ZnO NPs Impair the Viability and Function of Porcine Granulosa Cells Through Autophagy Regulated by ROS Production
Abstract
1. Introduction
2. Materials and Methods
2.1. Characterization of ZnO NPs
2.2. PGCs Isolation and Culture
2.3. Cell Viability Assay
2.4. Cell Proliferation Assay
2.5. Cell Cycle Assay
2.6. Analysis of Steroid Hormone Production
2.7. Measurement of ROS
2.8. Measurement of Glutathione Peroxidase Activities and Superoxide Dismutase
2.9. Double Staining with MDC and DAPI
2.10. Mitochondrial Membrane Potential Detection
2.11. RNA Extraction and Quantitative Real-Time PCR
2.12. Western Blot Analysis
2.13. Statistical Analysis
3. Results
3.1. Characteristics of ZnO NPs
3.2. ZnO NPs Impair the Viability and Proliferation of PGCs
3.3. ZnO NPs Suppress Steroid Hormone Secretion in PGCs
3.4. ZnO NPs Induce Oxidative Stress to Damage Mitochondrial Membrane in PGCs
3.5. ZnO NPs Promote Autophagy in PGCs
3.6. NAC Alleviated the Autophagy Induced by ZnO NPs in PGCs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wang, C.; Zhang, L.; Su, W.; Ying, Z.; He, J.; Zhang, L.; Zhong, X.; Wang, T. Zinc Oxide Nanoparticles as a Substitute for Zinc Oxide or Colistin Sulfate: Effects on Growth, Serum Enzymes, Zinc Deposition, Intestinal Morphology and Epithelial Barrier in Weaned Piglets. PLoS ONE 2017, 12, e0181136. [Google Scholar] [CrossRef] [PubMed]
- Cho, J.H.; Upadhaya, S.D.; Kim, I.H. Effects of Dietary Supplementation of Modified Zinc Oxide on Growth Performance, Nutrient Digestibility, Blood Profiles, Fecal Microbial Shedding and Fecal Score in Weanling Pigs. Anim. Sci. J. 2015, 86, 617–623. [Google Scholar] [CrossRef] [PubMed]
- Abedini, M.; Shariatmadari, F.; Karimi Torshizi, M.A.; Ahmadi, H. Effects of Zinc Oxide Nanoparticles on the Egg Quality, Immune Response, Zinc Retention, and Blood Parameters of Laying Hens in the Late Phase of Production. J. Anim. Physiol. Anim. Nutr. 2018, 102, 736–745. [Google Scholar] [CrossRef] [PubMed]
- Mozaffari, Z.; Parivar, K.; Roodbari, N.H.; Irani, S. Histopathological Evaluation of the Toxic Effects of Zinc Oxide (ZnO) Nanoparticles on Testicular Tissue of NMRI Adult Mice. Adv. Stud. Biol. 2015, 7, 275–291. [Google Scholar] [CrossRef]
- Sharma, V.; Anderson, D.; Dhawan, A. Zinc Oxide Nanoparticles Induce Oxidative DNA Damage and ROS-Triggered Mitochondria Mediated Apoptosis in Human Liver Cells (HepG2). Apoptosis 2012, 17, 852–870. [Google Scholar] [CrossRef]
- Liu, J.; Kang, Y.; Yin, S.; Song, B.; Wei, L.; Chen, L.; Shao, L. Zinc Oxide Nanoparticles Induce Toxic Responses in Human Neuroblastoma SHSY5Y Cells in a Size-Dependent Manner. Int. J. Nanomed. 2017, 12, 8085–8099. [Google Scholar] [CrossRef]
- Kim, C.-S.; Nguyen, H.-D.; Ignacio, R.M.; Kim, J.-H.; Cho, H.-C.; Maeng, E.H.; Kim, Y.-R.; Kim, M.-K.; Park, B.-K.; Kim, S.-K. Immunotoxicity of Zinc Oxide Nanoparticles with Different Size and Electrostatic Charge. Int. J. Nanomed. 2014, 9, 195–205. [Google Scholar] [CrossRef]
- Yan, Z.; Wang, W.; Wu, Y.; Wang, W.; Li, B.; Liang, N.; Wu, W. Zinc Oxide Nanoparticle-Induced Atherosclerotic Alterations in Vitro and in Vivo. Int. J. Nanomed. 2017, 12, 4433–4442. [Google Scholar] [CrossRef]
- Chang, Y.-N.; Zhang, M.; Xia, L.; Zhang, J.; Xing, G. The Toxic Effects and Mechanisms of CuO and ZnO Nanoparticles. Materials 2012, 5, 2850–2871. [Google Scholar] [CrossRef]
- Talebi, A.R.; Khorsandi, L.; Moridian, M. The Effect of Zinc Oxide Nanoparticles on Mouse Spermatogenesis. J. Assist. Reprod. Gen. 2013, 30, 1203–1209. [Google Scholar] [CrossRef]
- Zhai, Q.-Y.; Ge, W.; Wang, J.-J.; Sun, X.-F.; Ma, J.-M.; Liu, J.-C.; Zhao, Y.; Feng, Y.-Z.; Dyce, P.W.; De Felici, M.; et al. Exposure to Zinc Oxide Nanoparticles during Pregnancy Induces Oocyte DNA Damage and Affects Ovarian Reserve of Mouse Offspring. Aging 2018, 10, 2170–2189. [Google Scholar] [CrossRef] [PubMed]
- Mohammad Hosseini, S.; Hossein Moshrefi, A.; Amani, R.; Vahid Razavimehr, S.; Hasan Aghajanikhah, M.; Sokouti, Z.; Babaei Holari, B. Subchronic Effects of Different Doses of Zinc Oxide Nanoparticle on Reproductive Organs of Female Rats: An Experimental Study. Int. J. Reprod. Biomed. 2019, 17, 107–118. [Google Scholar] [CrossRef]
- Kaipia, A.; Hsueh, A.J. Regulation of Ovarian Follicle Atresia. Annu. Rev. Physiol. 1997, 59, 349–363. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Peng, X.; Mei, S. Autophagy in Ovarian Follicular Development and Atresia. Int. J. Biol. Sci. 2019, 15, 726–737. [Google Scholar] [CrossRef] [PubMed]
- Zhao, F.; Zhao, W.; Ren, S.; Fu, Y.; Fang, X.; Wang, X.; Li, B. Roles of SIRT1 in Granulosa Cell Apoptosis during the Process of Follicular Atresia in Porcine Ovary. Anim. Reprod. Sci. 2014, 151, 34–41. [Google Scholar] [CrossRef]
- He, Y.; Deng, H.; Jiang, Z.; Li, Q.; Shi, M.; Chen, H.; Han, Z. Effects of Melatonin on Follicular Atresia and Granulosa Cell Apoptosis in the Porcine. Mol. Reprod. Dev. 2016, 83, 692–700. [Google Scholar] [CrossRef]
- Shao, T.; Ke, H.; Liu, R.; Xu, L.; Han, S.; Zhang, X.; Dang, Y.; Jiao, X.; Li, W.; Chen, Z.-J.; et al. Autophagy Regulates Differentiation of Ovarian Granulosa Cells through Degradation of WT1. Autophagy 2022, 18, 1864–1878. [Google Scholar] [CrossRef]
- Zhang, J.; Zhao, L.; Li, Y.; Dong, H.; Zhang, H.; Zhang, Y.; Ma, T.; Yang, L.; Gao, D.; Wang, X.; et al. Circadian Clock Regulates Granulosa Cell Autophagy through NR1D1-Mediated Inhibition of ATG5. Am. J. Physiol-Cell Physiol. 2022, 322, C231–C245. [Google Scholar] [CrossRef]
- Singh, S. Zinc Oxide Nanoparticles Impacts: Cytotoxicity, Genotoxicity, Developmental Toxicity, and Neurotoxicity. Toxicol. Mech. Method. 2019, 29, 300–311. [Google Scholar] [CrossRef]
- Rahman, M.A.; Ahmed, K.R.; Haque, F.; Park, M.N.; Kim, B. Recent Advances in Cellular Signaling Interplay between Redox Metabolism and Autophagy Modulation in Cancer: An Overview of Molecular Mechanisms and Therapeutic Interventions. Antioxidants 2023, 12, 428. [Google Scholar] [CrossRef]
- Yun, H.R.; Jo, Y.H.; Kim, J.; Shin, Y.; Kim, S.S.; Choi, T.G. Roles of Autophagy in Oxidative Stress. Int. J. Mol. Sci. 2020, 21, 3289. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Yao, Q.; Zhao, F.; Cui, W.; Price, C.A.; Wang, Y.; Lv, J.; Tang, H.; Jiang, Z. 1α,25(OH)2D3 Promotes the Autophagy of Porcine Ovarian Granulosa Cells as a Protective Mechanism against ROS through the BNIP3/PINK1 Pathway. Int. J. Mol. Sci. 2023, 24, 4364. [Google Scholar] [CrossRef] [PubMed]
- Lewinski, N.; Colvin, V.; Drezek, R. Cytotoxicity of Nanoparticles. Small 2008, 4, 26–49. [Google Scholar] [CrossRef]
- Huang, C.; Wu, D.; Khan, F.A.; Wang, Y.; Xu, J.; Luo, C.; Zhang, K.; Sun, F.; Huo, L. Zinc Oxide Nanoparticle Causes Toxicity to the Development of Mouse Oocyte and Early Embryo. Toxicol. Lett. 2022, 358, 48–58. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Xu, C.; Ji, G.; Liu, H.; Mo, Y.; Tollerud, D.J.; Gu, A.; Zhang, Q. Sublethal Effects of Zinc Oxide Nanoparticles on Male Reproductive Cells. Toxicol. In Vitro 2016, 35, 131–138. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.; Lv, J.; Wang, Y.; Sun, K.; Gao, H.; Li, Y.; Yao, Q.; Ma, L.; Kochshugulova, G.; Jiang, Z. ZnO NPs Induce miR-342-5p Mediated Ferroptosis of Spermatocytes through the NF-κB Pathway in Mice. J. Nanobiotechnol. 2024, 22, 390. [Google Scholar] [CrossRef] [PubMed]
- Girardello, F. ZnO Nanoparticles Alter Redox Metabolism of Limnoperna Fortunei. Environ. Sci. Pollut. Res. 2021, 28, 69416–69425. [Google Scholar] [CrossRef]
- Ding, L.; Liu, Z.; Aggrey, M.O.; Li, C.; Chen, J.; Tong, L. Nanotoxicity: The Toxicity Research Progress of Metal and Metal-Containing Nanoparticles. Mini Rev. Med. Chem. 2015, 15, 529–542. [Google Scholar] [CrossRef]
- Xiao, B.; Wang, X.; Yang, J.; Wang, K.; Zhang, Y.; Sun, B.; Zhang, T.; Zhu, L. Bioaccumulation Kinetics and Tissue Distribution of Silver Nanoparticles in Zebrafish: The Mechanisms and Influence of Natural Organic Matter. Ecotoxicol. Environ. Safe 2020, 194, 110454. [Google Scholar] [CrossRef]
- Cho, W.-S.; Kang, B.-C.; Lee, J.K.; Jeong, J.; Che, J.-H.; Seok, S.H. Comparative Absorption, Distribution, and Excretion of Titanium Dioxide and Zinc Oxide Nanoparticles after Repeated Oral Administration. Part. Fibre Toxicol. 2013, 10, 9. [Google Scholar] [CrossRef]
- Johnson, A.L. Ovarian Follicle Selection and Granulosa Cell Differentiation. Poult. Sci. 2015, 94, 781–785. [Google Scholar] [CrossRef] [PubMed]
- Knapczyk-Stwora, K.; Grzesiak, M.; Ciereszko, R.E.; Czaja, E.; Koziorowski, M.; Slomczynska, M. The Impact of Sex Steroid Agonists and Antagonists on Folliculogenesis in the Neonatal Porcine Ovary via Cell Proliferation and Apoptosis. Theriogenology 2018, 113, 19–26. [Google Scholar] [CrossRef] [PubMed]
- Matsuda, F.; Inoue, N.; Manabe, N.; Ohkura, S. Follicular Growth and Atresia in Mammalian Ovaries: Regulation by Survival and Death of Granulosa Cells. J. Reprod. Dev. 2012, 58, 44–50. [Google Scholar] [CrossRef] [PubMed]
- Sugiura, K.; Su, Y.-Q.; Li, Q.; Wigglesworth, K.; Matzuk, M.M.; Eppig, J.J. Estrogen Promotes the Development of Mouse Cumulus Cells in Coordination with Oocyte-Derived GDF9 and BMP15. Mol. Endocrinol. 2010, 24, 2303–2314. [Google Scholar] [CrossRef] [PubMed]
- Santacruz-Márquez, R.; Flaws, J.A. Exposure to Zinc Oxide Nanoparticles Increases Estradiol Levels and Induces an Antioxidant Response in Antral Ovarian Follicles In Vitro. Toxics 2023, 11, 602. [Google Scholar] [CrossRef]
- Farkas, J.; Salaberria, I.; Styrishave, B.; Staňková, R.; Ciesielski, T.M.; Olsen, A.J.; Posch, W.; Flaten, T.P.; Krøkje, Å.; Salvenmoser, W.; et al. Exposure of Juvenile Turbot (Scophthalmus Maximus) to Silver Nanoparticles and 17α-Ethinylestradiol Mixtures: Implications for Contaminant Uptake and Plasma Steroid Hormone Levels. Environ. Pollut. 2017, 220, 328–336. [Google Scholar] [CrossRef]
- Stocco, D.M. StAR Protein and the Regulation of Steroid Hormone Biosynthesis. Annu. Rev. Physiol. 2001, 63, 193–213. [Google Scholar] [CrossRef]
- Guo, I.-C.; Shih, M.-C.; Lan, H.-C.; Hsu, N.-C.; Hu, M.-C.; Chung, B.-C. Transcriptional Regulation of Human CYP11A1 in Gonads and Adrenals. J. Biomed. Sci. 2007, 14, 509–515. [Google Scholar] [CrossRef]
- Aventaggiato, M.; Preziosi, A.; Cheraghi Bidsorkhi, H.; Schifano, E.; Vespa, S.; Mardente, S.; Zicari, A.; Uccelletti, D.; Mancini, P.; Lotti, L.V.; et al. ZnO Nanorods Create a Hypoxic State with Induction of HIF-1 and EPAS1, Autophagy, and Mitophagy in Cancer and Non-Cancer Cells. Int. J. Mol. Sci. 2023, 24, 6971. [Google Scholar] [CrossRef]
- Xiong, P.; Huang, X.; Ye, N.; Lu, Q.; Zhang, G.; Peng, S.; Wang, H.; Liu, Y. Cytotoxicity of Metal-Based Nanoparticles: From Mechanisms and Methods of Evaluation to Pathological Manifestations. Adv. Sci. 2022, 9, 2106049. [Google Scholar] [CrossRef]
- Mohammadinejad, R.; Moosavi, M.A.; Tavakol, S.; Vardar, D.Ö.; Hosseini, A.; Rahmati, M.; Dini, L.; Hussain, S.; Mandegary, A.; Klionsky, D.J. Necrotic, Apoptotic and Autophagic Cell Fates Triggered by Nanoparticles. Autophagy 2019, 15, 4–33. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Zou, L.; Bao, M.; Feng, Q.; Xia, W.; Zhu, C. Toxicity of Polystyrene Nanoparticles for Mouse Ovary and Cultured Human Granulosa Cells. Ecotoxicol. Environ. Safe 2023, 249, 114371. [Google Scholar] [CrossRef] [PubMed]
- Tabandeh, M.R.; Samie, K.A.; Mobarakeh, E.S.; Khadem, M.D.; Jozaie, S. Silver Nanoparticles Induce Oxidative Stress, Apoptosis and Impaired Steroidogenesis in Ovarian Granulosa Cells of Cattle. Anim. Reprod. Sci. 2022, 236, 106908. [Google Scholar] [CrossRef] [PubMed]
- Meng, J.; Zhou, X.; Yang, J.; Qu, X.; Cui, S. Exposure to Low Dose ZnO Nanoparticles Induces Hyperproliferation and Malignant Transformation through Activating the CXCR2/NF-κB/STAT3/ERK and AKT Pathways in Colonic Mucosal Cells. Environ. Pollut. 2020, 263, 114578. [Google Scholar] [CrossRef]
- Zhang, C. “Iron Free” Zinc Oxide Nanoparticles with Ion-Leaking Properties Disrupt Intracellular ROS and Iron Homeostasis to Induce Ferroptosis. Cell Death Dis. 2020, 11, 183. [Google Scholar] [CrossRef]
- Chen, G.-H.; Song, C.-C.; Zhao, T.; Hogstrand, C.; Wei, X.-L.; Lv, W.-H.; Song, Y.-F.; Luo, Z. Mitochondria-Dependent Oxidative Stress Mediates ZnO Nanoparticle (ZnO NP)-Induced Mitophagy and Lipotoxicity in Freshwater Teleost Fish. Environ. Sci. Technol. 2022, 56, 2407–2420. [Google Scholar] [CrossRef]
- Ma, L.; Liu, J.; Li, N.; Wang, J.; Duan, Y.; Yan, J.; Liu, H.; Wang, H.; Hong, F. Oxidative Stress in the Brain of Mice Caused by Translocated Nanoparticulate TiO2 Delivered to the Abdominal Cavity. Biomaterials 2010, 31, 99–105. [Google Scholar] [CrossRef]
- Cai, Q.; Shu, X.-O.; Wen, W.; Cheng, J.-R.; Dai, Q.; Gao, Y.-T.; Zheng, W. Genetic Polymorphism in the Manganese Superoxide Dismutase Gene, Antioxidant Intake, and Breast Cancer Risk: Results from the Shanghai Breast Cancer Study. Breast Cancer Res. 2004, 6, R647–R655. [Google Scholar] [CrossRef]
- Tripathi, A.; Khatun, S.; Pandey, A.N.; Mishra, S.K.; Chaube, R.; Shrivastav, T.G.; Chaube, S.K. Intracellular Levels of Hydrogen Peroxide and Nitric Oxide in Oocytes at Various Stages of Meiotic Cell Cycle and Apoptosis. Free Radic. Res. 2009. [Google Scholar] [CrossRef]
- Lu, J.; Wang, Z.; Cao, J.; Chen, Y.; Dong, Y. A Novel and Compact Review on the Role of Oxidative Stress in Female Reproduction. Reprod. Biol. Endocrinol. 2018, 16, 80. [Google Scholar] [CrossRef]
- Jozwik, M.; Wolczynski, S.; Jozwik, M.; Szamatowicz, M. Oxidative Stress Markers in Preovulatory Follicular Fluid in Humans. Mol. Hum. Reprod. 1999, 5, 409–413. [Google Scholar] [CrossRef] [PubMed]
- Chiarelli, R.; Martino, C.; Agnello, M.; Bosco, L.; Roccheri, M.C. Autophagy as a Defense Strategy against Stress: Focus on Paracentrotus Lividus Sea Urchin Embryos Exposed to Cadmium. Cell Stress Chaperones 2016, 21, 19–27. [Google Scholar] [CrossRef] [PubMed]
- Pankiv, S.; Clausen, T.H.; Lamark, T.; Brech, A.; Bruun, J.-A.; Outzen, H.; Øvervatn, A.; Bjørkøy, G.; Johansen, T. P62/SQSTM1 Binds Directly to Atg8/LC3 to Facilitate Degradation of Ubiquitinated Protein Aggregates by Autophagy. J. Biol. Chem. 2007, 282, 24131–24145. [Google Scholar] [CrossRef]
- Mawed, S.A.; Marini, C.; Alagawany, M.; Farag, M.R.; Reda, R.M.; El-Saadony, M.T.; Elhady, W.M.; Magi, G.E.; Di Cerbo, A.; El-Nagar, W.G. Zinc Oxide Nanoparticles (ZnO-NPs) Suppress Fertility by Activating Autophagy, Apoptosis, and Oxidative Stress in the Developing Oocytes of Female Zebrafish. Antioxidants 2022, 11, 1567. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Tian, M.; Hua, T.; Wang, H.; Yang, M.; Li, W.; Zhang, X.; Yuan, H. Combination of Autophagy and NFE2L2/NRF2 Activation as a Treatment Approach for Neuropathic Pain. Autophagy 2021, 17, 4062–4082. [Google Scholar] [CrossRef]
- Wang, Y.-T.; Liu, T.-Y.; Shen, C.-H.; Lin, S.-Y.; Hung, C.-C.; Hsu, L.-C.; Chen, G.-C. K48/K63-Linked Polyubiquitination of ATG9A by TRAF6 E3 Ligase Regulates Oxidative Stress-Induced Autophagy. Cell Rep. 2022, 38, 110354. [Google Scholar] [CrossRef]
Gene | Primer Sequence (5′-3′) | Genebank No. | Size (bp) |
---|---|---|---|
β-actin | F: TGCGGGACATCAAGGAGAAG | XM_003124280.5 | 216 |
R: AGTTGAAGGTGGTCTCGTGG | |||
SQSTM1 | F: AAGCTGAGACATGGGCACTT | XM_003123639.4 | 173 |
R: ACACTCTCCCCTACGTTCTTG | |||
ATG7 | F: AGATTGCCTGGTGGGTGGT | NM_001190285.1 | 140 |
R: GGGTGATGCTGGAGGAGTTG | |||
LC3 | F: GCCTCTCAGGAGACTTTCGG | NM_001190290.1 | 214 |
R: GAGCTCCGTTTTTCTGCGTG | |||
BECN1 | F: AGGAGCTGCCGTTGTACTGT | NM_001044530.1 | 189 |
R: CACTGCCTCCTGTGTCTTCA | |||
STAR | F: CGTCGGAGCTCTCTTCTTGG | NM_213755.2 | 124 |
R: CCTCCTGGTTGCTGAGGATG | |||
CYP11A1 | F: CGAAGGACCCAACCCAGAACGA | NM_214427.1 | 237 |
R: CCAGAACCCTGCTGCTTGATGC | |||
HSD3B1 | F: ATTTCTCGGTGCCCAGGTTT | NM_001004049.2 | 180 |
R: GCTCTGGAGCTTAGAAAATTCCTC | |||
CYP19A1 | F: AGAAGGGTCACAACAAGACAG | NM_214429.1 | 125 |
R: AGGCACAACTTCAGACACCAT | |||
SOD2 | F: GGCCTACGTGAACAACCTGA | NM_214127.2 | 126 |
R: TGATTGATGTGGCCTCCACC | |||
GPX1 | F: CTAGCAGTGCCTAGAGTGCC | NM_214201.1 | 142 |
R: CGCCCATCTCAGGGGATTTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Lv, J.; Liu, G.; Yao, Q.; Wang, Z.; Liu, N.; He, Y.; Il, D.; Tusupovich, J.I.; Jiang, Z. ZnO NPs Impair the Viability and Function of Porcine Granulosa Cells Through Autophagy Regulated by ROS Production. Antioxidants 2024, 13, 1295. https://doi.org/10.3390/antiox13111295
Wang Y, Lv J, Liu G, Yao Q, Wang Z, Liu N, He Y, Il D, Tusupovich JI, Jiang Z. ZnO NPs Impair the Viability and Function of Porcine Granulosa Cells Through Autophagy Regulated by ROS Production. Antioxidants. 2024; 13(11):1295. https://doi.org/10.3390/antiox13111295
Chicago/Turabian StyleWang, Yifan, Jing Lv, Guangyu Liu, Qichun Yao, Ziqi Wang, Ning Liu, Yutao He, Dmitry Il, Jakupov Isatay Tusupovich, and Zhongliang Jiang. 2024. "ZnO NPs Impair the Viability and Function of Porcine Granulosa Cells Through Autophagy Regulated by ROS Production" Antioxidants 13, no. 11: 1295. https://doi.org/10.3390/antiox13111295
APA StyleWang, Y., Lv, J., Liu, G., Yao, Q., Wang, Z., Liu, N., He, Y., Il, D., Tusupovich, J. I., & Jiang, Z. (2024). ZnO NPs Impair the Viability and Function of Porcine Granulosa Cells Through Autophagy Regulated by ROS Production. Antioxidants, 13(11), 1295. https://doi.org/10.3390/antiox13111295