Antihypertensive Effects of a Sodium Thiosulfate-Loaded Nanoparticle in a Juvenile Chronic Kidney Disease Rat Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of STS-Loaded NPs
2.2. Characterization of NPs
2.3. In Vitro STS Release Studies
2.4. Animals
2.5. Quantitative PCR
2.6. High-Performance Liquid Chromatography (HPLC)
2.7. Statistics
3. Results
3.1. Characterization of STS-Loaded NPs
3.2. Effects of STS-Loaded NPs on Juvenile CKD Rats
3.3. H2S Pathway
3.4. NO Pathway
3.5. RAS
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kimura, H. The physiological role of hydrogen sulfide and beyond. Nitric Oxide 2014, 41, 4–10. [Google Scholar] [CrossRef] [PubMed]
- Lobb, I.; Sonke, E.; Aboalsamh, G.; Sener, A. Hydrogen sulphide and the kidney: Important roles in renal physiology and pathogenesis and treatment of kidney injury and disease. Nitric Oxide 2015, 46, 55–65. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.N.; Tain, Y.L. Hydrogen Sulfide in Hypertension and Kidney Disease of Developmental Origins. Int. J. Mol. Sci. 2018, 19, 1438. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.Y.; Dugbartey, G.J.; Juriasingani, S.; Sener, A. Hydrogen Sulfide Metabolite, Sodium Thiosulfate: Clinical Applications and Underlying Molecular Mechanisms. Int. J. Mol. Sci. 2021, 22, 6452. [Google Scholar] [CrossRef]
- Wyszynska, T.; Cichocka, E.; Wieteska-Klimczak, A.; Jobs, K.; Januszewicz, P. A single pediatric center experience with 1025 children with hypertension. Acta Paediatr. 1992, 81, 244–246. [Google Scholar] [CrossRef]
- Hadtstein, C.; Schaefer, F. Hypertension in children with chronic kidney disease: Pathophysiology and management. Pediatr. Nephrol. 2008, 23, 363–371. [Google Scholar] [CrossRef][Green Version]
- Carey, R.M.; Sakhuja, S.; Calhoun, D.A.; Whelton, P.K.; Muntner, P. Prevalence of Apparent Treatment-Resistant Hypertension in the United States. Hypertension 2019, 73, 424–431. [Google Scholar] [CrossRef]
- Nguyen, I.T.; Klooster, A.; Minnion, M.; Feelisch, M.; Verhaar, M.C.; van Goor, H.; Joles, J.A. Sodium thiosulfate improves renal function and oxygenation in L-NNA–induced hypertension in rats. Kidney Int. 2020, 98, 366–377. [Google Scholar] [CrossRef]
- Claramunt, D.; Gil-Peña, H.; Fuente, R.; García-López, E.; Loredo, V.; Frías, O.H.; Ordoñez, F.A.; Rodríguez, J.; Santos, F. Chronic kidney disease induced by adenine: A suitable model of growth retardation in uremia. Am. J. Physiol. Physiol. 2015, 309, F57–F62. [Google Scholar] [CrossRef]
- Hsu, C.N.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Yang, H.W.; Tain, Y.L. Sodium Thiosulfate Improves Hypertension in Rats with Adenine-Induced Chronic Kidney Disease. Antioxidants 2022, 11, 147. [Google Scholar] [CrossRef]
- Williams, R.M.; Jaimes, E.A.; Heller, D.A. Nanomedicines for kidney diseases. Kidney Int. 2016, 90, 740–745. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Ni, D.; Rosenkrans, Z.T.; Cao, T.; Cai, W. Smart H2S-Triggered/Therapeutic System (SHTS)-Based Nanomedicine. Adv. Sci. 2019, 6, 1901724. [Google Scholar] [CrossRef]
- Chen, C.K.; Jones, C.H.; Mistriotis, P.; Yu, Y.; Ma, X.; Ravikrishnan, A.; Jiang, M.; Andreadis, S.T.; Pfeifer, B.A.; Cheng, C. Poly (ethylene glycol)-block-cationic polylactide nanocomplexes of differing charge density for gene delivery. Biomaterials 2013, 34, 9688–9699. [Google Scholar] [CrossRef] [PubMed]
- Kabong, M.A.; Focke, W.W.; Du Toit, E.L.; Rolfes, H.; Ramjee, S. Breakdown mechanisms of oil-in-water emulsions stabilised with Pluronic F127 and co-surfactants. Colloids Surf. A Physicochem. Eng. Asp. 2020, 585, 124101. [Google Scholar] [CrossRef]
- Williams, R.M.; Shah, J.; Tian, H.S.; Chen, X.; Geissmann, F.; Jaimes, E.A.; Heller, D.A. Selective Nanoparticle Targeting of the Renal Tubules. Hypertension 2018, 71, 87–94. [Google Scholar] [CrossRef]
- Bode-Böger, S.M.; Scalera, F.; Ignarro, L.J. The L-arginine paradox: Importance of the L-arginine/asymmetrical dimethylarginine ratio. Pharmacol. Ther. 2007, 114, 295–306. [Google Scholar] [CrossRef]
- Snijder, P.M.; Frenay, A.R.; Koning, A.M.; Bachtler, M.; Pasch, A.; Kwakernaak, A.J.; van den Berg, E.; Bos, E.M.; Hillebrands, J.L.; Navis, G.; et al. Sodium thiosulfate attenuates angiotensin II-induced hypertension, proteinuria and renal damage. Nitric Oxide 2014, 42, 87–98. [Google Scholar] [CrossRef]
- Kurian, G.A.; Mohan, D.; Balasubramanian, E.D.; Ravindran, S. Renal mitochondria can withstand hypoxic/ischemic injury secondary to renal failure in uremic rats pretreated with sodium thiosulfate. Indian. J. Pharmacol. 2017, 49, 317–321. [Google Scholar] [CrossRef]
- Baldev, N.; Sriram, R.; Prabu, P.; Gino, A.K. Effect of mitochondrial potassium channel on the renal protection mediated by sodium thiosulfate against ethylene glycol induced nephrolithiasis in rat model. Int. Braz. J. Urol. 2015, 41, 1116–1125. [Google Scholar] [CrossRef]
- Bijarnia, R.K.; Bachtler, M.; Chandak, P.G.; van Goor, H.; Pasch, A. Sodium thiosulfate ameliorates oxidative stress and pre-serves renal function in hyperoxaluric rats. PLoS ONE 2015, 10, e0124881. [Google Scholar] [CrossRef]
- Tai, I.H.; Sheen, J.M.; Lin, Y.J.; Yu, H.R.; Tiao, M.M.; Chen, C.C.; Huang, L.T.; Tain, Y.L. Maternal N-acetylcysteine therapy regulates hydrogen sulfide-generating pathway and prevents programmed hypertension in male offspring exposed to prenatal dexamethasone and postnatal high-fat diet. Nitric Oxide 2016, 53, 6–12. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.N.; Lin, Y.J.; Lu, P.C.; Tain, Y.L. Early supplementation of D-cysteine or L-cysteine prevents hypertension and kidney damage in spontaneously hypertensive rats exposed to high-salt intake. Mol. Nutr. Food Res. 2018, 62, 2. [Google Scholar] [CrossRef] [PubMed]
- Olson, K.R.; Deleon, E.R.; Gao, Y.; Hurley, K.; Sadauskas, V.; Batz, C.; Stoy, G.F. Thiosulfate: A readily accessible source of hydrogen sulfide in oxygen sensing. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2013, 305, R592–R603. [Google Scholar] [CrossRef]
- Li, Z.; Polhemus, D.J.; Lefer, D.J. Evolution of Hydrogen Sulfide Therapeutics to Treat Cardiovascular Disease. Circ. Res. 2018, 123, 590–600. [Google Scholar] [CrossRef]
- Shibuya, N.; Kimura, H. Production of hydrogen sulfide from D-cysteine and its therapeutic potential. Front. Endocrinol. 2013, 4, 87. [Google Scholar] [CrossRef]
- Wu, D.; Hu, Q.; Zhu, D. An Update on Hydrogen Sulfide and Nitric Oxide Interactions in the Cardiovascular System. Oxidative Med. Cell. Longev. 2018, 2018, 4579140. [Google Scholar] [CrossRef]
- Chen, Y.J.; Li, L.J.; Tang, W.L.; Song, J.Y.; Qiu, R.; Li, Q.; Xue, H.; Wright, J.M. First-line drugs inhibiting the renin angiotensin system versus other first-line antihypertensive drug classes for hypertension. Cochrane Database Syst. Rev. 2018, 11, CD008170. [Google Scholar] [CrossRef]
- Reckelhoff, J.F. Gender differences in the regulation of blood pressure. Hypertension 2001, 37, 1199–1208. [Google Scholar] [CrossRef]
- Kasinath, B.S.; Feliers, D.; Lee, H.J. Hydrogen sulfide as a regulatory factor in kidney health and disease. Biochem. Pharmacol. 2018, 149, 29–41. [Google Scholar] [CrossRef]
- Peleli, M.; Zampas, P.; Papapetropoulos, A. Hydrogen Sulfide and the Kidney: Physiological Roles, Contribution to Pathophysiology, and Therapeutic Potential. Antioxid. Redox Signal. 2022, 36, 220–243. [Google Scholar] [CrossRef]





| Gene | Gene Accession No | Sense | Anti-Sense |
|---|---|---|---|
| CBS | NM_012522.2 | ATGCTGCAGAAAGGCTTCAT | GTGGAAACCAGTCGGTGTCT |
| CSE | NM_017074.2 | CGCACAAATTGTCCACAAAC | GCTCTGTCCTTCTCAGGCAC |
| 3MST | NM_138843.2 | GGCTCAGTAAACATCCCATTC | TGTCCTTCACAGGGTCTTCC |
| DAO | NM_053626.1 | CCCTTTCTGGAAAAGCACAG | CTCCTCTCACCACCTCTTCG |
| Renin | J02941.1 | AACATTACCAGGGCAACTTTCACT | ACCCCCTTCATGGTGATCTG |
| AGT | XM_032887807.1 | GCCCAGGTCGCGATGAT | TGTACAAGATGCTGAGTGAGGCAA |
| ACE1 | U03734.1 | CACCGGCAAGGTCTGCTT | CTTGGCATAGTTTCGTGAGGAA |
| AT1R | NM_030985.4 | GCTGGGCAACGAGTTTGTCT | CAGTCCTTCAGCTGGATCTTCA |
| ACE2 | NM_001012006.2 | ACCCTTCTTACATCAGCCCTACTG | TGTCCAAAACCTACCCCACATAT |
| MAS | NM_203470.2 | CATCTCTCCTCTCGGCTTTGTG | CCTCATCCGGAAGCAAAGG |
| AT2R | NM_012494.4 | CAATCTGGCTGTGGCTGACTT | TGCACATCACAGGTCCAAAGA |
| R18S | X01117 | GCCGCGGTAATTCCAGCTCCA | CCCGCCCGCTCCCAAGATC |
| Group | C | CKD | NP | CKDNP | p-Value | ||
|---|---|---|---|---|---|---|---|
| PCKD | PNP | PCKD×NP | |||||
| L-citrulline (μM) | 48.1 ± 8.4 | 54.8 ± 3.3 | 50.5 ± 4.6 | 59 ± 2.5 | NS | NS | NS |
| L-arginine (μM) | 266.5 ± 12 | 211.9 ± 8.9 | 260.2 ± 16.8 | 231.5 ± 12.2 | NS | NS | NS |
| ADMA (μM) | 2 ± 0.08 | 2.12 ± 0.08 | 1.84 ± 0.08 | 2.17 ± 0.14 | NS | NS | NS |
| SDMA (μM) | 1.41 ± 0.11 | 1.94 ± 0.08 | 1.64 ± 0.11 | 2.04 ± 0.1 | NS | NS | NS |
| AAR (μM/μM) | 134.7 ± 8.4 | 100.5 ± 4.1 | 144 ± 13.1 | 107.9 ± 4.6 | 0.008 | 0.029 | NS |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tain, Y.-L.; Hsu, C.-N.; Hou, C.-Y.; Chen, C.-K. Antihypertensive Effects of a Sodium Thiosulfate-Loaded Nanoparticle in a Juvenile Chronic Kidney Disease Rat Model. Antioxidants 2024, 13, 1574. https://doi.org/10.3390/antiox13121574
Tain Y-L, Hsu C-N, Hou C-Y, Chen C-K. Antihypertensive Effects of a Sodium Thiosulfate-Loaded Nanoparticle in a Juvenile Chronic Kidney Disease Rat Model. Antioxidants. 2024; 13(12):1574. https://doi.org/10.3390/antiox13121574
Chicago/Turabian StyleTain, You-Lin, Chien-Ning Hsu, Chih-Yao Hou, and Chih-Kuang Chen. 2024. "Antihypertensive Effects of a Sodium Thiosulfate-Loaded Nanoparticle in a Juvenile Chronic Kidney Disease Rat Model" Antioxidants 13, no. 12: 1574. https://doi.org/10.3390/antiox13121574
APA StyleTain, Y.-L., Hsu, C.-N., Hou, C.-Y., & Chen, C.-K. (2024). Antihypertensive Effects of a Sodium Thiosulfate-Loaded Nanoparticle in a Juvenile Chronic Kidney Disease Rat Model. Antioxidants, 13(12), 1574. https://doi.org/10.3390/antiox13121574

