The Effectiveness of Four Nicotinamide Adenine Dinucleotide (NAD+) Precursors in Alleviating the High-Glucose-Induced Damage to Hepatocytes in Megalobrama amblycephala: Evidence in NAD+ Homeostasis, Sirt1/3 Activation, Redox Defense, Inflammatory Response, Apoptosis, and Glucose Metabolism
Abstract
1. Introduction
2. Materials and Methods
2.1. Primary Hepatocytes Isolation and Culture
2.2. Cell Treatment
2.3. Cell Viability
2.4. Transaminase Activity Detection
2.5. Detection of NAD+ and NADH Contents
2.6. Antioxidant Status Examination
2.7. Measurement of Inflammatory Cytokines
2.8. Caspase 3 Activity Assay
2.9. Glucose Consumption Test
2.10. Glucose Production Assay
2.11. Glycogen Determination
2.12. Gene Expression Analysis
2.13. Animal Experiment
2.14. Western Blot
2.15. Statistical Analysis
3. Results
3.1. Establishment of the High-Glucose Model
3.2. NAD+ Precursors Improved the High-Glucose-Induced Hepatocyte Injury
3.3. NR Exhibited Superior NAD+ Boosting and Sirt 1/3 Activation Effects
3.4. NAD+ Precursors Attenuated High-Glucose-Induced Oxidative Stress
3.5. Anti-Inflammation Capacity of the Four NAD+ Precursors
3.6. Anti-Apoptosis Capacity of the Four NAD+ Precursors
3.7. NAD+ Precursors Benefited Glucose Metabolism
3.8. The Oral Gavage Test Showed That NR Had a Superior NAD+ Promotion Effect In Vivo
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Szkudelska, K.; Szkudelski, T. Resveratrol, obesity and diabetes. Eur. J. Pharmacol. 2010, 635, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Petro, A.E.; Cotter, J.; Cooper, D.A.; Peters, J.C.; Surwit, S.J.; Surwit, R.S. Fat, carbohydrate, and calories in the development of diabetes and obesity in the C57BL/6J mouse. Metabolism 2004, 53, 454–457. [Google Scholar] [CrossRef] [PubMed]
- Mohamed, J.; Nazratun Nafizah, A.H.; Zariyantey, A.H.; Budin, S.B. Mechanisms of Diabetes-Induced Liver Damage: The role of oxidative stress and inflammation. Sultan Qaboos Univ. Med. J. 2016, 16, e132–e141. [Google Scholar] [CrossRef]
- Oezcan, U.; Yilmaz, E.; Oezcan, L.; Furuhashi, M.; Vaillancourt, E.; Smith, R.O.; Goerguen, C.Z.; Hotamisligil, G.S. Chemical chaperones reduce ER stress and restore glucose homeostasis in a mouse model of type 2 diabetes. Science 2006, 313, 1137–1140. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Ge, Y.P.; Huang, Y.Y.; Chen, W.L.; Liu, W.B.; Zhang, D.D.; Li, X.F. Benfotiamine attenuates the high-carbohydrate diet-induced mitochondrial redox imbalance in fish Megalobrama amblycephala by activating SIRT3. Aquaculture 2023, 572, 739553. [Google Scholar] [CrossRef]
- Chen, Z.; Tian, R.; She, Z.; Cai, J.; Li, H. Role of oxidative stress in the pathogenesis of nonalcoholic fatty liver disease. Free Radic. Biol. Med. 2020, 152, 116–141. [Google Scholar] [CrossRef]
- Klaunig, J.E.; Wang, Z.; Pu, X.; Zhou, S. Oxidative stress and oxidative damage in chemical carcinogenesis. Toxicol. Appl. Pharmacol. 2011, 254, 86–99. [Google Scholar] [CrossRef]
- Wang, N.; Liu, Y.; Ma, Y.; Wen, D. Hydroxytyrosol ameliorates insulin resistance by modulating endoplasmic reticulum stress and prevents hepatic steatosis in diet-induced obesity mice. J. Nutr. Biochem. 2018, 57, 180–188. [Google Scholar] [CrossRef]
- Pereira, S.; Moore, J.; Li, J.-X.; Yu, W.Q.; Ghanim, H.; Vlavcheski, F.; Joseph, Y.D.; Dandona, P.; Volchuk, A.; Cummins, C.L.; et al. 4-Phenylbutyric acid improves free fatty acid-induced hepatic insulin resistance in vivo. Endocr. Connect. 2021, 10, 861–872. [Google Scholar] [CrossRef] [PubMed]
- Katsyuba, E.; Romani, M.; Hofer, D.; Auwerx, J. NAD+ homeostasis in health and disease. Nat. Metab. 2020, 2, 9–31. [Google Scholar] [CrossRef] [PubMed]
- Canto, C.; Houtkooper, R.H.; Pirinen, E.; Youn, D.Y.; Oosterveer, M.H.; Cen, Y.; Fernandez-Marcos, P.J.; Yamamoto, H.; Andreux, P.A.; Cettour-Rose, P.; et al. The NAD+ Precursor Nicotinamide Riboside Enhances Oxidative Metabolism and Protects against High-Fat Diet-Induced Obesity. Cell Metab. 2012, 15, 838–847. [Google Scholar] [CrossRef]
- Verdin, E. NAD+ in aging, metabolism, and neurodegeneration. Science 2015, 350, 1208–1213. [Google Scholar] [CrossRef] [PubMed]
- Amjad, S.; Nisar, S.; Bhat, A.A.; Shah, A.R.; Frenneaux, M.P.; Fakhro, K.; Haris, M.; Reddy, R.; Patay, Z.; Baur, J.; et al. Role of NAD+ in regulating cellular and metabolic signaling pathways. Mol. Metab. 2021, 49, 101195. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.J.; Choi, J.M.; Kim, L.; Park, S.E.; Rhee, E.J.; Lee, W.Y.; Oh, K.W.; Park, S.W.; Park, C.-Y. Nicotinamide improves glucose metabolism and affects the hepatic NAD-sirtuin pathway in a rodent model of obesity and type 2 diabetes. J. Nutr. Biochem. 2014, 25, 66–72. [Google Scholar] [CrossRef] [PubMed]
- Canto, C. NAD+ Precursors: A Questionable Redundancy. Metabolites 2022, 12, 630. [Google Scholar] [CrossRef] [PubMed]
- Trammell, S.A.J.; Schmidt, M.S.; Weidemann, B.J.; Redpath, P.; Jaksch, F.; Dellinger, R.W.; Li, Z.; Abel, E.D.; Migaud, M.E.; Brenner, C. Nicotinamide riboside is uniquely and orally bioavailable in mice and humans. Nat. Commun. 2016, 7, 12948. [Google Scholar] [CrossRef]
- Schlegel, A.; Stainier, D.Y.R. Lessons from ‘‘lower’’ organisms: What worms, flies, and zebrafish can teach us about human energy metabolism. PLoS Genet. 2007, 3, 2037–2048. [Google Scholar] [CrossRef] [PubMed]
- Prisingkorn, W.; Prathomya, P.; Jakovlic, I.; Liu, H.; Zhao, Y.H.; Wang, W.M. Transcriptomics, metabolomics and histology indicate that high-carbohydrate diet negatively affects the liver health of blunt snout bream (Megalobrama amblycephala). BMC Genom. 2017, 18, 856. [Google Scholar] [CrossRef]
- Kamel, M.; Ninov, N. Catching new targets in metabolic disease with a zebrafish. Curr. Opin. Pharm. 2017, 37, 41–50. [Google Scholar] [CrossRef]
- Zang, L.; Maddison, L.A.; Chen, W. Zebrafish as a Model for Obesity and Diabetes. Front. Cell Dev. Biol. 2018, 6, 91. [Google Scholar] [CrossRef]
- Asaoka, Y.; Terai, S.; Sakaida, I.; Nishina, H. The expanding role of fish models in understanding non-alcoholic fatty liver disease. Dis. Model. Mech. 2013, 6, 905–914. [Google Scholar] [CrossRef]
- Oka, T.; Nishimura, Y.; Zang, L.; Hirano, M.; Shimada, Y.; Wang, Z.; Umemoto, N.; Kuroyanagi, J.; Nishimura, N.; Tanaka, T. Diet-induced obesity in zebrafish shares common pathophysiological pathways with mammalian obesity. BMC Physiol. 2010, 10, 21. [Google Scholar] [CrossRef]
- Xu, C.; Liu, W.B.; Shi, H.J.; Mi, H.F.; Li, X.F. Benfotiamine ameliorates high-carbohydrate diet-induced hepatic oxidative stress, inflammation and apoptosis in Megalobrama amblycephala. Aquacult. Res. 2021, 52, 3174–3185. [Google Scholar] [CrossRef]
- Shi, H.J.; Xu, C.; Liu, M.Y.; Wang, B.K.; Liu, W.B.; Chen, D.H.; Zhang, L.; Xu, C.Y.; Li, X.F. Resveratrol Improves the Energy Sensing and Glycolipid Metabolism of Blunt Snout Bream Megalobrama amblycephala Fed High-Carbohydrate Diets by Activating the AMPK-SIRT1-PGC-1α Network. Front. Physiol. 2018, 9, 1258. [Google Scholar] [CrossRef]
- Zhou, W.; Rahimnejad, S.; Tocher, D.R.; Lu, K.; Zhang, C.; Sun, Y. Metformin attenuates lipid accumulation in hepatocytes of blunt snout bream (Megalobrama amblycephala) via activation of AMP-activated protein kinase. Aquaculture 2019, 499, 90–100. [Google Scholar] [CrossRef]
- Reitman, S.; Frankel, S. A Colorimetric Method for the Determination of Serum Glutamic Oxalacetic and Glutamic Pyruvic Transaminases. Am. J. Clin. Pathol. 1957, 28, 56–63. [Google Scholar] [CrossRef]
- Chamchoy, K.; Pakotiprapha, D.; Pumirat, P.; Leartsakulpanich, U.; Boonyuen, U. Application of WST-8 based colorimetric NAD(P)H detection for quantitative dehydrogenase assays. BMC Biochem. 2019, 20, 4. [Google Scholar] [CrossRef] [PubMed]
- Uchiyama, M.; Mihara, M. Determination of malonaldehyde precursor in tissues by thiobarbituric acid test. Anal. Biochem. 1978, 86, 271–278. [Google Scholar] [CrossRef]
- Cakmak, I.; Marschner, H. Magnesium Deficiency and High Light Intensity Enhance Activities of Superoxide Dismutase, Ascorbate Peroxidase, and Glutathione Reductase in Bean Leaves 1. Plant Physiol. 1992, 98, 1222–1227. [Google Scholar] [CrossRef] [PubMed]
- Ōyanagui, Y. Reevaluation of assay methods and establishment of kit for superoxide dismutase activity. Anal. Biochem. 1984, 142, 290–296. [Google Scholar] [CrossRef] [PubMed]
- Wilson, R.; Turner, A.P.F. Glucose oxidase: An ideal enzyme. Biosens. Bioelectron. 1992, 7, 165–185. [Google Scholar] [CrossRef]
- Xu, C.; Li, Y.Y.; Brown, P.B.; Liu, W.B.; Gao, L.L.; Ding, Z.R.; Li, X.F.; Xie, D.Z. Interactions between dietary carbohydrate and thiamine: Implications on the growth performance and intestinal mitochondrial biogenesis and function of Megalobrama amblycephala. Br. J. Nutr. 2022, 127, 321–334. [Google Scholar] [CrossRef] [PubMed]
- Li, X.F.; Wang, T.J.; Qian, Y.; Jiang, G.Z.; Zhang, D.D.; Liu, W.B. Dietary niacin requirement of juvenile blunt snout bream Megalobrama amblycephala based on a dose-response study. Aquacult. Nutr. 2017, 23, 1410–1417. [Google Scholar] [CrossRef]
- Covarrubias, A.J.; Perrone, R.; Grozio, A.; Verdin, E. NAD+ metabolism and its roles in cellular processes during ageing. Nat. Rev. Mol. Cell Biol. 2021, 22, 119–141. [Google Scholar] [CrossRef] [PubMed]
- Nikiforov, A.; Dölle, C.; Niere, M.; Ziegler, M. Pathways and Subcellular Compartmentation of NAD Biosynthesis in Human Cells: From entry of extracellular precursors to mitochondrial NAD generation. J. Biol. Chem. 2011, 286, 21767–21778. [Google Scholar] [CrossRef] [PubMed]
- Shi, H.J.; Li, X.F.; Xu, C.; Zhang, D.; Zhang, L.; Xia, S.L.; Liu, W. Nicotinamide improves the growth performance, intermediary metabolism and glucose homeostasis of blunt snout bream Megalobrama amblycephala fed high-carbohydrate diets. Aquacult. Nutr. 2020, 26, 1311–1328. [Google Scholar] [CrossRef]
- Wang, S.; Wan, T.; Ye, M.; Qiu, Y.; Pei, L.; Jiang, R.; Pang, N.; Huang, Y.; Liang, B.; Ling, W.; et al. Nicotinamide riboside attenuates alcohol induced liver injuries via activation of SirT1/PGC-1α/mitochondrial biosynthesis pathway. Redox Biol. 2018, 17, 89–98. [Google Scholar] [CrossRef]
- Cerutti, R.; Pirinen, E.; Lamperti, C.; Marchet, S.; Sauve, A.A.; Li, W.; Leoni, V.; Schon, E.A.; Dantzer, F.; Auwerx, J.; et al. NAD+-Dependent Activation of Sirt1 Corrects the Phenotype in a Mouse Model of Mitochondrial Disease. Cell Metab. 2014, 19, 1042–1049. [Google Scholar] [CrossRef]
- Ge, Y.P.; Zhang, L.; Chen, W.L.; Sun, M.; Liu, W.B.; Li, X. Resveratrol Modulates the Redox Response and Bile Acid Metabolism to Maintain the Cholesterol Homeostasis in Fish Megalobrama amblycephala Offered a High-Carbohydrate Diet. Antioxidants 2023, 12, 121. [Google Scholar] [CrossRef]
- Zhang, J.; Wang, X.; Vikash, V.; Ye, Q.; Wu, D.; Liu, Y.; Dong, W. ROS and ROS-Mediated Cellular Signaling. Oxidative Med. Cell. Longev. 2016, 2016, 4350965. [Google Scholar] [CrossRef]
- Liguori, I.; Russo, G.; Curcio, F.; Bulli, G.; Aran, L.; Della-Morte, D.; Gargiulo, G.; Testa, G.; Cacciatore, F.; Bonaduce, D.; et al. Oxidative stress, aging, and diseases. Clin. Interv. Aging 2018, 13, 757–772. [Google Scholar] [CrossRef]
- Schieber, M.; Chandel, N.S. ROS Function in Redox Signaling and Oxidative Stress. Curr. Biol. 2014, 24, R453–R462. [Google Scholar] [CrossRef]
- Tian, L.; Zhou, X.Q.; Jiang, W.-D.; Liu, Y.; Wu, P.; Jiang, J.; Kuang, S.Y.; Tang, L.; Tang, W.N.; Zhang, Y.A.; et al. Sodium butyrate improved intestinal immune function associated with NF-κB and p38MAPK signalling pathways in young grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2017, 66, 548–563. [Google Scholar] [CrossRef]
- Kauppinen, A.; Suuronen, T.; Ojala, J.; Kaarniranta, K.; Salminen, A. Antagonistic crosstalk between NF-κB and SIRT1 in the regulation of inflammation and metabolic disorders. Cell. Signal. 2013, 25, 1939–1948. [Google Scholar] [CrossRef]
- Vringer, E.; Tait, S.W.G. Mitochondria and cell death-associated inflammation. Cell Death Differ. 2023, 30, 304–312. [Google Scholar] [CrossRef]
- Reed, J.C. Mechanisms of apoptosis. Am. J. Pathol. 2000, 157, 1415–1430. [Google Scholar] [CrossRef]
- Cohen, G.M. Caspases: The executioners of apoptosis. Biochem. J. 1997, 326, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Gibson, B.A.; Kraus, W.L. New insights into the molecular and cellular functions of poly(ADP-ribose) and PARPs. Nat. Rev. Mol. Cell Biol. 2012, 13, 411–424. [Google Scholar] [CrossRef]
- Hassa, P.O.; Hottiger, M.O. The diverse biological roles of mammalian PARPS, a small but powerful family of poly-ADP-ribose polymerases. Front. Biosci. 2008, 13, 3046–3082. [Google Scholar] [CrossRef] [PubMed]
- Polakof, S.; Panserat, S.; Soengas, J.L.; Moon, T.W. Glucose metabolism in fish: A review. J. Comp. Physiol. B 2012, 182, 1015–1045. [Google Scholar] [CrossRef] [PubMed]
- Wilson, R.P. Utilization of dietary carbohydrate by fish. Aquaculture 1994, 124, 67–80. [Google Scholar] [CrossRef]
- Fang, E.F.; Hou, Y.; Lautrup, S.; Jensen, M.B.; Yang, B.; SenGupta, T.; Caponio, D.; Khezri, R.; Demarest, T.G.; Aman, Y.; et al. NAD+ augmentation restores mitophagy and limits accelerated aging in Werner syndrome. Nat. Commun. 2019, 10, 5284. [Google Scholar] [CrossRef] [PubMed]
Gene Abbreviations | Gene Full Names | Primer Sequences (5′-3′) | Accession Numbers |
---|---|---|---|
il6 | interleukin-6 | ACAAAGCGCTCTTCCTGTTTG | KJ755058.1 |
GCCATTTCTCCTGGTCGTTCA | |||
il1β | interleukin-1β | CGAAGGCATGTCGGAGCATT | XM_048181166.1 |
ACCACTTCCATACGACGCTC | |||
tnfα | tumor necrosis factor-α | GCATGCCAGTCAGGTAGTGT | KU976426.1 |
AGGGCCACAGAAAGAAGAGC | |||
bcl2 | b-cell lymphoma-2 | GATGAGCCCGTTAGTGGGAC | XM_048179299.1 |
TCTGCGAATCGCTCCCATC | |||
baxa | bcl2 associated X, apoptosis regulator a | TCCTATTTTGGCACCCCCAC | XM_048196672.1 |
CTCTCTGCTCCCCCTCATCT | |||
caspase9 | - | TCCAGATGAGGTGGAACCCT | KM604705.1 |
CCAAAATGTCGCTGGGTGTG | |||
caspase3a | - | GGAGCCTGACAGCCATAACA | KY006115.1 |
TGAGCTCTAGTTGGTTGCCA | |||
caspase3b | - | TGGTATGTGCATGGGGAACA | XM_048187987.1 |
TATGTGCATGGGGAACAGGAC | |||
glut2 | glucose transporter 2 | ACGCACCCGATGTGAAAGT | KC513421.2 |
TTGGACAGCAGCATTGATT | |||
gs | glycogen synthase | CCTCCAGTAACAACTCACAACA | XM_048154697.1 |
CAGATAGATTGGTGGTTACGC | |||
gp | glycogen phosphorylase | CTGTCTACCAGCTGGGGTTG | XM_048205686.1 |
GGCCTTCTCCCAAGGGTTAC | |||
gk | glucokinase | ACTGGATCTTGGAGGGACGA | KJ141202.1 |
AAGTCAGATATGCACCCGGC | |||
pfka | phosphofructokinase a | AGGAAATTGCAGTGCAGTAAAG | XM_048194728.1 |
CTGCTTCTGCTTCTAAATCCGC | |||
pfkb | phosphofructokinase b | GAAACCGGCTCAGTCGAAGA | XM_048172371.1 |
ACGGTGTAAACCCTGTGACC | |||
pk | pyruvate kinase | GCCGAGAAAGTCTTCATCGCACAG | XM_048152870.1 |
CGTCCAGAACCGCATTAGCCAC | |||
pepck | phosphoenolpyruvatecarboxykinase | CGGCTACAACTTCGGTCAGT | XM_048198716.1 |
ACGTGGAAGATCTTGGGCAG | |||
fbpase | fructose-1,6-bisphosphatase | TACCCAGATGTCACAGAAT | KJ743995.1 |
CACTCATACAACAGCCTCA | |||
g6pase | glucose-6-phosphatas | CAGGCATGATTGTTGCCGAG | XM_048171060.1 |
AATGGACCCAGGCTGGATTG | |||
g6pd | glucose-6-phosphate dehydrogenase | AGGTAAAGGTGCTGAAGT | KJ743994.1 |
AAATGTAGCCTGAGTGGA | |||
6pgd | 6-phosphogluconate dehydrogenase | TCAAGGAAGCGTTTGACCGA | XM_048178257.1 |
CACTGTCATCTGTCAGGCGT | |||
ef1α | elongation factor 1α | CTTCTCAGGCTGACTGTGC | XM_048180512.1 |
CCGCTAGCATTACCCTCC |
NAD+ (pmol/mg Tissue) | NADH (pmol/mg Tissue) | NAD+/NADH Ratio | |
---|---|---|---|
Means of main effects | |||
Oral gavage | |||
Vehicle | 0.693 a | 1.110 | 0.626 a |
NA | 1.001 ab | 1.005 | 1.022 b |
NAM | 0.822 a | 0.999 | 0.852 ab |
NR | 1.230 b | 0.957 | 1.291 c |
NMN | 0.994 ab | 1.168 | 0.858 ab |
Sampling time | |||
1 h | 0.909 AB | 1.082 | 0.871 A |
3 h | 1.095 B | 1.054 | 1.057 B |
12 h | 0.840 A | 1.008 | 0.861 A |
p-values | |||
Oral gavage | <0.001 | 0.186 | <0.001 |
Sampling time | 0.014 | 0.620 | 0.012 |
Interaction | 0.378 | 0.459 | 0.448 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dong, Y.; Wang, X.; Wei, L.; Liu, Z.; Chu, X.; Xiong, W.; Liu, W.; Li, X. The Effectiveness of Four Nicotinamide Adenine Dinucleotide (NAD+) Precursors in Alleviating the High-Glucose-Induced Damage to Hepatocytes in Megalobrama amblycephala: Evidence in NAD+ Homeostasis, Sirt1/3 Activation, Redox Defense, Inflammatory Response, Apoptosis, and Glucose Metabolism. Antioxidants 2024, 13, 385. https://doi.org/10.3390/antiox13040385
Dong Y, Wang X, Wei L, Liu Z, Chu X, Xiong W, Liu W, Li X. The Effectiveness of Four Nicotinamide Adenine Dinucleotide (NAD+) Precursors in Alleviating the High-Glucose-Induced Damage to Hepatocytes in Megalobrama amblycephala: Evidence in NAD+ Homeostasis, Sirt1/3 Activation, Redox Defense, Inflammatory Response, Apoptosis, and Glucose Metabolism. Antioxidants. 2024; 13(4):385. https://doi.org/10.3390/antiox13040385
Chicago/Turabian StyleDong, Yanzou, Xi Wang, Luyao Wei, Zishang Liu, Xiaoyu Chu, Wei Xiong, Wenbin Liu, and Xiangfei Li. 2024. "The Effectiveness of Four Nicotinamide Adenine Dinucleotide (NAD+) Precursors in Alleviating the High-Glucose-Induced Damage to Hepatocytes in Megalobrama amblycephala: Evidence in NAD+ Homeostasis, Sirt1/3 Activation, Redox Defense, Inflammatory Response, Apoptosis, and Glucose Metabolism" Antioxidants 13, no. 4: 385. https://doi.org/10.3390/antiox13040385
APA StyleDong, Y., Wang, X., Wei, L., Liu, Z., Chu, X., Xiong, W., Liu, W., & Li, X. (2024). The Effectiveness of Four Nicotinamide Adenine Dinucleotide (NAD+) Precursors in Alleviating the High-Glucose-Induced Damage to Hepatocytes in Megalobrama amblycephala: Evidence in NAD+ Homeostasis, Sirt1/3 Activation, Redox Defense, Inflammatory Response, Apoptosis, and Glucose Metabolism. Antioxidants, 13(4), 385. https://doi.org/10.3390/antiox13040385