Antioxidant Activity of Sweet Whey Derived from Bovine, Ovine and Caprine Milk Obtained from Various Small-Scale Cheese Plants in Greece before and after In Vitro Simulated Gastrointestinal Digestion
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Collection and Preparation of Samples
2.3. In Vitro Digestion Protocol
2.3.1. Simulated Oral Digestion
2.3.2. Simulated Gastric Digestion
2.3.3. Simulated Intestinal Digestion
2.3.4. Digestates’ Fractionation
2.4. Biochemical Assays
2.4.1. Oxygen Radical Antioxidant Capacity (ORAC)
2.4.2. 2,2′-Azinobis (3-Ethylbenzothiazoline-6-Sulfonic Acid) Radical Scavenging Assay (ABTS)
2.4.3. Ferric Reducing Antioxidant Power (FRAP)
2.4.4. Potassium Ferricyanide Reducing Power (P-FRAP)
2.5. Cellular Assays
2.5.1. Cell Culture and Cell Viability of HT29
2.5.2. Cellular Antioxidant Activity (CAA) Assay
2.5.3. Cell Culture and Differentiation of THP-1
2.5.4. Quantification of mRNA Transcripts Using Real Time-PCR (qPCR)
2.6. Statistical Analysis
3. Results and Discussion
3.1. Assessment of Antioxidant Activity of SW before and after In Vitro Digestion Using ORAC, ABTS, FRAP and P-FRAP Biochemical Assays
Effect of Milk Animal Origin
3.2. Assessment of Cellular Antioxidant Activity of SW-D-P3
3.3. Effect of SW-D-P3 on Expression of Antioxidant Genes
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bintsis, T.; Papademas, P. Sustainable Approaches in Whey Cheese Production: A Review. Dairy 2023, 4, 249–270. [Google Scholar]
- Barba, F.J. An integrated approach for the valorization of cheese whey. Foods 2021, 10, 564. [Google Scholar] [CrossRef] [PubMed]
- Aspri, M.; Leni, G.; Galaverna, G.; Papademas, P. Bioactive properties of fermented donkey milk, before and after in vitro simulated gastrointestinal digestion. Food Chem. 2018, 268, 476–484. [Google Scholar] [CrossRef] [PubMed]
- Akan, E. An evaluation of the in vitro antioxidant and antidiabetic potentials of camel and donkey milk peptides released from casein and whey proteins. J. Food Sci. Technol. 2021, 58, 3743–3751. [Google Scholar] [CrossRef]
- Kleekayai, T.; O’neill, A.; Clarke, S.; Holmes, N.; O’sullivan, B.; Fitzgerald, R.J. Contribution of Hydrolysis and Drying Conditions to Whey Protein Hydrolysate Characteristics and In Vitro Antioxidative Properties. Antioxidants 2022, 11, 399. [Google Scholar] [CrossRef]
- Corrochano, A.R.; Buckin, V.; Kelly, P.M.; Giblin, L. Invited review: Whey proteins as antioxidants and promoters of cellular antioxidant pathways. J. Dairy Sci. 2018, 101, 4747–4761. [Google Scholar] [CrossRef] [PubMed]
- Tong, L.M.; Sasaki, S.; McClements, D.J.; Decker, E.A. Antioxidant activity of whey in a salmon oil emulsion. J. Food Sci. 2000, 65, 1325–1329. [Google Scholar] [CrossRef]
- Tong, L.M.; Sasaki, S.; McClements, D.J.; Decker, E.A. Mechanisms of the antioxidant activity of a high molecular weight fraction of whey. J. Agric. Food Chem. 2000, 48, 1473–1478. [Google Scholar] [CrossRef]
- Carrasco-Castilla, J.; Hernández-Álvarez, A.J.; Jiménez-Martínez, C.; Jacinto-Hernández, C.; Alaiz, M.; Girón-Calle, J.; Vioque, J.; Dávila-Ortiz, G. Antioxidant and metal chelating activities of peptide fractions from phaseolin and bean protein hydrolysates. Food Chem. 2012, 135, 1789–1795. [Google Scholar] [CrossRef]
- Hayes, M.; Ross, R.P.; Fitzgerald, G.F.; Stanton, C. Putting microbes to work: Diary fermentation, cell factories and bioactive peptides. Part I: Overview. Biotechnol. J. 2007, 2, 426–434. [Google Scholar] [CrossRef]
- Bustamante, S.Z.; González, J.G.; Sforza, S.; Tedeschi, T. Bioactivity and peptide profile of whey protein hydrolysates obtained from Colombian double-cream cheese production and their products after gastrointestinal digestion. LWT 2021, 145, 111334. [Google Scholar] [CrossRef]
- Guo, Y.; Jiang, X.; Xiong, B.; Zhang, T.; Zeng, X.; Wu, Z.; Sun, Y.; Pan, D. Production and transepithelial transportation of angiotensin-I-converting enzyme (ACE)-inhibitory peptides from whey protein hydrolyzed by immobilized Lactobacillus helveticus proteinase. J. Dairy Sci. 2019, 102, 961–975. [Google Scholar] [CrossRef]
- Wolfe, K.L.; Rui, H.L. Cellular antioxidant activity (CAA) assay for assessing antioxidants, foods, and dietary supplements. J. Agric. Food Chem. 2007, 55, 8896–8907. [Google Scholar] [CrossRef]
- Faller, A.L.K.; Fialho, E.; Liu, R.H. Cellular antioxidant activity of Feijoada whole meal coupled with an in vitro digestion. J. Agric. Food Chem. 2012, 60, 4826–4832. [Google Scholar] [CrossRef]
- Bothon, F.T.D.; Debiton, E.; Avlessi, F.; Forestier, C.; Teulade, J.C.; Sohounhloue, D.K.C. In vitro biological effects of two anti-diabetic medicinal plants used in Benin as folk medicine. BMC Complement. Altern. Med. 2013, 13, 51. [Google Scholar] [CrossRef]
- Girard-Lalancette, K.; Pichette, A.; Legault, J. Sensitive cell-based assay using DCFH oxidation for the determination of pro- and antioxidant properties of compounds and mixtures: Analysis of fruit and vegetable juices. Food Chem. 2009, 115, 720–726. [Google Scholar] [CrossRef]
- Wan, H.; Liu, D.; Yu, X.; Sun, H.; Li, Y. A Caco-2 cell-based quantitative antioxidant activity assay for antioxidants. Food Chem. 2015, 175, 601–608. [Google Scholar] [CrossRef]
- Kellett, M.E.; Greenspan, P.; Pegg, R.B. Modification of the cellular antioxidant activity (CAA) assay to study phenolic antioxidants in a Caco-2 cell line. Food Chem. 2018, 244, 359–363. [Google Scholar] [CrossRef] [PubMed]
- Ballatore, M.B.; Bettiol, M.D.R.; Vanden Braber, N.L.; Aminahuel, C.A.; Rossi, Y.E.; Petroselli, G.; Erra-Balsells, R.; Cavaglieri, L.R.; Montenegro, M.A. Antioxidant and cytoprotective effect of peptides produced by hydrolysis of whey protein concentrate with trypsin. Food Chem. 2020, 319, 126472. [Google Scholar] [CrossRef]
- Nam, M.H.; Son, W.R.; Yang, S.Y.; Lee, Y.S.; Lee, K.W. Chebulic acid inhibits advanced glycation end products-mediated vascular dysfunction by suppressing ROS via the ERK/Nrf2 pathway. J. Funct. Foods 2017, 36, 150–161. [Google Scholar] [CrossRef]
- Clementi, M.E.; Lazzarino, G.; Sampaolese, B.; Brancato, A.; Tringali, G. DHA protects PC12 cells against oxidative stress and apoptotic signals through the activation of the NFE2L2/HO-1 axis. Int. J. Mol. Med. 2019, 43, 2523–2531. [Google Scholar] [CrossRef]
- Zhao, D.; Jiang, Y.; Sun, J.; Li, H.; Huang, M.; Sun, X.; Zhao, M. Elucidation of The Anti-Inflammatory Effect of Vanillin In Lps-Activated THP-1 Cells. Nutrition 2019, 84, 1920–1928. [Google Scholar] [CrossRef]
- Saw, C.L.; Wu, Q.; Kong, A.N.T. Anti-cancer and potential chemopreventive actions of ginseng by activating Nrf2 (NFE2L2) anti-oxidative stress/anti-inflammatory pathways. Chin. Med. 2010, 5, 37. [Google Scholar] [CrossRef] [PubMed]
- Dias, K.A.; da Conceição, A.R.; Pereira, S.M.S.; Oliveira, L.A.; da Silva Rodrigues, J.V.; Dias, R.S.; de Paula, S.O.; Natali, A.J.; da Matta, S.L.P.; Gonçalves, R.V.; et al. Curcumin-Added Whey Protein Positively Modulates Skeletal Muscle Inflammation and Oxidative Damage after Exhaustive Exercise. Nutrients 2022, 14, 4905. [Google Scholar] [CrossRef]
- Jung, K.A.; Kwak, M.K. The Nrf2 system as a potential target for the development of indirect antioxidants. Molecules 2010, 15, 7266–7291. [Google Scholar] [CrossRef] [PubMed]
- Treml, J.; Večeřová, P.; Herczogová, P.; Šmejkal, K. Direct and indirect antioxidant effects of selected plant phenolics in cell-based assays. Molecules 2021, 26, 2534. [Google Scholar] [CrossRef]
- Morgan, M.J.; Liu, Z.-G. Crosstalk of reactive oxygen species and NF-κB signaling NF-κB. Nat. Publ. Gr. 2011, 21, 103–115. [Google Scholar] [CrossRef]
- Brodkorb, A.; Egger, L.; Alminger, M.; Alvito, P.; Assunção, R.; Ballance, S.; Bohn, T.; Bourlieu-Lacanal, C.; Boutrou, R.; Carrière, F.; et al. INFOGEST static in vitro simulation of gastrointestinal food digestion. Nat. Protoc. 2019, 14, 991–1014. [Google Scholar] [CrossRef]
- Minekus, M.; Alminger, M.; Alvito, P.; Ballance, S.; Bohn, T.; Bourlieu, C.; Carrière, F.; Boutrou, R.; Corredig, M.; Dupont, D.; et al. A standardised static in vitro digestion method suitable for food-an international consensus. Food Funct. 2014, 5, 1113–1124. [Google Scholar] [CrossRef]
- Ou, B.; Hampsch-Woodill, M.; Prior, R.L. Development and validation of an improved oxygen radical absorbance capacity assay using fluorescein as the fluorescent probe. J. Agric. Food Chem. 2001, 49, 4619–4626. [Google Scholar] [CrossRef]
- Zulueta, A.; Maurizi, A.; Frígola, A.; Esteve, M.J.; Coli, R.; Burini, G. Antioxidant capacity of cow milk, whey and deproteinized milk. Int. Dairy J. 2009, 19, 380–385. [Google Scholar] [CrossRef]
- Zulueta, A.; Esteve, M.J.; Frígola, A. ORAC and TEAC assays comparison to measure the antioxidant capacity of food products. Food Chem. 2009, 114, 310–316. [Google Scholar] [CrossRef]
- Ozgen, M.; Reese, R.N.; Tulio, A.Z.; Scheerens, J.C.; Miller, A.R. Modified 2,2-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS) method to measure antioxidant capacity of selected small fruits and comparison to ferric reducing antioxidant power (FRAP) and 2,2′-diphenyl-1- picrylhydrazyl (DPPH) methods. J. Agric. Food Chem. 2006, 54, 1151–1157. [Google Scholar] [CrossRef] [PubMed]
- Feng, Y.; Yuan, D.; Cao, C.; Kong, B.; Sun, F.; Xia, X.; Liu, Q. Changes of in vitro digestion rate and antioxidant activity of digestion products of ethanol-modified whey protein isolates. Food Hydrocoll. 2022, 131, 107756. [Google Scholar] [CrossRef]
- Benzie, I.F.F.; Strain, J.J. The Ferric Reducing Ability of Plasma (FRAP) as a Measure of “Antioxidant Power”: The FRAP Assay. Anal. Biochem. 1996, 239, 70–76. [Google Scholar] [CrossRef]
- González-Centeno, M.R.; Jourdes, M.; Femenia, A.; Simal, S.; Rosselló, C.; Teissedre, P.L. Proanthocyanidin composition and antioxidant potential of the stem winemaking byproducts from 10 different grape varieties (Vitis vinifera L.). J. Agric. Food Chem. 2012, 60, 11850–11858. [Google Scholar]
- Corrochano, A.R.; Sariçay, Y.; Arranz, E.; Kelly, P.M.; Buckin, V.; Giblin, L. Comparison of antioxidant activities of bovine whey proteins before and after simulated gastrointestinal digestion. J. Dairy Sci. 2019, 102, 54–67. [Google Scholar] [CrossRef]
- Oyaizu, M. Studies on Products of Browning Reaction Antioxidative Activities of Products of Browning Reaction Prepared from Glucosamine. Jpn. J. Nutr. Diet. 1986, 44, 307–315. [Google Scholar] [CrossRef]
- Liang, T.; Yue, W.; Li, Q. Comparison of the phenolic content and antioxidant activities of apocynum venetum l. (Luo-Bu-Ma) and two of its alternative species. Int. J. Mol. Sci. 2010, 11, 4452–4464. [Google Scholar] [CrossRef]
- Sánchez-Velázquez, O.A.; Mulero, M.; Cuevas-Rodríguez, E.O.; Mondor, M.; Arcand, Y.; Hernández-Álvarez, A.J. In vitro gastrointestinal digestion impact on stability, bioaccessibility and antioxidant activity of polyphenols from wild and commercial blackberries (Rubus spp.). Food Funct. 2021, 12, 7358–7378. [Google Scholar] [CrossRef] [PubMed]
- Armstrong, D. Advanced Protocols in Oxidative Stress III; Elsevier: Amsterdam, The Netherlands, 2014; pp. 1–477. [Google Scholar] [CrossRef]
- Lind, K.F.; Hansen, E.; Østerud, B.; Eilertsen, K.E.; Bayer, A.; Engqvist, M.; Leszczak, K.; Jørgensen, T.; Andersen, J.H. Antioxidant and Anti-Inflammatory Activities of Barettin. Mar. Drugs 2013, 11, 2655–2666. [Google Scholar] [CrossRef] [PubMed]
- Piccolomini, A.F.; Iskandar, M.M.; Lands, L.C.; Kubow, S. High hydrostatic pressure pre-treatment of whey proteins enhances whey protein hydrolysate inhibition of oxidative stress and IL-8 secretion in intestinal epithelial cells. Food Nutr. Res. 2012, 56, 17549. [Google Scholar] [CrossRef]
- Feng, L.; Peng, F.; Wang, X.; Li, M.; Lei, H.; Xu, H. Identification and characterization of antioxidative peptides derived from simulated in vitro gastrointestinal digestion of walnut meal proteins. Food Res. Int. 2019, 116, 518–526. [Google Scholar] [CrossRef] [PubMed]
- Chanput, W.; Mes, J.; Vreeburg, R.A.M.M.; Savelkoul, F.J.; Wichers, H.J.; Savelkoul, H.F.J.; Wichers, H.J. Transcription profiles of LPS-stimulated THP-1 monocytes and macrophages: A tool to study inflammation modulating effects of food-derived compounds. Food Funct. 2010, 1, 254–261. [Google Scholar] [CrossRef] [PubMed]
- Chanput, W.; Mes, J.J.; Wichers, H.J. International Immunopharmacology THP-1 cell line: An in vitro cell model for immune modulation approach. Int. Immunopharmacol. 2014, 23, 37–45. [Google Scholar] [CrossRef]
- Baxter, E.W.; Graham, A.E.; Re, N.A.; Carr, I.M.; Robinson, J.I.; Mackie, S.L.; Morgan, A.W. Standardized protocols for differentiation of THP-1 cells to macrophages with distinct M(IFNγ+LPS), M(IL-4) and M(IL-10) phenotypes. J. Immunol. Methods 2019, 478, 112721. [Google Scholar] [CrossRef]
- Daigneault, M.; Preston, J.A.; Marriott, H.M.; Whyte, M.K.B.; Dockrell, D.H. The identification of markers of macrophage differentiation in PMA-stimulated THP-1 cells and monocyte-derived macrophages. PLoS ONE 2010, 5, e8668. [Google Scholar] [CrossRef]
- Templeton, G.F.; Templeton, G.F. A two-step approach for transforming continuous variables to normal: Implications and recommendations for IS research. Commun. Assoc. Inf. Syst. 2011, 28, 41–58. [Google Scholar] [CrossRef]
- Cho, S.J. Changes in the antioxidant properties of rice bran protein isolate upon simulated gastrointestinal digestion. LWT 2020, 126, 109206. [Google Scholar] [CrossRef]
- Huang, D.; Prior, R.L. The Chemistry behind Antioxidant Capacity Assays. Agric. Food Chem. 2005, 53, 841–1856. [Google Scholar] [CrossRef]
- Di Meo, F.; Lemaur, V.; Cornil, J.; Lazzaroni, R.; Duroux, J.L.; Olivier, Y.; Trouillas, P. Free radical scavenging by natural polyphenols: Atom versus electron transfer. J. Phys. Chem. A 2013, 117, 2082–2092. [Google Scholar] [CrossRef]
- Zou, T.B.; He, T.P.; Li, H.B.; Tang, H.W.; Xia, E.Q. The structure-activity relationship of the antioxidant peptides from natural proteins. Molecules 2016, 21, 72. [Google Scholar] [CrossRef]
- Giromini, C.; Lovegrove, J.A.; Givens, D.I.; Rebucci, R.; Pinotti, L.; Maffioli, E.; Tedeschi, G.; Sundaram, T.S.; Baldi, A. In vitro-digested milk proteins: Evaluation of angiotensin-1-converting enzyme inhibitory and antioxidant activities, peptidomic profile, and mucin gene expression in HT29-MTX cells. J. Dairy Sci. 2019, 102, 10760–10771. [Google Scholar] [CrossRef] [PubMed]
- García-Casas, V.E.; Seiquer, I.; Pardo, Z.; Haro, A.; Recio, I.; Olías, R. Antioxidant Potential of the Sweet Whey-Based Beverage Colada after the Digestive Process and Relationships with the Lipid and Protein Fractions. Antioxidants 2022, 11, 1827. [Google Scholar] [CrossRef]
- Clausen, M.R.; Skibsted, L.H.; Stagsted, J. Characterization of major radical scavenger species in bovine milk through size exclusion chromatography and functional assays. J. Agric. Food Chem. 2009, 57, 2912–2919. [Google Scholar] [CrossRef] [PubMed]
- Shaukat, A.; Nadeem, M.; Qureshi, T.M.; Kanwal, R.; Sultan, M.; Kashongwe, O.B.; Shamshiri, R.R.; Murtaza, M.A. Effect of in vitro digestion on the antioxidant and angiotensin-converting enzyme inhibitory potential of Buffalo milk processed cheddar cheese. Foods 2021, 10, 1661. [Google Scholar] [CrossRef]
- Stobiecka, M.; Król, J.; Brodziak, A. Antioxidant Activity of Milk and Dairy Products. Animals 2022, 12, 245. [Google Scholar] [CrossRef]
- Vogelsang-O’dwyer, M.; Sahin, A.W.; Bot, F.; O’mahony, J.A.; Bez, J.; Arendt, E.K.; Zannini, E. Enzymatic hydrolysis of lentil protein concentrate for modification of physicochemical and techno-functional properties. Eur. Food Res. Technol. 2023, 249, 573–586. [Google Scholar] [CrossRef]
- Salami, M.; Moosavi-Movahedi, A.A.; Ehsani, M.R.; Yousefi, R.; Haertlé, T.; Chobert, J.M.; Razavi, S.H.; Henrich, R.; Balalaie, S.; Ebadi, S.A.; et al. Improvement of the antimicrobial and antioxidant activities of camel and bovine whey proteins by limited proteolysis. J. Agric. Food Chem. 2010, 58, 3297–3302. [Google Scholar] [CrossRef] [PubMed]
- Peña-Ramos, E.A.; Xiong, Y.L.; Arteaga, G.E. Fractionation and characterisation for antioxidant activity of hydrolysed whey protein. J. Sci. Food Agric. 2004, 84, 1908–1918. [Google Scholar] [CrossRef]
- Tavano, O.L. Protein hydrolysis using proteases: An important tool for food biotechnology. J. Mol. Catal. B Enzym. 2013, 90, 1–11. [Google Scholar] [CrossRef]
- Athira, S.; Mann, B.; Saini, P.; Sharma, R.; Kumar, R.; Singh, A.K. Production and characterisation of whey protein hydrolysate having antioxidant activity from cheese whey. J. Sci. Food Agric. 2015, 95, 2908–2915. [Google Scholar] [CrossRef] [PubMed]
- Peng, X.; Kong, B.; Xia, X.; Liu, Q. Reducing and radical-scavenging activities of whey protein hydrolysates prepared with Alcalase. Int. Dairy J. 2010, 20, 360–365. [Google Scholar] [CrossRef]
- O’Keeffe, M.B.; FitzGerald, R.J. Antioxidant effects of enzymatic hydrolysates of whey protein concentrate on cultured human endothelial cells. Int. Dairy J. 2014, 36, 128–135. [Google Scholar] [CrossRef]
- Le Maux, S.; Bouhallab, S.; Giblin, L.; Brodkorb, A.; Croguennec, T. Complexes between linoleate and native or aggregated β-lactoglobulin: Interaction parameters and in vitro cytotoxic effect. Food Chem. 2013, 141, 2305–2313. [Google Scholar] [CrossRef]
- Kleekayai, T.; Le Gouic, A.V.; Deracinois, B.; Cudennec, B.; FitzGerald, R.J. In vitro characterisation of the antioxidative properties of whey protein hydrolysates generated under pH- And non pH-controlled conditions. Foods 2020, 9, 582. [Google Scholar] [CrossRef] [PubMed]
- García Fillería, S.; Tironi, V. Intracellular antioxidant activity and intestinal absorption of amaranth peptides released using simulated gastrointestinal digestion with Caco-2 TC7 cells. Food Biosci. 2021, 41, 101086. [Google Scholar] [CrossRef]
- García-Nebot, M.J.; Recio, I.; Hernández-Ledesma, B. Antioxidant activity and protective effects of peptide lunasin against oxidative stress in intestinal Caco-2 cells. Food Chem. Toxicol. 2014, 65, 155–161. [Google Scholar] [CrossRef]
- Chen, M.; Li, B. The effect of molecular weights on the survivability of casein-derived antioxidant peptides after the simulated gastrointestinal digestion. Innov. Food Sci. Emerg. Technol. 2012, 16, 341–348. [Google Scholar] [CrossRef]
- Kong, B.; Peng, X.; Xiong, Y.L.; Zhao, X. Protection of lung fibroblast MRC-5 cells against hydrogen peroxide-induced oxidative damage by 0.1–2.8 kDa antioxidative peptides isolated from whey protein hydrolysate. Food Chem. 2012, 135, 540–547. [Google Scholar] [CrossRef]
- Gong, E.S.; Gao, N.; Li, T.; Chen, H.; Wang, Y.; Si, X.; Tian, J.; Shu, C.; Luo, S.; Zhang, J.; et al. Effect of in Vitro Digestion on Phytochemical Profiles and Cellular Antioxidant Activity of Whole Grains. J. Agric. Food Chem. 2019, 67, 7016–7024. [Google Scholar] [CrossRef]
- Torres-Fuentes, C.; Contreras, M.D.M.; Recio, I.; Alaiz, M.; Vioque, J. Identification and characterization of antioxidant peptides from chickpea protein hydrolysates. Food Chem. 2015, 180, 194–202. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Tong, X.; Qi, B.; Wang, Z.; Li, Y.; Sui, X.; Jiang, L. Changes in antioxidant activity of Alcalase-hydrolyzed soybean hydrolysate under simulated gastrointestinal digestion and transepithelial transport. J. Funct. Foods 2018, 42, 298–305. [Google Scholar] [CrossRef]
- Shi, Y.; Kovacs-Nolan, J.; Jiang, B.; Tsao, R.; Mine, Y. Antioxidant activity of enzymatic hydrolysates from eggshell membrane proteins and its protective capacity in human intestinal epithelial Caco-2 cells. J. Funct. Foods 2014, 10, 35–45. [Google Scholar] [CrossRef]
- Corrochano, A.R.; Arranz, E.; De Noni, I.; Stuknytė, M.; Ferraretto, A.; Kelly, P.M.; Buckin, V.; Giblin, L. Intestinal health benefits of bovine whey proteins after simulated gastrointestinal digestion. J. Funct. Foods 2018, 49, 526–535. [Google Scholar] [CrossRef]
- Ma, Y.; Xu, J.; Guo, R.; Teng, G.; Chen, Y.; Xu, X. In vitro gastrointestinal model for the elderly: Effect of high hydrostatic pressure on protein structures and antioxidant activities of whey protein isolate. Food Biosci. 2023, 52, 102452. [Google Scholar] [CrossRef]
- Ibrahim, H.R.; Isono, H.; Miyata, T. Potential antioxidant bioactive peptides from camel milk proteins. Anim. Nutr. 2018, 4, 273–280. [Google Scholar] [CrossRef] [PubMed]
- Xu, R.; Liu, N.; Xu, X.; Kong, B. Antioxidative effects of whey protein on peroxide-induced cytotoxicity. J. Dairy Sci. 2011, 94, 3739–3746. [Google Scholar] [CrossRef]
- Kerasioti, E.; Stagos, D.; Tzimi, A.; Kouretas, D. Increase in antioxidant activity by sheep/goat whey protein through nuclear factor-like 2 (Nrf2) is cell type dependent. Food Chem. Toxicol. 2016, 97, 47–56. [Google Scholar] [CrossRef] [PubMed]
- Pyo, M.C.; Yang, S.Y.; Chun, S.H.; Oh, N.S.; Lee, K.W. Protective Effects of Maillard Reaction Products of Whey Protein Concentrate against Oxidative Stress through an Nrf2-Dependent Pathway in HepG2 Cells. Biol. Pharm. Bull. 2016, 39, 1437–1447. [Google Scholar] [CrossRef]
- Rojo, A.I.; Salinas, M.; Martín, D.; Perona, R.; Cuadrado, A. Regulation of Cu/Zn-Superoxide Dismutase Expression via the Phosphatidylinositol 3 Kinase/Akt Pathway and Nuclear Factor-κB. J. Neurosci. 2004, 24, 7324–7334. [Google Scholar] [CrossRef] [PubMed]
- Schreiber, J.; Jenner, R.G.; Murray, H.L.; Gerber, G.K.; Gifford, D.K.; Young, R.A. Coordinated binding of NF-kappaB family members in the response of human cells to lipopolysaccharide. Proc. Natl. Acad. Sci. USA 2006, 103, 5899–5904. [Google Scholar] [CrossRef]
- Zhou, L.Z.H.; Johnson, A.P.; Rando, T.A. NF kappa B and AP-1 mediate transcriptional responses to oxidative stress in skeletal muscle cells. Free Radic. Biol. Med. 2001, 31, 1405–1416. [Google Scholar] [CrossRef] [PubMed]
- Ishikawa, F.; Matsubara, T.; Koyama, T.; Iwamoto, H.; Miyaji, K. Whey protein hydrolysate mitigates both inflammation and endotoxin tolerance in THP-1 human monocytic leukemia cells. Immunity Inflamm. Dis. 2022, 10, e737. [Google Scholar] [CrossRef] [PubMed]
- Ebaid, H.; Salem, A.; Sayed, A.; Metwalli, A. Whey protein enhances normal inflammatory responses during cutaneous wound healing in diabetic rats. Lipids Health Dis. 2011, 10, 235. [Google Scholar] [CrossRef] [PubMed]
- Athira, S.; Mann, B.; Sharma, R.; Kumar, R. Ameliorative potential of whey protein hydrolysate against paracetamol-induced oxidative stress. J. Dairy Sci. 2013, 96, 1431–1437. [Google Scholar] [CrossRef]
- Sousa, R.; Recio, I.; Heimo, D.; Dubois, S.; Moughan, P.J.; Hodgkinson, S.M.; Portmann, R.; Egger, L. In vitro digestibility of dietary proteins and in vitro DIAAS analytical workflow based on the INFOGEST static protocol and its validation with in vivo data. Food Chem. 2023, 404, 134720. [Google Scholar] [CrossRef] [PubMed]
- Manninen, A.H. Protein hydrolysates in sports nutrition. Nutr. Metab. 2009, 6, 38. [Google Scholar] [CrossRef]



| Gene (Accesion Number) | Primer Direction | Sequence (5′-3′) | Amplicon Size | Reaction Efficiency |
|---|---|---|---|---|
| SOD1 (NM_000454) | Forward | CGAGCAGAAGGAAAGTAATGG | 194 | 95 |
| Reverse | CCAAGTCTCCAACATGCC | |||
| CAT (NM_001752) | Forward | TGCCTATCCTGACACTCACC | 137 | 92 |
| Reverse | GAGCACCACCCTGATTGTC | |||
| NFE2L2 (NM_001145412) | Forward | GATCTGCCAACTACTCCCA | 121 | 90 |
| Reverse | GCCGAAGAAACCTCATTGTC | |||
| NFKB1 (NM_001165412) | Forward | GCACAAGGAGACATGAAACAG | 189 | 97 |
| Reverse | CCCAGAGACCTCATAGTTGTC | |||
| RELA (NM_001145138) | Forward | GGACTACGACCTGAATGCTG | 228 | 105 |
| Reverse | ACCTCAATGTCCTCTTTCTGC | |||
| RPS18 (NM_022551) | Forward | CTGAGGATGAGGTGGAACG | 240 | 98 |
| Reverse | CAGTGGTCTTGGTGTGCT | |||
| HPRT1 (NM_000194) | Forward | CTTTGCTTTCCTTGGTCAGG | 111 | 99 |
| Reverse | CAAATCCAACAAAGTCTGGCT | |||
| RPL37A (NM_000998) | Forward | AGTACACTTGCTCTTTCTGTGG | 119 | 106 |
| Reverse | GGAAGTGGTATTGTACGTCCAG | |||
| B2M (NM_004048) | Forward | GCTATCCAGCGTACTCCA | 285 | 103 |
| Reverse | CTTAACTATCTTGGGCTGTGAC |
| Method (Units) | SW | SW-Ds | SW-D-P3 |
|---|---|---|---|
| ABTS (μmol TEs/g protein) | 20.3 ± 0.8 a | 46.2 ± 0.8 c | 38.7 ± 0.6 b |
| ORAC-FL (μmol TEs/g protein) | 20.5 ± 1.0 a | 167.2 ± 4.8 c | 122.3 ± 3.9 b |
| FRAP (μmol TEs/g protein) | 10.9 ± 0.5 a | 31.4 ± 1.3 c | 21.3 ± 0.6 b |
| P-FRAP (μmol BHT eqv/g protein) | 7.5 ± 0.3 a | 26.9 ± 0.8 c | 18.7 ± 0.6 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dalaka, E.; Politis, I.; Theodorou, G. Antioxidant Activity of Sweet Whey Derived from Bovine, Ovine and Caprine Milk Obtained from Various Small-Scale Cheese Plants in Greece before and after In Vitro Simulated Gastrointestinal Digestion. Antioxidants 2023, 12, 1676. https://doi.org/10.3390/antiox12091676
Dalaka E, Politis I, Theodorou G. Antioxidant Activity of Sweet Whey Derived from Bovine, Ovine and Caprine Milk Obtained from Various Small-Scale Cheese Plants in Greece before and after In Vitro Simulated Gastrointestinal Digestion. Antioxidants. 2023; 12(9):1676. https://doi.org/10.3390/antiox12091676
Chicago/Turabian StyleDalaka, Eleni, Ioannis Politis, and Georgios Theodorou. 2023. "Antioxidant Activity of Sweet Whey Derived from Bovine, Ovine and Caprine Milk Obtained from Various Small-Scale Cheese Plants in Greece before and after In Vitro Simulated Gastrointestinal Digestion" Antioxidants 12, no. 9: 1676. https://doi.org/10.3390/antiox12091676
APA StyleDalaka, E., Politis, I., & Theodorou, G. (2023). Antioxidant Activity of Sweet Whey Derived from Bovine, Ovine and Caprine Milk Obtained from Various Small-Scale Cheese Plants in Greece before and after In Vitro Simulated Gastrointestinal Digestion. Antioxidants, 12(9), 1676. https://doi.org/10.3390/antiox12091676

