PGC-1α Agonist Rescues Doxorubicin-Induced Cardiomyopathy by Mitigating the Oxidative Stress and Necroptosis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Mice and Experimental Procedures
2.2. Gene Expression by Quantitative PCR (qPCR)
2.3. Immunofluorescence
2.4. Histological Analysis
2.5. Protein Quantification by Enzyme Linked Immune Sorbent Assay (ELISA)
2.6. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Primo, G.; LeClerc, J.L.; Goldstein, J.P.; DeSmet, J.M.; Joris, M.P. Cardiac transplantation for the treatment of end stage ischemic cardiomyopathy. Adv. Cardiol. 1988, 36, 293–297. [Google Scholar]
- Richardson, P. Report of the 1995 World Health Organization/International Society and Federation of Cardiology Task Force on the Definition and Classification of Cardiomyopathies. Circulation 1996, 93, 841–842. [Google Scholar]
- Hudson, M.M.; Ness, K.K.; Gurney, J.G.; Mulrooney, D.A.; Chemaitilly, W.; Krull, K.R.; Green, D.M.; Armstrong, G.T.; Nottage, K.A.; Jones, K.E.; et al. Clinical ascertainment of health outcomes among adults treated for childhood cancer. JAMA 2013, 309, 2371–2381. [Google Scholar] [CrossRef]
- Volkova, M.; Russell, R., 3rd. Anthracycline cardiotoxicity: Prevalence, pathogenesis and treatment. Curr. Cardiol. Rev. 2011, 7, 214–220. [Google Scholar] [CrossRef]
- Swain, S.M.; Whaley, F.S.; Ewer, M.S. Congestive heart failure in patients treated with doxorubicin: A retrospective analysis of three trials. Cancer 2003, 97, 2869–2879. [Google Scholar] [CrossRef]
- Lefrak, E.A.; Piťha, J.; Rosenheim, S.; Gottlieb, J.A. A clinicopathologic analysis of adriamycin cardiotoxicity. Cancer 1973, 32, 302–314. [Google Scholar]
- Shi, Y.; Moon, M.; Dawood, S.; McManus, B.; Liu, P.P. Mechanisms and management of doxorubicin cardiotoxicity. Herz 2011, 36, 296–305. [Google Scholar]
- Zhang, S.; Liu, X.; Bawa-Khalfe, T.; Lu, L.-S.; Lyu, Y.L.; Liu, L.F.; Yeh, E.T.H. Identification of the molecular basis of doxorubicin-induced cardiotoxicity. Nat. Med. 2012, 18, 1639–1642. [Google Scholar]
- Tang, D.; Kang, R.; Berghe, T.V.; Vandenabeele, P.; Kroemer, G. The molecular machinery of regulated cell death. Cell Res. 2019, 29, 347–364. [Google Scholar]
- Galluzzi, L.; Vitale, I.; Aaronson, S.A.; Abrams, J.M.; Adam, D.; Agostinis, P.; Alnemri, E.S.; Altucci, L.; Amelio, I.; Andrews, D.W.; et al. Molecular mechanisms of cell death: Recommendations of the Nomenclature Committee on Cell Death 2018. Cell Death Differ. 2018, 25, 486–541. [Google Scholar]
- Christidi, E.; Brunham, L.R. Regulated cell death pathways in doxorubicin-induced cardiotoxicity. Cell Death Dis. 2021, 12, 339. [Google Scholar] [PubMed]
- Yu, X.; Ruan, Y.; Huang, X.; Dou, L.; Lan, M.; Cui, J.; Chen, B.; Gong, H.; Wang, Q.; Yan, M.; et al. Dexrazoxane ameliorates doxorubicin-induced cardiotoxicity by inhibiting both apoptosis and necroptosis in cardiomyocytes. Biochem. Biophys. Res. Commun. 2020, 523, 140–146. [Google Scholar] [PubMed]
- ErdogmusOzgen, Z.; Erdinc, M.; Kelle, I.; Erdinc, L.; Nergiz, Y. Protective effects ofnecrostatin-1 on doxorubicin-induced cardiotoxicity in rat heart. Hum. Exp. Toxicol. 2022, 41, 9603271211066066. [Google Scholar]
- Kaczmarek, A.; Vandenabeele, P.; Krysko, D.V. Necroptosis: The release of damage-associated molecular patterns and its physiological relevance. Immunity 2013, 38, 209–223. [Google Scholar] [PubMed]
- Chan, J.K.; Roth, J.; Oppenheim, J.J.; Tracey, K.J.; Vogl, T.; Feldmann, M.; Horwood, N.; Nanchahal, J. Alarmins: Awaiting a clinical response. J. Clin. Investig. 2012, 122, 2711–2719. [Google Scholar] [PubMed]
- Satish, S.; Philipose, H.; Rosales, M.A.B.; Saint-Geniez, M. Pharmaceutical Induction of PGC-1α Promotes Retinal Pigment Epithelial Cell Metabolism and Protects against Oxidative Damage. Oxid. Med. Cell. Longev. 2018, 2018, 9248640. [Google Scholar] [CrossRef]
- Dinulovic, I.; Furrer, R.; DiFulvio, S.; Ferry, A.; Beer, M.; Handschin, C. PGC-1α modulates necrosis, inflammatory response, and fibrotic tissue formation in injured skeletal muscle. Skelet. Muscle 2016, 6, 38. [Google Scholar]
- Rius-Pérez, S.; Torres-Cuevas, I.; Millán, I.; Ortega, Á.L.; Pérez, S. PGC-1α, Inflammation, and Oxidative Stress: An Integrative View in Metabolism. Oxid. Med. Cell. Longev. 2020, 2020, 1452696. [Google Scholar]
- Liang, D.; Zhuo, Y.; Guo, Z.; He, L.; Wang, X.; He, Y.; Li, L.; Dai, H. SIRT1/PGC-1 pathway activation triggers autophagy/mitophagy and attenuates oxidative damage in intestinal epithelial cells. Biochimie 2020, 170, 10–20. [Google Scholar] [CrossRef]
- PeresDiaz, L.S.; Schuman, M.L.; Aisicovich, M.; Toblli, J.E.; Pirola, C.J.; Landa, M.S.; García, S.I. Short-term doxorubicin cardiotoxic effects: Involvement of cardiac Thyrotropin Releasing Hormone system. Life Sci. 2020, 261, 118346. [Google Scholar] [CrossRef]
- Sun, J.; Li, J.Y.; Zhang, L.Q.; Li, D.Y.; Wu, J.Y.; Gao, S.J.; Liu, D.Q.; Zhou, Y.Q.; Mei, W. Nrf2 Activation Attenuates Chronic Constriction Injury-Induced Neuropathic Pain via Induction of PGC-1α-Mediated Mitochondrial Biogenesis in the Spinal Cord. Oxid. Med. Cell. Longev. 2021, 2021, 9577874. [Google Scholar]
- Xu, Y.; Kabba, J.A.; Ruan, W.; Wang, Y.; Zhao, S.; Song, X.; Zhang, L.; Li, J.; Pang, T. The PGC-1α Activator ZLN005 Ameliorates Ischemia-Induced Neuronal Injury In Vitro and In Vivo. Cell. Mol. Neurobiol. 2018, 38, 929–939. [Google Scholar] [CrossRef] [PubMed]
- Wallace, K.B.; Sardão, V.A.; Oliveira, P.J. Mitochondrial Determinants of Doxorubicin-Induced Cardiomyopathy. Circ. Res. 2020, 126, 926–941. [Google Scholar] [PubMed]
- Osataphan, N.; Phrommintikul, A.; Chattipakorn, S.C.; Chattipakorn, N. Effects of doxorubicin-induced cardiotoxicity on cardiac mitochondrial dynamics and mitochondrial function: Insights for future interventions. J. Cell. Mol. Med. 2020, 24, 6534–6557. [Google Scholar] [CrossRef]
- Liu, Y.; Bai, H.; Guo, F.; Thai, P.N.; Luo, X.; Zhang, P.; Yang, C.; Feng, X.; Zhu, D.; Guo, J.; et al. PGC-1αactivatorZLN005promotes maturation of cardiomyocytes derived from human embryonic stem cells. Aging 2020, 12, 7411–7430. [Google Scholar] [PubMed]
- Zhou, Q.; Xu, H.; Yan, L.; Ye, L.; Zhang, X.; Tan, B.; Yi, Q.; Tian, J.; Zhu, J. PGC-1α promotes mitochondrial respiration and biogenesis during the differentiation of hiPSCs into cardiomyocytes. Genes Dis. 2021, 8, 891–906. [Google Scholar] [CrossRef]
- Brainard, R.E.; Facundo, H.T. Cardiac hypertrophy drives PGC-1α suppression associated with enhanced O-glycosylation. Biochim. Et Biophys. Acta (BBA) Mol. Basis Dis. 2021, 1867, 166080. [Google Scholar] [CrossRef]
- Zhu, P.; Ma, H.; Cui, S.; Zhou, X.; Xu, W.; Yu, J.; Li, J. ZLN005 Alleviates In Vivo and In Vitro Renal Fibrosis viaPGC-1α-Mediated Mitochondrial Homeostasis. Pharmaceuticals 2022, 15, 434. [Google Scholar] [CrossRef]
- Shi, Z.; Wang, S.; Deng, J.; Gong, Z. PGC-1α attenuates the oxidative stress-induced impaired osteogenesis and angiogenesis regulation effects of mesenchymal stem cells in the presence of diabetic serum. Biochem. Biophys. Rep. 2021, 27, 101070. [Google Scholar] [CrossRef]
- Valle, I.; Alvarez-Barrientos, A.; Arza, E.; Lamas, S.; Monsalve, M. PGC-1alpha regulates the mitochondrial antioxidant defense system in vascular endothelial cells. Cardiovasc. Res. 2005, 66, 562–573. [Google Scholar] [CrossRef]
- DiMinno, A.; Turnu, L.; Porro, B.; Squellerio, I.; Cavalca, V.; Tremoli, E.; DiMinno, M.N. 8-Hydroxy-2-Deoxyguanosine Levels and Cardiovascular Disease: A Systematic Review and Meta-Analysis of the Literature. Antioxid. Redox Signal. 2016, 24, 548–555. [Google Scholar] [CrossRef] [PubMed]
- Thomas, M.C.; Woodward, M.; Li, Q.; Pickering, R.; Tikellis, C.; Poulter, N.; Cooper, M.E.; Marre, M.; Zoungas, S.; Chalmers, J. Relationship Between Plasma 8-OH-Deoxyguanosine and Cardiovascular Disease and Survival in Type 2 Diabetes Mellitus: Results From the ADVANCE Trial. J. Am. Heart Assoc. 2018, 7, e008226. [Google Scholar] [CrossRef] [PubMed]
- Qin, F.; Lennon-Edwards, S.; Lancel, S.; Biolo, A.; Siwik, D.A.; Pimentel, D.R.; Dorn, G.W.; Kang, Y.J.; Colucci, W.S. Cardiac-specific overexpression of catalase identifies hydrogen peroxide-dependent and-independent phases of myocardial remodeling and prevents the progression to overt heart failure in G(alpha)q-over expressing transgenic mice. Circ. Heart Fail. 2010, 3, 306–313. [Google Scholar] [CrossRef]
- Li, X.; Lin, Y.; Wang, S.; Zhou, S.; Ju, J.; Wang, X.; Chen, Y.; Xia, M. Extracellular Superoxide Dismutase Is Associated With Left Ventricular Geometry and Heart Failure in Patients With Cardiovascular Disease. J. Am. Heart Assoc. 2020, 9, e016862. [Google Scholar] [CrossRef] [PubMed]
- vanDeel, E.D.; Lu, Z.; Xu, X.; Zhu, G.; Hu, X.; Oury, T.D.; Bache, R.J.; Duncker, D.J.; Chen, Y. Extracellular superoxide dismutase protects the heart against oxidative stress and hypertrophy after myocardial infarction. Free Radic. Biol. Med. 2008, 44, 1305–1313. [Google Scholar] [CrossRef]
- Sorci, G.; Riuzzi, F.; Agneletti, A.L.; Marchetti, C.; Donato, R. S100B inhibits myogenic differentiation and myotube formationin a RAGE-independent manner. Mol. Cell. Biol. 2003, 23, 4870–4881. [Google Scholar] [CrossRef]
- Tubaro, C.; Arcuri, C.; Giambanco, I.; Donato, R. S100B protein in myoblasts modulates myogenic differentiation via NF-kappa B-dependent inhibition of MyoD expression. J. Cell. Physiol. 2010, 223, 270–282. [Google Scholar]
- Tubaro, C.; Arcuri, C.; Giambanco, I.; Donato, R. S100B in myoblasts regulates the transition from activation to quiescence and from quiescence to activation and reduces apoptosis. Biochim. Et Biophys. Acta (BBA) Mol. Cell Res. 2011, 1813, 1092–1104. [Google Scholar] [CrossRef]
- Andrassy, M.; Volz, H.C.; Igwe, J.C.; Funke, B.; Eichberger, S.N.; Kaya, Z.; Buss, S.; Autschbach, F.; Pleger, S.T.; Lukic, I.K.; et al. High-Mobility Group Box-1 in Ischemia-Reperfusion Injury of the Heart. Circulation 2008, 117, 3216–3226. [Google Scholar] [CrossRef]
- Yao, Y.; Xu, X.; Zhang, G.; Zhang, Y.; Qian, W.; Rui, T. Role of HMGB1 in doxorubicin-induced myocardial apoptosis and its regulation pathway. Basic Res. Cardiol. 2012, 107, 267. [Google Scholar] [CrossRef]
- Bosire, R.; Fadel, L.; Mocsár, G.; Nánási, P.; Sen, P.; Sharma, A.K.; Naseem, M.U.; Kovács, A.; Kugel, J.; Kroemer, G.; et al. Doxorubicin impacts chromatin binding of HMGB1, Histone H1 and retinoic acid receptor. Sci. Rep. 2022, 12, 8087. [Google Scholar] [CrossRef]
- Liu, C.; Cai, Z.; Hu, T.; Yao, Q.; Zhang, L. Cathepsin B aggravated doxorubicin-induced myocardial injury via NF-κB signalling. Mol. Med. Rep. 2020, 22, 4848–4856. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.Q.; Xu, M.; Yuan, Y.; Li, F.F.; Yang, Z.; Liu, Y.; Zhou, M.Q.; Bian, Z.Y.; Deng, W.; Gao, L.; et al. Cathepsin B deficiency attenuates cardiac remodeling in response to pressure overload via TNF-α/ASK1/JNK pathway. Am. J. Physiol. Heart Circ. Physiol. 2015, 308, H1143–H1154. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Yao, Q.; Hu, T.; Cai, Z.; Xie, Q.; Zhao, J.; Yuan, Y.; Ni, J.; Wu, Q.Q. Cathepsin B deteriorates diabetic cardiomyopathy induced by streptozotocin via promoting NLRP3-mediatedpyroptosis. Mol. Ther. Nucleic Acids 2022, 30, 198–207. [Google Scholar] [CrossRef]
- Valiente-Alandi, I.; Potter, S.J.; Salvador, A.M.; Schafer, A.E.; Schips, T.; Carrillo-Salinas, F.; Gibson, A.M.; Nieman, M.L.; Perkins, C.; Sargent, M.A.; et al. Inhibiting Fibronectin Attenuates Fibrosis and Improves Cardiac Function in a Model of Heart Failure. Circulation 2018, 138, 1236–1252. [Google Scholar] [CrossRef] [PubMed]
- Querejeta, R.; López, B.; González, A.; Sánchez, E.; Larman, M.; Ubago, J.L.M.; Díez, J. Increased Collagen Type I Synthesis in Patients With Heart Failure of Hypertensive Origin. Circulation 2004, 110, 1263–1268. [Google Scholar] [CrossRef]
- Wei, S.; Chow, L.T.C.; Shum, I.O.L.; Qin, L.; Sanderson, J.E. Left and right ventricular collagen type I/III ratios and remodeling post-myocardial infarction. J. Card. Fail. 1999, 5, 117–126. [Google Scholar] [CrossRef]
S.No. | Gene Name | Accession ID | Forward Primer (5′→3′) Reverse Primer (5′→3′) |
---|---|---|---|
1. | CTSB | NM_007798.3 | GGCTCTTGTTGGGCATTTGG |
CAGCTTCACAGCTCTTGTTGC | |||
2. | HMGB1 | NM_001313894.1 | TCCCTCATCCTTGTTTACTCG |
GCAGTTTCCTATCGCTTTGG | |||
3. | RIPK1 | NM_001359997.1 | AGGTGTCCTTGTGTTACC |
CCTCCACGATTATCCTTCC | |||
4. | RIPK3 | NM_019955.2 | AAGACAGTCCTTGCCACTTCC |
TGGGTCAAGAGTCAGTTTGGG | |||
5. | MLKL | NM_001310613.1 | ATGCCAGCGTCTAGGAAACC |
TCGGGCAGGTTCTTCTTTCC | |||
6. | S100B | NM_009115.3 | ACAACGAGCTCTCTCACTTCC |
CATCTTCGTCCAGCGTCTCC | |||
7. | PGC-1α | NM_008904.3 | GCACACACCGCAATTCTCC |
AGGCTTCATAGCTGTCGTACC | |||
8. | GAPDH | NM_001411843.1 | AACTTTGGCATTGTGGAAGGG |
CATCACGCCACAGCTTTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shipra; Tembhre, M.K.; Hote, M.P.; Bhari, N.; Lakshmy, R.; Kumaran, S.S. PGC-1α Agonist Rescues Doxorubicin-Induced Cardiomyopathy by Mitigating the Oxidative Stress and Necroptosis. Antioxidants 2023, 12, 1720. https://doi.org/10.3390/antiox12091720
Shipra, Tembhre MK, Hote MP, Bhari N, Lakshmy R, Kumaran SS. PGC-1α Agonist Rescues Doxorubicin-Induced Cardiomyopathy by Mitigating the Oxidative Stress and Necroptosis. Antioxidants. 2023; 12(9):1720. https://doi.org/10.3390/antiox12091720
Chicago/Turabian StyleShipra, Manoj Kumar Tembhre, Milind Padmakar Hote, Neetu Bhari, Ramakrishnan Lakshmy, and S. Senthil Kumaran. 2023. "PGC-1α Agonist Rescues Doxorubicin-Induced Cardiomyopathy by Mitigating the Oxidative Stress and Necroptosis" Antioxidants 12, no. 9: 1720. https://doi.org/10.3390/antiox12091720