Mitochondria of Porcine Oocytes Synthesize Melatonin, Which Improves Their In Vitro Maturation and Embryonic Development
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Chemicals
2.3. The Procedure of In Vitro Porcine Oocyte Maturation
2.4. Parthenogenetic Activation of Oocytes
2.5. In Vitro Culture (IVC) of Embryos
2.6. Calculation of Cumulus Cell Expansion and Polar Body Extrusion Rates in Porcine Oocyte Maturation
2.7. Cortical Granule Migration Assay
2.8. Mitochondrial Levels and Their Distribution in Porcine Oocytes
2.9. Subcellular Localization of AANAT, Detected by Immunoelectron Microscopy
2.10. Lipid Droplet Staining of Porcine Oocytes
2.11. Mitochondrial Membrane Potential Analysis with JC-10 Staining
2.12. Procedure of Immunofluorescence Staining
2.13. Melatonin Assay with High-Performance Liquid Chromatography (HPLC)-Tandem Mass Spectrometry
2.14. Assay of ATP
2.15. RNA Interference Assay
2.16. Real-Time Fluorescent Quantitative PCR
2.17. Statistical Analysis
3. Results
3.1. The Capacity of Mitochondria in Porcine Oocytes on Melatonin Biosynthesis during Their In Vitro Maturation
3.2. 5-HT Supplementation Improves the Quality of Porcine Oocytes
3.3. Effects of 5-HT Supplementation on the Distribution and Function of Mitochondria in Oocytes
3.4. Effects of siAANAT on the Quality and Maturation of Porcine Oocytes
3.5. Effects of siAANAT on Mitochondrial Distribution and ATP Production in Porcine Oocytes
3.6. Effects of siAANAT on the Metabolic Pattern of Porcine Oocytes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
Appendix A. Effects of 5-HT on the Mitochondrial Membrane Potential of Porcine Oocytes
Appendix B. Effects of siAANAT on Oocyte Lipid and Mitochondrial Membrane Potential Levels
References
- Tricoire, H.; Møller, M.; Chemineau, P.; Malpaux, B. Origin of cerebrospinal fluid melatonin and possible function in the integration of photoperiod. Reprod. Suppl. 2003, 61, 311–321. [Google Scholar] [CrossRef] [PubMed]
- Simonneaux, V.; Ribelayga, C. Generation of the melatonin endocrine message in mammals: A review of the complex regulation of melatonin synthesis by norepinephrine, peptides, and other pineal transmitters. Pharmacol. Rev. 2003, 55, 325–395. [Google Scholar] [CrossRef]
- Ozaki, Y.; Lynch, H.J. Presence of melatonin in plasma and urine or pinealectomized rats. Endocrinology 1976, 99, 641–644. [Google Scholar] [CrossRef] [PubMed]
- Tan, D.X.; Reiter, R.J.; Zimmerman, S.; Hardeland, R. Melatonin: Both a Messenger of Darkness and a Participant in the Cellular Actions of Non-Visible Solar Radiation of Near Infrared Light. Biology 2023, 12, 89. [Google Scholar] [CrossRef] [PubMed]
- Reiter, R.J.; Tan, D.X.; Rosales-Corral, S.; Galano, A.; Zhou, X.J.; Xu, B. Mitochondria: Central Organelles for Melatonin’s Antioxidant and Anti-Aging Actions. Molecules 2018, 23, 509. [Google Scholar] [CrossRef] [PubMed]
- He, C.; Wang, J.; Zhang, Z.; Yang, M.; Li, Y.; Tian, X.; Ma, T.; Tao, J.; Zhu, K.; Song, Y.; et al. Mitochondria Synthesize Melatonin to Ameliorate Its Function and Improve Mice Oocyte’s Quality under in Vitro Conditions. Int. J. Mol. Sci. 2016, 17, 939. [Google Scholar] [CrossRef] [PubMed]
- Rossi, A.; Pizzo, P.; Filadi, R. Calcium, mitochondria and cell metabolism: A functional triangle in bioenergetics. Biochim. Biophys. Acta Mol. Cell Res. 2019, 1866, 1068–1078. [Google Scholar] [CrossRef] [PubMed]
- Boyman, L.; Karbowski, M.; Lederer, W.J. Regulation of Mitochondrial ATP Production: Ca2+ Signaling and Quality Control. Trends Mol. Med. 2020, 26, 21–39. [Google Scholar] [CrossRef] [PubMed]
- Spinelli, J.B.; Haigis, M.C. The multifaceted contributions of mitochondria to cellular metabolism. Nat. Cell Biol. 2018, 20, 745–754. [Google Scholar] [CrossRef]
- Lill, R.; Freibert, S.A. Mechanisms of Mitochondrial Iron-Sulfur Protein Biogenesis. Annu. Rev. Biochem. 2020, 89, 471–499. [Google Scholar] [CrossRef]
- Bock, F.J.; Tait, S.W.G. Mitochondria as multifaceted regulators of cell death. Nat. Rev. Mol. Cell Biol. 2020, 21, 85–100. [Google Scholar] [CrossRef] [PubMed]
- Van Blerkom, J. Mitochondrial function in the human oocyte and embryo and their role in developmental competence. Mitochondrion 2011, 11, 797–813. [Google Scholar] [CrossRef] [PubMed]
- Dumollard, R.; Campbell, K.; Halet, G.; Carroll, J.; Swann, K. Regulation of cytosolic and mitochondrial ATP levels in mouse eggs and zygotes. Dev. Biol. 2008, 316, 431–440. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Li, Y. Adenosine triphosphate content in human unfertilized oocytes, undivided zygotes and embryos unsuitable for transfer or cryopreservation. J. Int. Med. Res. 2012, 40, 734–739. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.Y.; Wang, D.H.; Zou, X.Y.; Xu, C.M. Mitochondrial functions on oocytes and preimplantation embryos. J. Zhejiang Univ. Sci. B 2009, 10, 483–492. [Google Scholar] [CrossRef] [PubMed]
- Zeng, H.T.; Ren, Z.; Yeung, W.S.; Shu, Y.M.; Xu, Y.W.; Zhuang, G.L.; Liang, X.Y. Low mitochondrial DNA and ATP contents contribute to the absence of birefringent spindle imaged with PolScope in in vitro matured human oocytes. Hum. Reprod. 2007, 22, 1681–1686. [Google Scholar] [CrossRef]
- Martín, M.; Macías, M.; Escames, G.; León, J.; Acuña-Castroviejo, D. Melatonin but not vitamins C and E maintains glutathione homeostasis in t-butyl hydroperoxide-induced mitochondrial oxidative stress. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2000, 14, 1677–1679. [Google Scholar] [CrossRef] [PubMed]
- Acuña Castroviejo, D.; López, L.C.; Escames, G.; López, A.; García, J.A.; Reiter, R.J. Melatonin-mitochondria interplay in health and disease. Curr. Top. Med. Chem. 2011, 11, 221–240. [Google Scholar] [CrossRef]
- Chau, M.N.; Radden, B.G. Intra-oral salivary gland neoplasms: A retrospective study of 98 cases. J. Oral Pathol. 1986, 15, 339–342. [Google Scholar] [CrossRef]
- Okatani, Y.; Wakatsuki, A.; Reiter, R.J.; Enzan, H.; Miyahara, Y. Protective effect of melatonin against mitochondrial injury induced by ischemia and reperfusion of rat liver. Eur. J. Pharmacol. 2003, 469, 145–152. [Google Scholar] [CrossRef]
- Okatani, Y.; Wakatsuki, A.; Reiter, R.J. Melatonin protects hepatic mitochondrial respiratory chain activity in senescence-accelerated mice. J. Pineal Res. 2002, 32, 143–148. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, A.; Gupta, S.; Sharma, R.K. Role of oxidative stress in female reproduction. Reprod. Biol. Endocrinol. RBE 2005, 3, 28. [Google Scholar] [CrossRef] [PubMed]
- Kala, M.; Shaikh, M.V.; Nivsarkar, M. Equilibrium between anti-oxidants and reactive oxygen species: A requisite for oocyte development and maturation. Reprod. Med. Biol. 2017, 16, 28–35. [Google Scholar] [CrossRef] [PubMed]
- Cruz, M.H.; Leal, C.L.; Cruz, J.F.; Tan, D.X.; Reiter, R.J. Essential actions of melatonin in protecting the ovary from oxidative damage. Theriogenology 2014, 82, 925–932. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.M.; Hao, H.S.; Du, W.H.; Zhao, S.J.; Wang, H.Y.; Wang, N.; Wang, D.; Liu, Y.; Qin, T.; Zhu, H.B. Melatonin inhibits apoptosis and improves the developmental potential of vitrified bovine oocytes. J. Pineal Res. 2016, 60, 132–141. [Google Scholar] [CrossRef]
- Li, Y.; Zhang, Z.; He, C.; Zhu, K.; Xu, Z.; Ma, T.; Tao, J.; Liu, G. Melatonin protects porcine oocyte in vitro maturation from heat stress. J. Pineal Res. 2015, 59, 365–375. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, C.; Mayo, J.C.; Sainz, R.M.; Antolín, I.; Herrera, F.; Martín, V.; Reiter, R.J. Regulation of antioxidant enzymes: A significant role for melatonin. J. Pineal Res. 2004, 36, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Yuan, Y.; Spate, L.D.; Redel, B.K.; Tian, Y.; Zhou, J.; Prather, R.S.; Roberts, R.M. Quadrupling efficiency in production of genetically modified pigs through improved oocyte maturation. Proc. Natl. Acad. Sci. USA 2017, 114, e5796–e5804. [Google Scholar] [CrossRef]
- Cao, Z.; Gao, D.; Xu, T.; Zhang, L.; Tong, X.; Zhang, D.; Wang, Y.; Ning, W.; Qi, X.; Ma, Y.; et al. Circular RNA profiling in the oocyte and cumulus cells reveals that circARMC4 is essential for porcine oocyte maturation. Aging 2019, 11, 8015–8034. [Google Scholar] [CrossRef]
- Sutton-McDowall, M.L.; Gilchrist, R.B.; Thompson, J.G. The pivotal role of glucose metabolism in determining oocyte developmental competence. Reproduction 2010, 139, 685–695. [Google Scholar] [CrossRef]
- Bradley, J.; Swann, K. Mitochondria and lipid metabolism in mammalian oocytes and early embryos. Int. J. Dev. Biol. 2019, 63, 93–103. [Google Scholar] [CrossRef]
- Niu, Y.J.; Zhou, W.; Nie, Z.W.; Shin, K.T.; Cui, X.S. Melatonin enhances mitochondrial biogenesis and protects against rotenone-induced mitochondrial deficiency in early porcine embryos. J. Pineal Res. 2020, 68, e12627. [Google Scholar] [CrossRef]
- Tamura, H.; Takasaki, A.; Miwa, I.; Taniguchi, K.; Maekawa, R.; Asada, H.; Taketani, T.; Matsuoka, A.; Yamagata, Y.; Shimamura, K.; et al. Oxidative stress impairs oocyte quality and melatonin protects oocytes from free radical damage and improves fertilization rate. J. Pineal Res. 2008, 44, 280–287. [Google Scholar] [CrossRef]
- Wang, F.; Tian, X.; Zhang, L.; Tan, D.; Reiter, R.J.; Liu, G. Melatonin promotes the in vitro development of pronuclear embryos and increases the efficiency of blastocyst implantation in murine. J. Pineal Res. 2013, 55, 267–274. [Google Scholar] [CrossRef]
- Berlinguer, F.; Leoni, G.G.; Succu, S.; Spezzigu, A.; Madeddu, M.; Satta, V.; Bebbere, D.; Contreras-Solis, I.; Gonzalez-Bulnes, A.; Naitana, S. Exogenous melatonin positively influences follicular dynamics, oocyte developmental competence and blastocyst output in a goat model. J. Pineal Res. 2009, 46, 383–391. [Google Scholar] [CrossRef] [PubMed]
- Gao, C.; Han, H.B.; Tian, X.Z.; Tan, D.X.; Wang, L.; Zhou, G.B.; Zhu, S.E.; Liu, G.S. Melatonin promotes embryonic development and reduces reactive oxygen species in vitrified mouse 2-cell embryos. J. Pineal Res. 2012, 52, 305–311. [Google Scholar] [CrossRef] [PubMed]
- Shi, J.M.; Tian, X.Z.; Zhou, G.B.; Wang, L.; Gao, C.; Zhu, S.E.; Zeng, S.M.; Tian, J.H.; Liu, G.S. Melatonin exists in porcine follicular fluid and improves in vitro maturation and parthenogenetic development of porcine oocytes. J. Pineal Res. 2009, 47, 318–323. [Google Scholar] [CrossRef] [PubMed]
- Tan, D.X.; Manchester, L.C.; Qin, L.; Reiter, R.J. Melatonin: A Mitochondrial Targeting Molecule Involving Mitochondrial Protection and Dynamics. Int. J. Mol. Sci. 2016, 17, 2124. [Google Scholar] [CrossRef]
- Schomerus, C.; Korf, H.W. Mechanisms regulating melatonin synthesis in the mammalian pineal organ. Ann. N. Y. Acad. Sci. 2005, 1057, 372–383. [Google Scholar] [CrossRef]
- Kirillova, A.; Smitz, J.E.J.; Sukhikh, G.T.; Mazunin, I. The Role of Mitochondria in Oocyte Maturation. Cells 2021, 10, 2484. [Google Scholar] [CrossRef] [PubMed]
- Reiter, R.J.; Tan, D.X.; Rosales-Corral, S.; Galano, A.; Jou, M.J.; Acuna-Castroviejo, D. Melatonin Mitigates Mitochondrial Meltdown: Interactions with SIRT3. Int. J. Mol. Sci. 2018, 19, 2439. [Google Scholar] [CrossRef]
- Xu, D.; Liu, L.; Zhao, Y.; Yang, L.; Cheng, J.; Hua, R.; Zhang, Z.; Li, Q. Melatonin protects mouse testes from palmitic acid-induced lipotoxicity by attenuating oxidative stress and DNA damage in a SIRT1-dependent manner. J. Pineal Res. 2020, 69, e12690. [Google Scholar] [CrossRef] [PubMed]
- He, B.; Yin, C.; Gong, Y.; Liu, J.; Guo, H.; Zhao, R. Melatonin-induced increase of lipid droplets accumulation and in vitro maturation in porcine oocytes is mediated by mitochondrial quiescence. J. Cell. Physiol. 2018, 233, 302–312. [Google Scholar] [CrossRef] [PubMed]
- Graveleau, C.; Paust, H.J.; Schmidt-Grimminger, D.; Mukhopadhyay, A.K. Presence of a 5-HT7 receptor positively coupled to adenylate cyclase activation in human granulosa-lutein cells. J. Clin. Endocrinol. Metab. 2000, 85, 1277–1286. [Google Scholar] [CrossRef]
- Il’ková, G.; Rehák, P.; Veselá, J.; Cikos, S.; Fabian, D.; Czikková, S.; Koppel, J. Serotonin localization and its functional significance during mouse preimplantation embryo development. Zygote 2004, 12, 205–213. [Google Scholar] [CrossRef]
- Hinckley, M.; Vaccari, S.; Horner, K.; Chen, R.; Conti, M. The G-protein-coupled receptors GPR3 and GPR12 are involved in cAMP signaling and maintenance of meiotic arrest in rodent oocytes. Dev. Biol. 2005, 287, 249–261. [Google Scholar] [CrossRef] [PubMed]
- Veselá, J.; Rehák, P.; Mihalik, J.; Czikková, S.; Pokorný, J.; Koppel, J. Expression of serotonin receptors in mouse oocytes and preimplantation embryos. Physiol. Res. 2003, 52, 223–228. [Google Scholar] [CrossRef] [PubMed]
- Markova, L.N.; Sadykova, K.A.; Sakharova, N. The effect of biogenic monoamine antagonists on the development of preimplantation mouse embryos cultured in vitro. Zhurnal Evoliutsionnoi Biokhimii I Fiziol. 1990, 26, 726–732. [Google Scholar]
- Sutton, M.L.; Cetica, P.D.; Beconi, M.T.; Kind, K.L.; Gilchrist, R.B.; Thompson, J.G. Influence of oocyte-secreted factors and culture duration on the metabolic activity of bovine cumulus cell complexes. Reproduction 2003, 126, 27–34. [Google Scholar] [CrossRef]
- Akin, N.; von Mengden, L.; Herta, A.C.; Billooye, K.; van Leersum, J.; Cava-Cami, B.; Saucedo-Cuevas, L.; Klamt, F.; Smitz, J.; Anckaert, E. Glucose metabolism characterization during mouse in vitro maturation identifies alterations in cumulus cells. Biol. Reprod. 2021, 104, 902–913. [Google Scholar] [CrossRef]
- Richani, D.; Dunning, K.R.; Thompson, J.G.; Gilchrist, R.B. Metabolic co-dependence of the oocyte and cumulus cells: Essential role in determining oocyte developmental competence. Hum. Reprod. Update 2021, 27, 27–47. [Google Scholar] [CrossRef] [PubMed]
- Paczkowski, M.; Silva, E.; Schoolcraft, W.B.; Krisher, R.L. Comparative importance of fatty acid beta-oxidation to nuclear maturation, gene expression, and glucose metabolism in mouse, bovine, and porcine cumulus oocyte complexes. Biol. Reprod. 2013, 88, 111. [Google Scholar] [CrossRef] [PubMed]
- de Andrade Melo-Sterza, F.; Poehland, R. Lipid Metabolism in Bovine Oocytes and Early Embryos under In Vivo, In Vitro, and Stress Conditions. Int. J. Mol. Sci. 2021, 22, 3421. [Google Scholar] [CrossRef] [PubMed]
- Pike, L.S.; Smift, A.L.; Croteau, N.J.; Ferrick, D.A.; Wu, M. Inhibition of fatty acid oxidation by etomoxir impairs NADPH production and increases reactive oxygen species resulting in ATP depletion and cell death in human glioblastoma cells. Biochim. Biophys. Acta 2011, 1807, 726–734. [Google Scholar] [CrossRef]
Genes | Accession Number | Sequence (5′-3′) |
---|---|---|
ATPase6 | NP_008639.1 | F ACTCATTCACACCCACCACACA |
R CCTGCTGTAATGTGGCTGTCA | ||
HIF1A | NM_001123124 | F ATTTCCATCTCCTCCCCACGTA |
R ACTCAAAGCGACAGATAACACA | ||
GLUT1 | XM_021096908.1 | F CATCGTCGTCGGCATCCT |
R GGTTCTCCTCATTGCGGTTG | ||
AKT1 | NM_001159776 | F GGCCCAACACCTTCATCATCCG |
R ATCTCTCCTCCTGCCGCTTG | ||
PGD | XM_003127557 | F AGAACCTGCTCCTGGATGACT |
R ATCTCGTGTCTGTACCCGTCGT | ||
LDHA | XM_013994501.2 | F GAAAGCCGTCTTAATTTGGTC |
R TTCCAAGCCACATAGGTCA | ||
SOD1 | NM_001190422.1 | F AAGATTCTGTGATCGCCTCT |
R ACTTCCAGCATTTCCCGTCT | ||
NRF2 | XM_013984303.2 | F AGTCCAGAAACCAAACCGACA |
R AATCTGTGTTICCTGTTGCGTA | ||
SIRT3 | NM_001110057.1 | F TTTCGCCAAGGAGCTGTACCC |
R CTCTCTCAAGCCCGTCGATG | ||
ND1 | NP_008634 | F TAATCACAACACAAGAGCACA |
R CGGCTGCATATTCTACGTT | ||
COX3 | NP_008640.1 | F TCAGAATATTACGAAGCACCA |
R ATCCGATGATTACGTGCAA | ||
CyTB | NP_008646.1 | F CCACCCCATATTAAACCAG |
R TACTAGGGCCAACACTCCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, T.; Yan, L.; Deng, S.; Ma, W.; Xia, F.; Wang, L.; Ma, X.; Li, G.; Shen, Z.; Wang, Y.; et al. Mitochondria of Porcine Oocytes Synthesize Melatonin, Which Improves Their In Vitro Maturation and Embryonic Development. Antioxidants 2024, 13, 814. https://doi.org/10.3390/antiox13070814
Zhu T, Yan L, Deng S, Ma W, Xia F, Wang L, Ma X, Li G, Shen Z, Wang Y, et al. Mitochondria of Porcine Oocytes Synthesize Melatonin, Which Improves Their In Vitro Maturation and Embryonic Development. Antioxidants. 2024; 13(7):814. https://doi.org/10.3390/antiox13070814
Chicago/Turabian StyleZhu, Tianqi, Laiqing Yan, Shoulong Deng, Wenkui Ma, Fan Xia, Likai Wang, Xiao Ma, Guangdong Li, Zixia Shen, Yiwei Wang, and et al. 2024. "Mitochondria of Porcine Oocytes Synthesize Melatonin, Which Improves Their In Vitro Maturation and Embryonic Development" Antioxidants 13, no. 7: 814. https://doi.org/10.3390/antiox13070814
APA StyleZhu, T., Yan, L., Deng, S., Ma, W., Xia, F., Wang, L., Ma, X., Li, G., Shen, Z., Wang, Y., Fu, Y., Ji, P., Wang, B., Zhang, L., & Liu, G. (2024). Mitochondria of Porcine Oocytes Synthesize Melatonin, Which Improves Their In Vitro Maturation and Embryonic Development. Antioxidants, 13(7), 814. https://doi.org/10.3390/antiox13070814