.; Padanilam, B.J. Simultaneous deletion of Bax and Bak is required to prevent apoptosis and interstitial fibrosis in obstructive nephropathy. Am. J. Physiol. Renal Physiol. 2015, 309, F540–F550. [Google Scholar] [CrossRef] [PubMed]
- Yang, R.; Xu, X.; Li, H.; Chen, J.; Xiang, X.; Dong, Z.; Zhang, D. p53 induces miR199a-3p to suppress SOCS7 for STAT3 activation and renal fibrosis in UUO. Sci. Rep. 2017, 7, 43409. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Chen, X.; Ru, F.; Gan, Y.; Li, B.; Xia, W.; Dai, G.; He, Y.; Chen, Z. Liproxstatin-1 attenuates unilateral ureteral obstruction-induced renal fibrosis by inhibiting renal tubular epithelial cells ferroptosis. Cell Death Dis. 2021, 12, 843. [Google Scholar] [CrossRef] [PubMed]
- Dai, Y.; Chen, Y.; Mo, D.; Jin, R.; Huang, Y.; Zhang, L.; Zhang, C.; Gao, H.; Yan, Q. Inhibition of ACSL4 ameliorates tubular ferroptotic cell death and protects against fibrotic kidney disease. Commun. Biol. 2023, 6, 907. [Google Scholar] [CrossRef] [PubMed]
- Olech, M.; Ziemichód, W.; Nowacka-Jechalke, N. The Occurrence and Biological Activity of Tormentic Acid—A Review. Molecules 2021, 26, 3797. [Google Scholar] [CrossRef] [PubMed]
- Yue, Y.; Qiao, B.; Jiang, X. Tormentic acid confers protection against oxidative stress injury in rats with Parkinson’s disease by targeting the Wnt/β-catenin signaling pathway. Cell. Mol. Biol. 2020, 66, 32–36. [Google Scholar] [CrossRef] [PubMed]
- Cui, W.; Sun, C.; Ma, Y.; Wang, S.; Wang, X.; Zhang, Y. Neuroprotective effect of tormentic acid against memory impairment and neuro-inflammation in an Alzheimer’s disease mouse model. Mol. Med. Rep. 2020, 22, 739–750. [Google Scholar] [CrossRef] [PubMed]
- Jiang, W.-P.; Huang, S.-S.; Matsuda, Y.; Saito, H.; Uramaru, N.; Ho, H.-Y.; Wu, J.-B.; Huang, G.-J. Protective Effects of Tormentic Acid, a Major Component of Suspension Cultures of Eriobotrya japonica Cells, on Acetaminophen-Induced Hepatotoxicity in Mice. Molecules 2017, 22, 830. [Google Scholar] [CrossRef]
- Wu, J.B.; Kuo, Y.H.; Lin, C.H.; Ho, H.Y.; Shih, C.C. Tormentic acid, a major component of suspension cells of Eriobotrya japonica, suppresses high-fat diet-induced diabetes and hyperlipidemia by glucose transporter 4 and AMP-activated protein kinase phosphorylation. J. Agric. Food Chem. 2014, 62, 10717–10726. [Google Scholar] [CrossRef]
- Shi, C.; Li, Z.; Wu, Y.; Li, X.; Li, Y.; Wei, J.; Li, J.; Zhang, Y.; Li, L. Euscaphic acid and Tormentic acid protect vascular endothelial cells against hypoxia-induced apoptosis via PI3K/AKT or ERK 1/2 signaling pathway. Life Sci. 2020, 252, 117666. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Wang, Y.; Zhao, M.; Jia, H.; Li, B.; Xing, D. Tormentic acid inhibits IL-1β-induced chondrocyte apoptosis by activating the PI3K/Akt signaling pathway. Mol. Med. Rep. 2018, 17, 4753–4758. [Google Scholar] [CrossRef] [PubMed]
- Lin, X.; Zhang, S.; Huang, R.; Tan, S.; Liang, S.; Wu, X.; Zhuo, L.; Huang, Q. Protective effect of tormentic acid from Potentilla chinensis against lipopolysaccharide/D-galactosamine induced fulminant hepatic failure in mice. Int. Immunopharmacol. 2014, 19, 365–372. [Google Scholar] [CrossRef]
- Martínez-Klimova, E.; Aparicio-Trejo, O.E.; Tapia, E.; Pedraza-Chaverri, J. Unilateral Ureteral Obstruction as a Model to Investigate Fibrosis-Attenuating Treatments. Biomolecules 2019, 9, 141. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Fan, X.; Wang, Q.; Zhen, J.; Li, X.; Zhou, P.; Lang, Y.; Sheng, Q.; Zhang, T.; Huang, T.; et al. ROS promote hyper-methylation of NDRG2 promoters in a DNMTS-dependent manner: Contributes to the progression of renal fibrosis. Redox Biol. 2023, 62, 102674. [Google Scholar] [CrossRef]
- Lom, Y.H.; Yang, S.F.; Cheng, C.C.; Hsu, K.C.; Chen, Y.S.; Chen, Y.Y.; Wang, C.W.; Guan, S.S.; Wu, C.T. Nobiletin Alleviates Ferroptosis-Associated Renal Injury, Inflammation, and Fibrosis in a Unilateral Ureteral Obstruction Mouse Model. Biomedicines 2022, 10, 595. [Google Scholar] [CrossRef]
- Forbes, M.S.; Thornhill, B.A.; Chevalier, R.L. Proximal tubular injury and rapid formation of atubular glomeruli in mice with unilateral ureteral obstruction: A new look at an old model. Am. J. Physiol. Renal Physiol. 2011, 301, F110–F117. [Google Scholar] [CrossRef]
- Romejko, K.; Markowska, M.; Niemczyk, S. The Review of Current Knowledge on Neutrophil Gelatinase-Associated Lipocalin (NGAL). Int. J. Mol. Sci. 2023, 24, 10470. [Google Scholar] [CrossRef]
- Gutierrez, V.; Kim-Vasquez, D.; Shum, M.; Yang, Q.; Dikeman, D.; Louie, S.G.; Shirihai, O.S.; Tsukamoto, H.; Liesa, M. The mitochondrial biliverdin exporter ABCB10 in hepatocytes mitigates neutrophilic inflammation in alcoholic hepatitis. Redox Biol. 2024, 70, 103052. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Z.; Tsvetkov, D.; Bartolomaeus, T.U.P.; Erdogan, C.; Krügel, U.; Schleifenbaum, J.; Schaefer, M.; Nürnberg, B.; Chai, X.; Ludwig, F.A.; et al. Role of TRPC6 in kidney damage after acute ischemic kidney injury. Sci. Rep. 2022, 12, 3038. [Google Scholar] [CrossRef] [PubMed]
- Lee, T.W.; Bae, E.; Kim, J.H.; Jung, M.H.; Park, D.J. Psoralen Alleviates Renal Fibrosis by Attenuating Inflammasome-Dependent NLRP3 Activation and Epithelial–Mesenchymal Transition in a Mouse Unilateral Ureteral Obstruction Model. Int. J. Mol. Sci. 2023, 24, 13171. [Google Scholar] [CrossRef]
- Yuan, Q.; Tang, B.; Zhang, C. Signaling pathways of chronic kidney diseases, implications for therapeutics. Signal Transduct. Target. Ther. 2022, 7, 182. [Google Scholar] [CrossRef]
- Ricciardi, C.A.; Gnudi, L. The endoplasmic reticulum stress and the unfolded protein response in kidney disease: Implications for vascular growth factors. J. Cell. Mol. Med. 2020, 24, 12910–12919. [Google Scholar] [CrossRef] [PubMed]
- Hadpech, S.; Thongboonkerd, V. Epithelial-mesenchymal plasticity in kidney fibrosis. Genesis 2024, 62, e23529. [Google Scholar] [CrossRef] [PubMed]
- Gavia-García, G.; Rosado-Pérez, J.; Arista-Ugalde, T.L.; Aguiñiga-Sánchez, I.; Santiago-Osorio, E.; Mendoza-Núñez, V.M. The consumption of Sechium edule (chayote) has antioxidant effect and prevents telomere attrition in older adults with metabolic syndrome. Redox Rep. 2023, 28, 2207323. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Qu, Y.; Cai, R.; Gao, J.; Xu, Q.; Zhang, L.; Kang, M.; Jia, H.; Chen, Q.; Liu, Y.; et al. Atorvastatin ameliorates diabetic nephropathy through inhibiting oxidative stress and ferroptosis signaling. Eur. J. Pharmacol. 2024, 976, 176699. [Google Scholar] [CrossRef]
- Maremonti, F.; Meyer, C.; Linkermann, A. Mechanisms and Models of Kidney Tubular Necrosis and Nephron Loss. J. Am. Soc. Nephrol. 2022, 33, 472–486. [Google Scholar] [CrossRef]
- Saad, K.M.; Salles, É.L.; Naeini, S.E.; Baban, B.; Abdelmageed, M.E.; Abdelaziz, R.R.; Suddek, G.M.; Elmarakby, A.A. Reno-protective effect of protocatechuic acid is independent of sex-related differences in murine model of UUO-induced kidney injury. Pharmacol. Rep. 2024, 76, 98–111. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-Y.; Jo, J.; Kim, K.; An, H.-J.; Gwon, M.-G.; Gu, H.; Kim, H.-J.; Yang, A.Y.; Kim, S.-W.; Jeon, E.J.; et al. Pharmacological Activation of Sirt1 Ameliorates Cisplatin-Induced Acute Kidney Injury by Suppressing Apoptosis, Oxidative Stress, and Inflammation in Mice. Antioxidants 2019, 8, 322. [Google Scholar] [CrossRef] [PubMed]
- Ma, F.Y.; Sachchithananthan, M.; Flanc, R.S.; Nikolic-Paterson, D.J. Mitogen activated protein kinases in renal fibrosis. Front. Biosci. (Schol. Ed.) 2009, 1, 171–187. [Google Scholar] [CrossRef]
- Mostafa, R.G.; El-Aleem Hassan Abd El-Aleem, A.; Mahmoud Fouda, E.A.; Ahmed Taha, F.R.; Amin Elzorkany, K.M. A pilot study on gene expression of endoplasmic reticulum unfolded protein response in chronic kidney disease. Biochem. Biophys. Rep. 2020, 24, 100829. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.-H.; Wu, C.-H.; Chiang, C.-K. Therapeutic Approaches Targeting Proteostasis in Kidney Disease and Fibrosis. Int. J. Mol. Sci. 2021, 22, 8674. [Google Scholar] [CrossRef]
- Maekawa, H.; Inagi, R. Stress Signal Network between Hypoxia and ER Stress in Chronic Kidney Disease. Front. Physiol. 2017, 8, 74. [Google Scholar] [CrossRef] [PubMed]
- Noh, M.R.; Kim, J.I.; Han, S.J.; Lee, T.J.; Park, K.M. C/EBP homologous protein (CHOP) gene deficiency attenuates renal ischemia/reperfusion injury in mice. Biochim. Biophys. Acta 2015, 1852, 1895–1901. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Guo, Y.; Fu, H.; Hu, S.; Pan, J.; Wang, Y.; Cheng, J.; Song, J.; Yu, Q.; Zhang, S.; et al. Chop deficiency prevents UUO-induced renal fibrosis by attenuating fibrotic signals originated from Hmgb1/TLR4/NFκB/IL-1β signaling. Cell Death Dis. 2015, 6, e1847. [Google Scholar] [CrossRef]
- Qiu, L.; Zheng, X.; Jaishankar, D.; Green, R.; Fang, D.; Nadig, S.; Zhang, Z.J. Beyond UPR: Cell-specific roles of ER stress sensor IRE1α in kidney ischemic injury and transplant rejection. Kidney Int. 2023, 104, 463–469. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Cao, T.; Luo, C.; Cai, J.; Zhou, X.; Xiao, X.; Liu, S. Crosstalk between ER stress, NLRP3 inflammasome, and inflammation. Appl. Microbiol. Biotechnol. 2020, 104, 6129–6140. [Google Scholar] [CrossRef]
- Sun, Y.B.; Qu, X.; Caruana, G.; Li, J. The origin of renal fibroblasts/myofibroblasts and the signals that trigger fibrosis. Differentiation 2016, 92, 102–107. [Google Scholar] [CrossRef] [PubMed]
- Lin, X.; Wei, Y.; Li, Y.; Xiong, Y.; Fang, B.; Li, C.; Huang, Q.; Huang, R.; Wei, J. Tormentic Acid Ameliorates Hepatic Fibrosis in vivo by Inhibiting Glycerophospholipids Metabolism and PI3K/Akt/mTOR and NF-κB Pathways: Based on Transcriptomics and Metabolomics. Front. Pharmacol. 2022, 13, 801982. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Wang, Y.; Zhang, J.; Hu, C.; Jiang, J.; Li, Y.; Peng, Z. ROS-induced lipid peroxidation modulates cell death outcome: Mechanisms behind apoptosis, autophagy, and ferroptosis. Arch. Toxicol. 2023, 97, 1439–1451. [Google Scholar] [CrossRef]
- Maiorino, M.; Conrad, M.; Ursini, F. GPx4, Lipid Peroxidation, and Cell Death: Discoveries, Rediscoveries, and Open Issues. Antioxid. Redox Signal. 2018, 29, 61–74. [Google Scholar] [CrossRef]
- Zan, H.; Liu, J.; Yang, M.; Zhao, H.; Gao, C.; Dai, Y.; Wang, Z.; Liu, H.; Zhang, Y. Melittin alleviates sepsis-induced acute kidney injury by promoting GPX4 expression to inhibit ferroptosis. Redox Rep. 2024, 29, 2290864. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.; Glandorff, C.; Sun, M. GSH and Ferroptosis: Side-by-Side Partners in the Fight against Tumors. Antioxidants 2024, 13, 697. [Google Scholar] [CrossRef]
- Portilla, D. Apoptosis, fibrosis and senescence. Nephron Clin. Pract. 2014, 127, 65–69. [Google Scholar] [CrossRef]
- Shao, L.; Fang, Q.; Ba, C.; Zhang, Y.; Shi, C.; Zhang, Y.; Wang, J. Identification of ferroptosis-associated genes in chronic kidney disease. Exp. Ther. Med. 2022, 25, 60. [Google Scholar] [CrossRef]
- Yang, S.Q.; Zhao, X.; Zhang, J.; Liao, D.Y.; Wang, Y.H.; Wang, Y.G. Ferroptosis in renal fibrosis: A mini-review. J. Drug Target. 2024, 32, 785–793. [Google Scholar] [CrossRef] [PubMed]
- Nakanishi, T.; Nanami, M.; Kuragano, T. The pathogenesis of CKD complications; Attack of dysregulated iron and phosphate metabolism. Free Radic. Biol. Med. 2020, 157, 55–62. [Google Scholar] [CrossRef] [PubMed]
- Baek, J.; He, C.; Afshinnia, F.; Michailidis, G.; Pennathur, S. Lipidomic approaches to dissect dysregulated lipid metabolism in kidney disease. Nat. Rev. Nephrol. 2022, 18, 38–55. [Google Scholar] [CrossRef]
- Punchai, S.; Chaiyagot, N.; Artkaew, N.; Jusakul, A.; Cha’on, U.; Thanan, R.; Vaeteewoottacharn, K.; Lert-Itthiporn, W. Iron-induced kidney cell damage: Insights into molecular mechanisms and potential diagnostic significance of urinary FTL. Front. Mol. Biosci. 2024, 11, 1352032. [Google Scholar] [CrossRef] [PubMed]
- Jiménez-Uribe, A.P.; Gómez-Sierra, T.; Aparicio-Trejo, O.E.; Orozco-Ibarra, M.; Pedraza-Chaverri, J. Backstage players of fibrosis: NOX4, mTOR, HDAC, and S1P; companions of TGF-β. Cell. Signal. 2021, 87, 110123. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Lu, X.; Zhang, G.; Liu, C.; Sun, S.; Mao, W.; Jiang, G.; Zhou, Y.; Zhang, N.; Tao, S.; et al. DRD4 alleviates acute kidney injury by suppressing ISG15/NOX4 axis-associated oxidative stress. Redox Biol. 2024, 70, 103078. [Google Scholar] [CrossRef]
Gene | Primer Sequence (5′→3′) | Accession No. |
---|---|---|
Tnf | F: ACTTCGGGGTGATCGGTCCCC R: TGGTTTGCTACGACGTGGGCTAC | NM_013693 |
Il6 | F: TACCACTTCACAAGTCGGAGGC R: CTGCAAGTGCATCATCGTTGTTC | NM_031168 |
Il1b | F: CGCAGCAGCACATCAACAAGAGC R: TGTCCTCATCCTGGAAGGTCCACG | NM_008361 |
Icam1 | F: AACTGTGGCACCGTGCAGTC R: AGGGTGAGGTCCTTGCCTACTTG | NM_010493 |
Vcam1 | F: CCCAGGTGGAGGTCTACTCA R: CAGGATTTTGGGAGCTGGTA | NM_011693 |
Ern1 | F: GGTCCAATCGTACGGCAGTT R: TCTCTCACAGAGCCACCTTTGTAG | NM_023913 |
Atf6 | F: CCCAAGCTCTCCGCATAGTC R: TAAAATGCCCCATAACTGACCAA | NM_001081304 |
Atf4 | F: GAGCTTCCTGAACAGCGAAGTG R: TGGCCACCTCCAGATAGTCATC | NM_009716 |
Acsl4 | F: CGTTCCTCCAAGTAGACCAAC R: CCTTACACTGTCTGACCAGTC | NM_207625 |
Ptgs2 | F: TGCCTGGTCTGATGATGTATG R: GCCCTTCACGTTATTGCAGATG | NM_011198 |
Actb | F: GGCTGTATTCCCCTCCATCG R: CCAGTTGGTAACAATGCCATGT | NM_007393 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, A.Y.; Kim, J.-Y.; Gwon, M.-G.; Kwon, H.H.; Leem, J.; Jeon, E.-J. Protective Effects of Tormentic Acid on Unilateral Ureteral Obstruction-Induced Renal Injury, Inflammation, and Fibrosis: A Comprehensive Approach to Reducing Oxidative Stress, Apoptosis, and Ferroptosis. Antioxidants 2025, 14, 13. https://doi.org/10.3390/antiox14010013
Yang AY, Kim J-Y, Gwon M-G, Kwon HH, Leem J, Jeon E-J. Protective Effects of Tormentic Acid on Unilateral Ureteral Obstruction-Induced Renal Injury, Inflammation, and Fibrosis: A Comprehensive Approach to Reducing Oxidative Stress, Apoptosis, and Ferroptosis. Antioxidants. 2025; 14(1):13. https://doi.org/10.3390/antiox14010013
Chicago/Turabian StyleYang, Ah Young, Jung-Yeon Kim, Mi-Gyeong Gwon, Hyun Hee Kwon, Jaechan Leem, and Eon-Ju Jeon. 2025. "Protective Effects of Tormentic Acid on Unilateral Ureteral Obstruction-Induced Renal Injury, Inflammation, and Fibrosis: A Comprehensive Approach to Reducing Oxidative Stress, Apoptosis, and Ferroptosis" Antioxidants 14, no. 1: 13. https://doi.org/10.3390/antiox14010013
APA StyleYang, A. Y., Kim, J.-Y., Gwon, M.-G., Kwon, H. H., Leem, J., & Jeon, E.-J. (2025). Protective Effects of Tormentic Acid on Unilateral Ureteral Obstruction-Induced Renal Injury, Inflammation, and Fibrosis: A Comprehensive Approach to Reducing Oxidative Stress, Apoptosis, and Ferroptosis. Antioxidants, 14(1), 13. https://doi.org/10.3390/antiox14010013