Next Article in Journal
The Impact of Punica granatum Linn and Its Derivatives on Oxidative Stress, Inflammation, and Endothelial Function in Diabetes Mellitus: Evidence from Preclinical and Clinical Studies
Next Article in Special Issue
Microbiome–Metabolomic Analysis Reveals Beneficial Effects of Dietary Kelp Resistant Starch on Intestinal Functions of Hybrid Snakeheads (Channa maculata ♀ × Channa argus ♂)
Previous Article in Journal
Aging, NRF2, and TAU: A Perfect Match for Neurodegeneration?
Previous Article in Special Issue
The Benefits of Nanosized Magnesium Oxide in Fish Megalobrama amblycephala: Evidence in Growth Performance, Redox Defense, Glucose Metabolism, and Magnesium Homeostasis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antioxidants
Volume 12
Issue 8
10.3390/antiox12081565
antioxidants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Dietary Supplementation of Chlorella vulgaris Effectively Enhanced the Intestinal Antioxidant Capacity and Immune Status of Micropterus salmoides

by
Heng Yu
1,
Xianping Ge
1,2,
Dongyu Huang
2,
Chunyu Xue
1,
Mingchun Ren
1,2,* and
Hualiang Liang
1,2,*
1
Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China
2
Key Laboratory of Integrated Rice-Fish Farming Ecology, Ministry of Agriculture and Rural Affairs, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, China
*
Authors to whom correspondence should be addressed.
Antioxidants 2023, 12(8), 1565; https://doi.org/10.3390/antiox12081565
Submission received: 29 June 2023 / Revised: 29 July 2023 / Accepted: 3 August 2023 / Published: 4 August 2023
(This article belongs to the Special Issue Antioxidants Benefits in Aquaculture 2.0)
Browse Figures
Versions Notes

Abstract

:
An M. salmoides fish meal diet was supplemented with 0 (CHL0, Control), 38 (CHL38), 76 (CHL76), 114 (CHL114), and 152 (CHL152) mg/kg C. vulgaris for 60 days, and their serum and intestinal samples were analyzed. The results showed that the albumin (ALB) and total protein (TP) contents were observably enhanced in the CHL76 group compared with the Control group. The intestinal glutathione (GSH) and glutathione peroxidase (GSH-Px) contents were enhanced significantly in the CHL76 group, while the total antioxidant capacity (T-AOC) was enhanced in the CHL38 group, compared with the Control group. However, supplementation of >76 g/kg C. vulgaris significantly inhibited the superoxide dismutase (SOD) activity in the intestines of M. salmoides. Moreover, the malondialdehyde (MDA) content was observably dropped in the CHL-supplemented groups compared with the Control group. Transcriptome analysis of the CHL76 and Control groups displayed a total of 1384 differentially expressed genes (DEGs). KEGG analysis revealed that these DEGs were enriched in apoptosis, cytokine–cytokine receptor interaction, tight junction (TJ), and phagosome signaling pathways, which were associated with improved intestinal immunity in the CHL76 group. Additionally, the DEGs enriched in the above pathways were also correlated with the antioxidant parameters, such as catalase (CAT), GSH, GSH-Px, SOD, T-AOC, and MDA. Therefore, our study found that dietary supplementation of C. vulgaris effectively enhanced the intestinal antioxidant capacity of M. salmoides by increasing antioxidant enzyme activity and decreasing MDA content. Additionally, dietary supplementation of C. vulgaris improved the intestinal immune status of M. salmoides by reducing proapoptotic and proinflammatory factors, increasing intestinal TJs- and phagosome-related genes expressions, and increasing the serum ALB and TP contents. Lastly, quadratic regression analysis of the serum biochemical indices (ALB and TP) and intestinal antioxidant parameters (GSH-Px and GSH) revealed that the optimal supplemental level of C. vulgaris in the M. salmoides diet was 58.25–77.7 g/kg.

1. Introduction

Aquaculture contributes to global food security by providing high-quality protein [1], and according to the Food and Agriculture Organization (FAO) [2], fish accounted for approximately 17% of global animal protein consumption in 2017. In 2020, freshwater fish was the most prominent biota in aquaculture, with fin fish farming reaching 8.3 million tons in seawater and 49.1 million tons in inland aquaculture [3], thus indicating the importance of freshwater fish farming in global food production. Micropterus salmoides (M. salmoides) is a widely farmed freshwater fish that first originated in North America and was then introduced in various countries, including China, Japan, and New Zealand. M. salmoides is preferred by both fish farmers and consumers owing to its several favorable characteristics, such as rapid growth, adaptability, lack of thorns, flavorful meat, etc. [4]. M. salmoides is a carnivorous fish [5], and the demand for fish meal (FM) is 40–50% [6]. According to the FAO [7], compared to 2018, the yearly output of FM in 2030 would rise by 1% while its price would increase by 30%. This would not only increase the cost of feeding but also lead to restrictions on the farming industry in the future. Therefore, finding novel protein sources that can fully or partially replace FM can promote sustainable development of the aquaculture industry and contribute to the global production of high-quality aquatic animal protein.
The alternative protein sources for FM can be classified as animal, plant, or single-cell protein (SCP) sources. Among the SCPs, microalgae, bacteria, and yeast have attracted the attention of researchers due to their several advantages. For instance, compared to terrestrial plants, microalgae grow more rapidly and produce more biomass owing to their higher efficiency in harnessing sunlight and CO2 [8]. Chlorella vulgaris (C. vulgaris, CHL), a freshwater microalga, is known for its easy cultivation and high yield [9]. Moreover, it is nutrient-rich and does not compete with humans for land or food [10]. Additionally, C. vulgaris contains Chlorella growth factor (CGF), which is rich in nutrients, such as amino acids, peptides, and polysaccharides [11]. In Pacific white shrimp (Litopenaeus vannamei), C. vulgaris could replace 100% of the FM without causing any adverse effects due to the presence of antioxidants, minerals, vitamins, and other nutrients [12]. C. vulgaris has been used to partially substitute FM for Nile tilapia (Oreochromis niloticus) [13], Gilted seabream (Sparus aurata) [14], and narrow clawed crayfish (Pontastacus leptodactylus Eschscholtz) [15]. In our previous study, we found that C. vulgaris could effectively replace 15.56% of the FM in the M. salmoides diet [16].
When the dysfunction of the intestinal epithelial barrier may impair intestinal function, the intestinal tract would select some pathogenic bacteria or harmful organisms to enter the intestinal tract, thus endangering intestinal health [17]. Existing studies focus on the effect of dietary supplementation of C. vulgaris on the growth, intestinal health, and intestinal microbiota of M. salmoides [18,19,20]. However, few studies have been conducted on how C. vulgaris regulates the immune and antioxidant mechanisms of the intestine, and transcriptome sequencing provides a good technique for explaining its mechanism. Therefore, in the current research, we determined the effects of the partial substitution of FM by C. vulgaris on the antioxidant and immune functions of M. salmoides and explored its potential mechanism using transcriptome analysis.

2. Materials and Methods

2.1. Experimental Design

All the subjects of the current study, M. salmoides, were provided by Yongda Aquaculture Professional Cooperative (Ezhou, China). The experiments were carried out in floating cages in an earthen pond at Wuhan Cp Aquatic Co., Ltd. (Huanggang, China). Prior to experimentation, M. salmoides were kept in net cages (1 × 1 × 1 m) for 14 d to acclimatize them to the culture conditions. In the formal experiment, a total of five experimental groups were designed, with three replicates in each group and 20 fish (15 ± 0.2 g) in each replicate. Fish were hand-fed to apparent satiation twice a day for 60 days. The M. salmoides were fed daily at 6:30 am and 6:30 pm, following the principle of full feeding. Water temperature ranged from 28 °C to 31 °C, dissolved oxygen was maintained above 6.0 mg/L, pH fluctuated between 7.5 and 8.2, ammonia nitrogen and nitrite ranged between 0–0.2 mg/L and 0.1–0.3 mg/L, respectively, during the feeding trial.

2.2. Experimental Diets Preparation

C. vulgaris, containing 60.83% protein and 10.40% lipid, was obtained from Wuxi Tongwei Feedstuffs Co., Ltd. (Wuxi, China). The five isonitrogenous and isoenergetic diets were formulated to contain 0 (CHL0), 38 (CHL38), 76 (CHL76), 114 (CHL114), and 152 (CHL152) mg/kg C. vulgaris. The experimental feed composition is provided in our previously published article [16]. The main protein raw material used in current research were all obtained by crushing them with a grinder and then sieving them pass a 60-mesh sieve and mixed sequentially with water and fish oil. Thereafter, the protein samples were processed with an F-26 (II)-type granulator to make the feed, which was then air-dried, placed in a self-sealing bag, and stored at −20 °C.

2.3. Fish Sample Collection

The fish were fasted 24 h prior to sampling. After anesthesia with MS-222 (100 mg/L), nine fish were randomly selected from each group (three per replicate) for serum biochemical index analysis. The collected blood was centrifuged to obtain serum (3500× g, 10 min, 4 °C), which was then stored at −80 °C for analysis of serum biochemical indices. Additionally, six fish were randomly selected from each group (two per replicate) to analyze the intestinal antioxidant indices. Lastly, three fish each were selected from the Control and CHL76 groups (1 per replicate) for transcriptome analysis. All the tissue samples were placed into frozen storage tubes and immediately placed in a liquid nitrogen tank. The frozen samples were transferred to a −80 °C freezer until further analysis.

2.4. Analysis of the Serum Biochemical Indices and Intestinal Antioxidant Parameters

The assay kits or testing equipment for the detection of the serum biochemical indices and the intestinal antioxidant parameters are shown in Table 1.

2.5. The Process of High-Throughput Sequencing

According to its instructions, TRIzol was used to extract intestinal RNA. The purity and concentration of RNA were detected using a NanoDrop 2000 spectrophotometer (Thermo Scientific) (New York, NY, USA) and the integrity of the RNA was accurately detected via Agient2100/LabChip GX (Perkin Elmer LabChip GX) (New York, NY, USA) to ensure the quality of the RNA. The RNA samples were used for library construction and quantified using a Qubit 3.0 fluorescence quantizer (Thermo Fisher Scientific) (New York, NY, USA) (>1 ng/μL). Thereafter, the Qsep400 high-throughput analysis system was used to assess the inserted fragments of the library. The effective concentration of the library needs quantitative real-time PCR (qPCR) assay to quantify accurately and to control the quality of the library so that it can be further used. Lastly, the Illumina NovaSeq6000 sequencing platform was used in the PE150 mode for library sequencing.

2.6. Quality Inspection of Sequencing Data

Before data analysis, remove the Reads containing joints and low-quality Reads. These Reads must be of high quality for the accuracy of further analysis. The positioning information on the reference genome was obtained by quickly and accurately comparing Clean Reads with the reference genome using the HISAT (2.0) software [21], and the aligned sequences were assembled using StringTie to reconstruct the transcriptome for subsequent analysis [22]. Based on the count value of genes in each sample, DESeq2 [23] was used to screen DEGs at fold change ≥2 and a false discovery rate < 0.05.

2.7. Quantitative Real-Time PCR Detection

RNA was extracted (on ice) from the M. salmoides intestinal samples using an RNA extraction reagent (Vazyme, Nanjing, China). The RNA concentration and quality were measured using a NanoDrop 2000 spectrophotometer, and RNA samples with A260/A280 of 1.8–2.0 were used for qPCR assay. The qPCR assay was conducted on the CFX96 Touch (Bio-Rad, Hercules, CA, USA) using reagents obtained from Vazyme. A standard curve was used to calculate the mRNA levels, and β-actin was proven to be usable in M. salmoides, which can act as a housekeeping gene. The gene sequences are shown in Table 2.

2.8. Statistical Analysis

Data were analyzed via one-way analysis of variance (ANOVA) using SPSS (20.0) and Tukey’s test for pairwise comparison (p < 0.05). Suppose the comparison between the two groups was the result of analysis by independent sample t-test. The data are presented as mean ± standard error.

3. Results

3.1. Effects of Dietary Supplementation of C. vulgaris on the Serum Biochemical Indices

As seen in Table 3, the ALB and TP levels were significantly increased in the CHL76 group compared to the Control group (p < 0.05). The differences in ALT and AST contents among M. salmoides fed different C. vulgaris levels were insignificant (p > 0.05).

3.2. Effects of Dietary Supplementation of C. vulgaris on the Intestinal Antioxidant Parameters

As seen in Figure 1, the intestinal GSH content of M. salmoides fed CHL76 and CHL114 diets was observably raised in comparison with the Control group (p < 0.05). The GSH-Px content showed an upward trend, with a significant increase in the CHL76 group (p < 0.05). The intestine SOD activity and T-AOC of M. salmoides were significantly increased in the CHL38 group in comparison with the Control group (p < 0.05). Nevertheless, MDA levels decreased in the CHL-supplemented groups (p < 0.05). Insignificant differences were found in intestinal CAT activity among M. salmoides fed different C. vulgaris levels (p > 0.05).

3.3. Optimal Supplementation Level of C. vulgaris in M. salmoides Diet

As seen in Figure 2, Quadratic regression analysis of ALB, TP, GSH-Px, and GSH revealed that the appropriate supplementation amount of C. vulgaris in the M. salmoides diet was 77.7, 58.25, 75.75, and 77.5 g/kg, respectively.

3.4. Library Sequencing Quality

As seen in Table 4, each sample produced ≥38,524,894 total Reads, and the average Clean Reads of the Control and the CHL-supplemented groups were >42,939,487 and >43,576,963, respectively. Their GC content was 47.26–49.08%, and the proportion of bases with mass value ≥30 was ≥93.62% in all the samples. Altogether, these results indicate that the library sequencing quality met the standards required for DEG analysis.

3.5. DEG Analysis

Correlation analysis between samples (Figure 3A) and the PCA diagram (Figure 3B) were used as measures of differences between samples within and between groups. The closer the r2 value is to 1, the better the repeatability between the samples, and vice versa (Figure 3A). In the current research, the PCA diagram displayed that the three samples in the same group were clustered, indicating lower within-group differences but higher between-group differences. It was observed that the intra-group samples used in the current research were more reproducible and had a good degree of discrimination between the groups. A total of 1384 DEGs were identified between the CHL76 and Control groups (Figure 3C), and among these, 429 DEGs were observably upregulated, while 955 DEGs were observably downregulated in the CHL76 group (Figure 3D). The KEGG pathway enrichment analysis of the DEGs showed that 1153 DEGs were enriched in 167 signaling pathways, among which most DEGs were enriched in immune- and antioxidant-related pathways. Additional information on the inflammation-related DEGs is shown in Table 5.

3.6. qPCR Assay

As described in Figure 4, the heat map between DEGs and samples in transcriptome results (Figure 4A,B). The high-throughput sequencing results indicated that the genes pro-cathepsin H, cathepsin K-like, cathepsin L1 (ctsl1), occludin b, claudin-4, eosinophil peroxidase (epo), and immunoglobulin tau heavy chain (igt) were significantly upregulated, while caspase-7, caspase-3-like, C-C motif chemokine 4-like (cxcr4), interleukin-8 (il-8), il-17 receptor A-like (il-17ra), chemokine (C-X-C motif) receptor 2 (cxcr2), and il-12 receptor subunit beta-2 (il-12rβ2) were observably downregulated in the CHL76 group compared with the Control group (Figure 4C–H). These were consistent with the results of RNA-seq and qPCR assays, thus indicating their credibility.

3.7. Correlation Analysis between DEGs, Serum Biochemical Indices, and Antioxidant Parameters

As shown in Figure 5, visualized heat maps of the correlation between DEGs (Figure 5A) and the correlation between DEGs and antioxidant parameters were analyzed (Figure 5B). This showed that the caspase-3-like and cytokine–cytokine receptor interaction-related DEGs (il-12rβ2, il-8, il-17ra, cxcr2, and cxcr4) were negatively associated with the tight junction protein-related DEGs (occludin b and claudin-4), apoptosis-related DEGs (cathepsin K-like and ctsl1), and phagosome-related DEGs (igt and epo). However, caspase-3-like was positively correlated with the cytokine–cytokine receptor interaction-related DEGs (il-12rβ2, il-8, il-17ra, cxcr2, and cxcr4). Moreover, there was no significant correlation between pro-cathepsin H and other DEGs, while caspase-7 was positively correlated with only il-12rβ2. Altogether, these results indicate that all the DEGs were associated with antioxidant parameters. The ALB, CAT, GSH-Px, T-AOC, and GSH were positively associated with the TJ-related DEGs (occludin b and claudin-4), apoptosis-related DEGs (cathepsin K-like, ctsl1, and pro-cathepsin H), and phagosome-related DEGs (igt and epo). However, CAT, GSH-Px, T-AOC, and GSH were negatively correlated, while MDA was positively correlated with cytokine–cytokine receptor interaction-related DEGs (il-12rβ2, il-8, il-17ra, cxcr2, and cxcr4) and apoptosis-related DEGs (caspase-7 and caspase-3-like).

4. Discussion

Animals have a complex antioxidant system, including antioxidant enzymes and non-enzymatic antioxidants [24], and C. vulgaris supplementation was found to effectively improve the antioxidant capacity of animals, such as rabbits [25]. In the current research, the T-AOC was observably enhanced in the CHL38 group compared with the Control group, while the MDA decreased significantly with CHL supplementation. The current results were similar to the previous study on Grey mullet (Mugil cephalus), which found that CHL supplementation could significantly increase the T-AOC level and significantly decrease the MDA level [26]. In general, the MDA level indicates the degree of lipid peroxidation in the body, thus indirectly indicating the degree of cell damage [27]. A study found that C. vulgaris has a better inhibitory effect on lipid peroxidation compared to glutathione, suggesting that it has antioxidant properties [28]. In this study, we found that the GSH content and GSH-Px activity increased significantly in the CHL76 group compared with the Control group, indicating that dietary supplementation of C. vulgaris can improve the intestinal antioxidant capacity of M. salmoides by increasing the levels of antioxidant indices and reducing the MDA level. The antioxidant properties of C. vulgaris may be due to the presence of several antioxidant bioactive factors [29]. For example, C. vulgaris contains abundant astaxanthin, a type of carotene, which is known as super vitamin E due to its natural antioxidant activity [30]. A previous study found that dietary supplementation of astaxanthin can improve the antioxidant and immune capacity of Rainbow trout (Oncorhynchus mykiss) [31]. Moreover, Ghwenm et al. reported that the ethanol extract of C. vulgaris contains antioxidant substances that can resist oxidative stress [32]. Serum biochemical parameters are commonly used as indicators of the health status of a fish [33]. In this study, we found no significant differences in the serum AST and ALT contents between the Control and CHL-supplemented groups, which indicates that dietary supplementation of C. vulgaris does not cause damage to M. salmoides. Additionally, the present results showed that the CHL76 group significantly increased TP and ALB activities. In general, increased TP and ALB levels may be an important parameter of the immune status of the fish [34]; therefore, our results indicate that CHL supplementation can improve the immune status of M. salmoides. Altogether, these results suggest that dietary supplementation of C. vulgaris improves the antioxidant capacity and immune status of M. salmoides. The quadratic regression analysis of the serum biochemical indices (ALB and TP) and intestinal antioxidant parameters (GSH-Px and GSH) revealed that 58.25–77.7 g/kg was the optimal supplemental level of C. vulgaris in M. salmoides diet.
In this study, we used transcriptome analysis to further examine the underlying molecular regulatory mechanisms associated with improved antioxidant capacity and immune status of M. salmoides. We found a total of 1384 DEGs between the CHL76 and Control groups, and KEGG enrichment analysis of these DEGs revealed that some immune-related DEGs were enriched in the apoptosis, cytokine–cytokine receptor interaction, TJ, and phagosome signaling pathways. Apoptosis is mediated by the activation of apoptotic factors by proteolytic enzymes called caspases, a family of cysteine-specific proteases that occupy an important position in the immune response against pathogens [35]. The caspase-3-like proteases play an important role under stress conditions [36], and an increase in caspase-3-like protease activity indicates the occurrence of cell apoptosis [37,38]. Caspase-7, a major molecule involved in cell apoptosis, can be induced by pathogenic infections and has been found in fish [39,40]. In the current study, we found that the expression of intestinal caspase-3-like and caspase-7 genes was significantly downregulated in the CHL-supplemented. A previous study found that dietary supplementation of methanotroph bacteria and Yellow mealworm (Tenebrio Molitor) could reduce intestinal pro-apoptotic factors and enhance intestinal immunity of M. salmoides [41,42]. This showed that dietary supplementation of C. vulgaris downregulated intestinal pro-apoptotic factors in M. salmoides. Müller et al. found that cysteine ctsl1 can activate macrophages to eliminate Staphylococcus aureus through the production of bactericidal peptides or proteins [43]. Additionally, existing results have found that ctsl1 occupies a vital position in the immunity of freshwater mussels (Cristaria plicata) [44] and pacific abalone (Haliotis discus hannai) [45]. Moreover, the ctsl1 and cathepsin K-like genes were downregulated under external stress in Nile tilapia [46]. In the current study, the apoptosis pathway-enriched genes, cathepsin K-like, ctsl1, and pro-cathepsin H, were significantly upregulated in the CHL-supplemented groups. Cathepsin is a widely distributed protease in both prokaryotes and eukaryotes, and it plays important immune functions, including lysosome protein degradation, in fishes and other vertebrates [47,48,49]. Altogether, these results indicate that dietary supplementation of C. vulgaris significantly improves the immune status of M. salmoides. The activation of the immune system requires the consumption of energy, and this energy consumption may be worth consuming for improving the health of fish, as the improvement of immunity is considered to be one of the evaluation criteria for the good application effect of C. vulgaris in fish. When the immune system of fish was activated, how much energy would be consumed and whether the energy consumed would affect the growth and health of fish was very meaningful to explore.
Intestines serve as a key immune and physical barrier to prevent the entry of harmful substances [50]. In fish, IL-8 acts as a proinflammatory factor [51]. Moreover, the expression of the il-17ra gene increases significantly in the fish intestines under external stress [52], while the expression of il-12rβ2 increases significantly in the fish intestines after Aeromonas hydrophila infection [53,54]. CXCR2 is mainly expressed in inflammatory cells [55] and can be activated by several chemokines, including IL-8 [56,57,58]. Like most chemokine receptors, CXCR4 contributes to inflammatory diseases and cancers [59,60]. The results of our study revealed that all these genes were differentially expressed and were enriched in the cytokine–cytokine receptor interaction pathway, whose dysfunction is associated with pathological alterations in the body, including increased inflammation [61,62]. In the current research, proinflammatory genes, including il-12rβ2, cxcr2, il-17ra, il-8, and cxcr4, were significantly downregulated in the CHL76 group, indicating that C. vulgaris has anti-inflammatory effects. Moreover, a previous report concluded that proinflammatory factors can inhibit TJ protein genes expressions observably [63].
TJ proteins are closely associated with the structural integrity of the intestines, and the increase in TJ (occ-1b and occludin)-related gene expressions in the intestine represents an improvement in intestinal health [64,65], while a decrease in the expression of claudin-4 indicates the loss of intestinal barrier function [66]. In the current research, the expression of occludin b and claudin-4 was observably enhanced in the CHL-supplemented groups compared with the Control group. This is similar to a previous study that found that claudin-4 expression increased significantly in the CHL-supplemented M. salmoides group compared with the Control [19]. EPO has antibacterial activity and occupies a crucial position in intestinal immunity [67]. Previous reports have suggested that IgT may play a crucial role in intestinal and gill mucosal immunity of M. salmoides [68] and rainbow trout [69,70]. In the current research, the expression of igt and epo, enriched in the phagosome signaling pathway, was observably increased in the CHL76 group compared with the Control group. This revealed that dietary supplementation of C. vulgaris can strengthen the intestinal barrier and improve the intestinal health of M. salmoides.
KEGG enrichment analysis revealed that the DEGs were closely associated with immunity and that the DEGs were correlated with serum biochemical index, ALB, and antioxidant parameters, such as CAT, GSH, GSH-Px, SOD, T-AOC, and MDA. Moreover, ALB, CAT, GSH, GSH-Px, and T-AOC were positively correlated, while MDA was negatively correlated with cathepsin K-like, ctsl1, pro-cathepsin H, claudin-4, occludin b, igt, and epo. The increase in ALB, CAT, GSH-Px, T-AOC, and GSH is an important indicator of the improvement in the immune and antioxidant capacity of an organism, while an increase in MDA indicates the occurrence of oxidative damage. These results indicate a correlation between antioxidant capacity and immune factors; however, further research is required to determine the specific mechanisms by which immune factors interact with antioxidant indicators.

5. Conclusions

The dietary supplementation of C. vulgaris effectively enhanced the intestinal antioxidant capacity of M. salmoides by increasing the activities of antioxidant enzymes and decreasing the MDA content. Furthermore, dietary supplementation of C. vulgaris improved the intestinal health of M. salmoides by reducing the expression of proapoptotic and proinflammatory factors, increasing the expression of intestinal TJ- and phagosome-related genes, and increasing the serum ALB and TP contents (Figure 6). Lastly, quadratic regression analysis of the serum biochemical indices (ALB and TP) and intestinal antioxidant parameters (GSH-Px, and GSH) revealed that 58.25–77.7 g/kg was the optimal supplemental level of C. vulgaris in the M. salmoides diet.

Author Contributions

Conceptualization, Data curation, M.R. and H.L.; Investigation, H.Y., X.G., D.H., H.L. and C.X.; Methodology, H.Y., D.H. and H.L.; Project administration, H.L. and M.R.; Supervision, M.R. and H.L.; Writing, original draft, H.Y.; Writing, review and editing, H.L. and M.R. All authors have read and agreed to the published version of the manuscript.

Funding

This study was financially supported by the National Key R & D Program of China (2022YFD2400904), the earmarked fund for CARS (CARS-46), National Natural Science Foundation of China (32102806).

Institutional Review Board Statement

The treatment of laboratory animals strictly followed the relevant regulations of the Animal Care and Use Committee of Nanjing Agricultural University (Nanjing, China) (SYXK (Su) 2022-0031).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Acknowledgments

The authors would like to express sincere thanks to the personnel of the Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, for their kind assistance. We thank foreign students (Joshua Daniel Jahazi and Kayiira John Cosmas) in our research group for the grammatical modifications in the present manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Boyd, C.E.; McNevin, A.A.; Davis, R.P. The contribution of fisheries and aquaculture to the global protein supply. Food Secur. 2022, 14, 805–827. [Google Scholar] [CrossRef] [PubMed]
  2. FAO. The State of World Fisheries and Aquaculture; Food and Agricultural Organization: Rome, Italy, 2020. Available online: http://www.fao.org/documents/card/en/c/ca9229en (accessed on 2 August 2023).
  3. FAO. The State of World Fisheries and Aquaculture—Towards Blue Transformation; Food and Agriculture Organization of the United Nations: Rome, Italy, 2022.
  4. Hussein, G.H.G.; Chen, M.; Qi, P.P.; Cui, Q.K.; Yu, Y.; Hu, W.H.; Tian, Y.; Fan, Q.X.; Gao, Z.X.; Feng, M.W.; et al. Aquaculture industry development, annual price analysis and out-of-season spawning in largemouth bass Micropterus salmoides. Aquaculture 2020, 220, 725–735. [Google Scholar] [CrossRef]
  5. Gatlin, D.; Barrows, F.; Brown, P.; Dabrowski, K.; Gaylord, T.; Hardy, R.; Wurtele, E. Expanding the utilization of sustainable plant products in aquafeeds: A review. Aquac. Res. 2007, 38, 551–579. [Google Scholar] [CrossRef]
  6. Huang, D.; Wu, Y.B.; Lin, Y.Y.; Chen, J.M.; Karrow, N.; Ren, X.; Wang, Y. Dietary protein and lipid requirements for juvenile Largemouth Bass, Micropterus salmoides. J. World Aquac. Soc. 2017, 48, 782–790. [Google Scholar] [CrossRef]
  7. FAO. The State of World Fisheries and Aquaculture; Food and Agricultural Organization: Rome, Italy, 2020. Available online: http://www.fao.org/3/ca9229en/ca9229en.pdf (accessed on 2 August 2023).
  8. Yan, N.; Fan, C.; Chen, Y.; Hu, Z. The potential for microalgae as bioreactors to produce pharmaceuticals. Int. J. Mol. Sci. 2016, 17, 962. [Google Scholar] [CrossRef] [Green Version]
  9. Buono, S.; Langellotti, A.L.; Martello, A.; Rinna, F.; Fogliano, V. Functional ingredients from microalgae. Food Funct. 2014, 5, 1669–1685. [Google Scholar] [CrossRef]
  10. Tlusty, G.M.; Rhyne, A.; Szczebak, J.T.; Bourque, B.; Bowen, J.L.; Burr, G.; Marx, C.J.; Feinberg, L. A transdisciplinary approach to the initial validation of a single cell protein as an alternative protein source for use in aquafeeds. PeerJ 2017, 5, 3170. [Google Scholar] [CrossRef] [Green Version]
  11. An, B.K.; Kim, K.E.; Jeon, J.Y.; Lee, K.W. Effect of dried Chlorella vulgaris and Chlorella growth factor on growth performance, meat qualities and humoral immune responses in broiler chickens. SpringerPlus 2016, 5, 718. [Google Scholar] [CrossRef] [Green Version]
  12. Pakravan, S.; Akbarzadeh, A.; Sajjadi, M.M.; Hajimoradloo, A.; Noori, F. Chlorella vulgaris meal improved growth performance, digestive enzyme activities, fatty acid composition and tolerance of hypoxia and ammonia stress in juvenile Pacific white shrimp Litopenaeus vannamei. Aquac. Nutr. 2018, 24, 594–604. [Google Scholar] [CrossRef]
  13. Abdel-Tawwab, M.; Mousa, M.A.A.; Mamoon, A.; Abdelghany, M.F.; Abdel-Hamid, E.A.A.; Abdel-Razek, N.; Ali, F.S.; Shady, S.H.H.; Gewida, A.G.A. Dietary Chlorella vulgaris modulates the performance, antioxidant capacity, innate immunity, and disease resistance capability of Nile tilapia fingerlings fed on plant-based diets. Anim. Feed. Sci. Technol. 2022, 283, 115181. [Google Scholar] [CrossRef]
  14. Karapanagiotidis, I.T.; Metsoviti, M.N.; Gkalogianni, E.Z.; Psofakis, P.; Asimaki, A.; Katsoulas, N.; Papapolymerou, G.; Zarkadas, I. The effects of replacing fishmeal by Chlorella vulgaris and fish oil by Schizochytrium sp. and Microchloropsis gaditana blend on growth performance, feed efficiency, muscle fatty acid composition and liver histology of gilthead seabream (Sparus aurata). Aquaculture 2022, 561, 738709. [Google Scholar] [CrossRef]
  15. Safari, O.; Paolucci, M.; Motlagh, H.A. Dietary supplementation of Chlorella vulgaris improved growth performance, immunity, intestinal microbiota and stress resistance of juvenile narrow clawed crayfish, Pontastacus leptodactylus Eschscholtz, 1823. Aquaculture 2022, 554, 738138. [Google Scholar] [CrossRef]
  16. Yu, H.; Liang, H.L.; Ge, X.P.; Zhu, J.; Wang, Y.L.; Ren, M.C.; Chen, X.R. Dietary chlorella (Chlorella vulgaris) supplementation effectively improves body color, alleviates muscle inflammation and inhibits apoptosis in largemouth bass (Micropterus salmoides). Fish Shellfish Immunol. 2022, 127, 140–147. [Google Scholar] [CrossRef]
  17. Dawood, M.A.O. Nutritional immunity of fish intestines: Important insights for sustainable aquaculture. Rev. Aquac. 2021, 13, 642–663. [Google Scholar] [CrossRef]
  18. Zhang, Z.M.; Xi, L.W.; Liu, H.K.; Jin, J.Y.; Yang, Y.X.; Zhu, X.M.; Han, D.; Xie, S.Q. High replacement of fishmeal by Chlorella meal affects intestinal microbiota and the potential metabolic function in largemouth bass (Micropterus salmoides). Front. Microbiol. 2022, 13, 3772. [Google Scholar] [CrossRef] [PubMed]
  19. Li, L.K.; Liu, X.J.; Wang, Y.; Huang, Y.Q.; Wang, C.F. Effects of alternate feeding between fish meal and novel protein diets on the intestinal health of juvenile largemouth bass (Micropterus salmoides). Aquac. Rep. 2022, 23, 101023. [Google Scholar] [CrossRef]
  20. Li, L.K.; Wang, Y.; Zhang, Z.; Wang, C.F. Microbiomic and metabonomic analysis provide new insights into the enhanced intestinal health in large-size largemouth bass (Micropterus salmoides) when fed novel proteins: Novel proteins are promising foods for future aquaculture. Aquaculture 2023, 563, 739019. [Google Scholar] [CrossRef]
  21. Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [Green Version]
  22. Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.C.; Mendell, J.T.; Salzberg, S.L. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef] [Green Version]
  23. Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Halliwell, B.; Gutteridge, J.M.C. Free Radicals in Biology and Medicine. Free Radic. Biol. Med. 1985, 1, 331–332. [Google Scholar] [CrossRef]
  25. Abdelnour, S.A.; Sheiha, A.M.; Taha, A.E.; Swelum, A.A.; Alarifi, S.; Alkahtani, S.; Ali, D.; AlBasher, G.; Almeer, R.; Falodah, F.; et al. Impacts of enriching growing rabbit diets with Chlorella vulgaris microalgae on growth, blood variables, carcass traits, immunological and antioxidant indices. Animals 2019, 9, 788. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Akbary, P.; Aminikhoei, Z. Impact of dietary supplementation of Chlorella vulgaris (Beijerinck, 1890) on the growth, antioxidant defense and immune status of the grey mullet, Mugil cephalus (Linnaeus, 1758). Sustain. Aquac. Health Manag. J. 2019, 5, 57–70. [Google Scholar] [CrossRef] [Green Version]
  27. Parvez, S.; Raisuddin, S. Protein carbonyls: Novel biomarkers of exposure to oxidative stress-inducing pesticides in freshwater fish Channa punctata (Bloch). Environ. Toxicol. Pharmacol. 2005, 20, 112–117. [Google Scholar] [CrossRef] [PubMed]
  28. Bengwayan, P.T.; Laygo, J.C.; Pacio, A.E.; Poyaoan, J.L.Z.; Rebugio, J.F.; Yuson, A.L.L. A comparative study on the antioxidant property of Chlorella (Chlorella sp.) tablet and glutathione tablet. E-Int. Sci. Res. J. 2010, 2, 12–25. [Google Scholar]
  29. Vijayavel, K.; Anbuselvam, C.; Balasubramanian, M.P. Antioxidant effect of the marine algae Chlorella vulgaris against naphthalene-induced oxidative stress in the albino rats. Mol. Cell. Biochem. 2007, 303, 39–44. [Google Scholar] [CrossRef]
  30. Yaakob, Z.; Ali, E.; Zainal, A.; Mohamad, M.; Takriff, M.S. An overview: Biomolecules from microalgae for animal feed and aquaculture. J. Biol. Res. Thessalon. 2014, 21, 6. [Google Scholar] [CrossRef] [Green Version]
  31. Řehulka, J. Influence of astaxanthin on growth rate, condition, and some blood indices of rainbow trout, Oncorhynchus mykiss. Aquaculture 2000, 190, 27–47. [Google Scholar] [CrossRef]
  32. Ghwenm, S.S.; Kata, F.S.; Athbi, A.M. Hypoglycemicandantioxidant effect of the ethanol extract of Chlorella vulgaris inalloxan-induced diabetes mice. Arch. Biochem. Biophys. 2020, 20, 3535–3542. [Google Scholar]
  33. Congleton, J.L.; Wagner, T. Blood-chemistry indicators of nutritional status in juvenile salmonids. J. Fish Biol. 2010, 69, 473–490. [Google Scholar] [CrossRef]
  34. Johnson, P.T.J.; Rohr, J.R.; Hoverman, J.T.; Kellermanns, E.; Bowerman, J.; Lunde, K.B. Living fast and dying of infection: Host life history drives interspecific variation in infection and disease risk. Ecol. Lett. 2012, 15, 235–242. [Google Scholar] [CrossRef]
  35. Mao, M.G.; Jiang, J.L.; Jiang, Z.Q.; Liu, R.T.; Zhang, Q.Y.; Gui, J.F. Molecular characterization of caspase members and expression response to nervous necrosis virus outbreak in Pacific cod. Fish Shellfish Immunol. 2018, 74, 559–566. [Google Scholar] [CrossRef]
  36. Yabu, T.; Todoriki, S.; Yamashita, M. Stress-induced apoptosis by heat shock, UV and γ-ray irradiation in zebrafish embryos detected by increased caspase activity and whole-mount TUNEL staining. Fish. Sci. 2001, 67, 333–340. [Google Scholar] [CrossRef]
  37. Kim, Y.M.; Talanian, R.V.; Billiar, T.R. Nitric oxide inhibits apoptosis by preventing increases in caspase-3-like activity via two distinct mechanisms. J. Biol. Chem. 1997, 272, 31138–31148. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Eykelbosh, A.J.; Kraak, G.V.D. A role for the lysosomal protease cathepsin B in zebrafish follicular apoptosis. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2010, 156, 218–223. [Google Scholar] [CrossRef] [PubMed]
  39. Datta, S.; Saha, D.R.; Ghosh, D.; Majumdar, T.; Bhattacharya, S.; Mazumder, S. Sub-lethal concentration of arsenic interferes with the proliferation of hepatocytes and induces in vivo apoptosis in Clarias batrachus L. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2007, 145, 339–349. [Google Scholar] [CrossRef] [PubMed]
  40. Fu, S.L.; Ding, M.M.; Liu, H.S.; Wu, L.T.; Li, B.X.; Wang, A.L.; Liao, S.A.; Ye, J.M. Identification and characterization of caspase-7 in pufferfish (Takifugu obscurus) in response to bacterial infection and cell apoptosis. Aquaculture 2019, 512, 734268. [Google Scholar] [CrossRef]
  41. Zhang, Q.L.; Liang, H.L.; Longshaw, M.; Wang, J.; Ge, X.P.; Zhu, J.; Li, S.L.; Ren, M.C. Effects of replacing fishmeal with methanotroph (Methylococcus capsulatus, Bath) bacteria meal (FeedKind®) on growth and intestinal health status of juvenile largemouth bass (Micropterus salmoides). Fish Shellfish Immunol. 2022, 122, 298–305. [Google Scholar] [CrossRef]
  42. Ge, C.Y.; Liang, X.F.; Wu, X.L.; Wang, J.; Wang, H.; Qin, Y.C.; Xue, M. Yellow mealworm (Tenebrio Molitor) enhances intestinal immunity in largemouth bass (Micropterus salmoides) via the NFκB/survivin signaling pathway. Fish Shellfish Immunol. 2023, 136, 108736. [Google Scholar] [CrossRef]
  43. Müller, S.; Faulhaber, A.; Sieber, C.; Pfeifer, D.; Hochberg, T.; Gansz, M.; Deshmukh, S.D.; Dauth, S.; Brix, K.; Saftig, P.; et al. The endolysosomal cysteine cathepsins L and K are involved in macrophage-mediated clearance of Staphylococcus aureus and the concomitant cytokine induction. FASEB J. 2014, 28, 162–175. [Google Scholar] [CrossRef]
  44. Hu, X.; Hu, X.; Hu, B.; Wen, C.; Xie, Y.; Wu, D.; Tao, Z.; Li, A.; Gao, Q. Molecular cloning and characterization of cathepsin L from freshwater mussel, Cristaria plicata. Fish Shellfish Immunol. 2014, 40, 446–454. [Google Scholar] [CrossRef] [PubMed]
  45. Shen, J.D.; Cai, Q.F.; Yan, L.J.; Du, C.H.; Liu, G.M.; Su, W.J.; Ke, C.; Cao, M.J. Cathepsin L is an immune-related protein in Pacific abalone (Haliotis discus hannai)-Purification and characterization. Fish Shellfish Immunol. 2015, 47, 986–995. [Google Scholar] [CrossRef] [PubMed]
  46. Liu, M.Y.; Ma, Z.T.; Zheng, T.R.; Sun, W.J.; Zhang, Y.J.; Jin, W.Q.; Zhan, J.Y.; Cai, Y.T.; Tang, Y.J.; Wu, Q.; et al. Insights into the correlation between physiological changes in and seed development of tartary buckwheat (Fagopyrum tataricum Gaertn.). BMC Genomics 2018, 19, 648. [Google Scholar] [CrossRef] [PubMed]
  47. Harikrishnan, R.; Kim, M.-C.; Kim, J.-S.; Han, Y.-J.; Jang, I.-S.; Balasundaram, C.; Heo, M.-S. Immune response and expression analysis of cathepsin K in goldfish during Aeromonas hydrophila infection. Fish Shellfish Immunol. 2010, 28, 511–516. [Google Scholar] [CrossRef]
  48. Lv, Z.; Qiu, L.M.; Liu, Z.Q.; Wang, W.L.; Chen, H.; Jia, Y.K.; Jia, Z.H.; Jiang, S.; Wang, L.L.; Song, L.S. Molecular characterization of a cathepsin L1 highly expressed in phagocytes of pacific oyster Crassostrea gigas. Dev. Comp. Immunol. 2018, 89, 152–162. [Google Scholar] [CrossRef]
  49. Schweiger, A.; Christensen, I.J.; Nielsen, H.J.; Sørensen, S.; Brunner, N.; Kos, J. Serum cathepsin H as a potential prognostic marker in patients with colorectal cancer. Int. J. Biol. Markers 2004, 19, 289–294. [Google Scholar] [CrossRef] [Green Version]
  50. Fan, J.; Yang, Y.; Ma, C.; Liu, X.; Wang, Y.; Chen, F.; Wang, B.; Bian, X.; Yang, C.; Zhang, N. The effects and cell barrier mechanism of main dietary nutrients on intestinal barrier. Curr. Opin. Food Sci. 2022, 48, 100942. [Google Scholar] [CrossRef]
  51. Rymuszka, A.; Adaszek, Ł. Pro-and anti-inflammatory cytokine expression in carp blood and head kidney leukocytes exposed to cyanotoxin stresse-An in vitro study. Fish Shellfish Immunol. 2012, 33, 382–388. [Google Scholar] [CrossRef]
  52. Zuo, Z.H.; Wang, S.D.; Wang, Q.J.; Wang, D.J.; Wu, Q.P.; Xie, S.L.; Zou, J.X. Effects of partial replacement of dietary flour meal with seaweed polysaccharides on the resistance to ammonia stress in the intestine of hybrid snakehead (Channa maculatus♀× Channa argus♂). Fish Shellfish Immunol. 2022, 127, 271–279. [Google Scholar] [CrossRef]
  53. Qiu, X.Y.; Wang, D.; Lv, M.Y.; Sun, H.; Ren, J.Q.; Wang, X.Y.; Zhou, H. Identification and functional characterization of interleukin-12 receptor beta 1 and 2 in grass carp (Ctenopharyngodon idella). Mol. Immunol. 2022, 143, 58–67. [Google Scholar] [CrossRef]
  54. Song, X.H.; Tang, J.; Gao, T.T.; Xu, X.F.; Yang, H.X.; Wu, K.; Yang, C.G.; Cheng, Z.Q.; Sun, B.Y. Interleukin-12 receptor β2 from grass carp: Molecular characterization and its involvement in Aeromonas hydrophila-induced intestinal inflammation. Fish Shellfish Immunol. 2019, 87, 226–234. [Google Scholar] [CrossRef] [PubMed]
  55. Le, Y.; Zhou, Y.; Iribarren, P.; Wang, J. Chemokines and chemokine receptors: Their manifold roles in homeostasis and disease. Cell. Mol. Immunol. 2004, 1, 95–104. [Google Scholar] [PubMed]
  56. Waugh, D.J.; Wilson, C. The interleukin-8 pathway in cancer. Clin. Cancer Res. 2008, 14, 6735–6741. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  57. Ning, Y.; Manegold, P.C.; Hong, Y.K.; Zhang, W.; Pohl, A.; Lurje, G.; Winder, T.; Yang, D.Y.; LaBonte, M.J.; Wilson, P.M.; et al. Interleukin-8 is associated with proliferation, migration, angiogenesis and chemosensitivity in vitro and in vivo in colon cancer cell line models. Int. J. Cancer 2011, 128, 2038–2049. [Google Scholar] [CrossRef] [Green Version]
  58. Liu, K.W.; Wu, L.J.; Yuan, S.G.; Wu, M.; Xu, Y.M.; Sun, Q.Q.; Li, S.; Zhao, S.W.; Hua, T.; Liu, Z.J. Structural basis of CXC chemokine receptor 2 activation and signalling. Nature 2020, 585, 135–140. [Google Scholar] [CrossRef]
  59. Koelink, P.J.; Overbeek, S.A.; Braber, S.; Kruijf, P.; Folkerts, G.; Smit, M.J.; Kraneveld, A.D. Targeting chemokine receptors in chronic inflammatory diseases: An extensive review. Pharmacol. Ther. 2012, 133, 1–18. [Google Scholar] [CrossRef]
  60. Balkwill, F. The significance of cancer cell expression of the chemokine receptor CXCR4. Semin. Cancer Biol. 2004, 14, 171–179. [Google Scholar] [CrossRef]
  61. Dey, R.; Ji, K.; Liu, Z.; Chen, L. A Cytokine-Cytokine Interaction in the assembly of Higher-Order structure and activation of the Interleukine-3: Receptor Complex. PLoS ONE 2009, 4, e5188. [Google Scholar] [CrossRef] [Green Version]
  62. Lasry, A.; Zinger, A.; Benneriah, Y. Inflammatory networks underlying colorectal cancer. Nat. Immunol. 2016, 17, 230–240. [Google Scholar] [CrossRef]
  63. Ma, T.Y.; Iwamoto, G.K.; Hoa, N.T.; Akotia, V.; Said, H.M.J.A.G.; Physiology, L. TNF-α-induced increase in intestinal epithelial tight junction permeability requires NF-κB activation. Am. J. Physiol. Gastrointest. Liver Physiol. 2004, 286, G367–G376. [Google Scholar] [CrossRef] [Green Version]
  64. Xie, M.; Xie, Y.; Li, Y.; Zhou, W.; Zhang, Z.; Yang, Y.; Zhou, Z. The effects of fish meal replacement with ultra-micro ground mixed plant proteins (uPP) in practical diet on growth, gut and liver health of common carp (Cyprinus carpio). Aquac. Rep. 2001, 19, 100558. [Google Scholar] [CrossRef]
  65. Xie, X.Z.; Wang, J.; Guan, Y.; Xing, S.J.; Liang, X.F.; Xue, M.; Wang, J.J.; Chang, Y.; Leclercq, E. Cottonseed protein concentrate as fishmeal alternative for largemouth bass (Micropterus salmoides) supplemented a yeast-based paraprobiotic: Effects on growth performance, gut health and microbiome. Aquaculture 2022, 551, 737898. [Google Scholar] [CrossRef]
  66. Pinton, P.; Braicu, C.; Nougayrede, J.P.; Laffitte, J.; Taranu, I.; Oswald, I.P. Deoxynivalenol impairs porcine intestinal barrier function and decreases the protein expression of claudin-4 through a mitogen-activated protein kinase-dependent mechanism. J. Nutr. 2010, 140, 1956–1962. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  67. Hogan, S.P.; Waddell, A.; Fulkerson, P.C. Eosinophils in infection and intestinal immunity. Curr. Opin. Gastroen. 2013, 29, 7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  68. Yang, S.; Ming, Y.; Ma, Y.X.; Zhang, X.T.; Qian, S.C.; Fei, H. Molecular cloning, characterization, and expression analyses of immunoglobulin tau heavy chain (IgT) in largemouth bass (Micropterus salmoides). Aquac. Rep. 2022, 22, 100989. [Google Scholar] [CrossRef]
  69. Zhang, Y.A.; Salinas, I.; Li, J.; Parra, D.; Bjork, S.; Xu, Z.; LaPatra, S.E.; Bartholomew, J.; Sunyer, J.O. IgT, a primitive immunoglobulin class specialized in mucosal immunity. Nat. Immunol. 2010, 11, 827–835. [Google Scholar] [CrossRef] [Green Version]
  70. Xu, Z.; Parra, D.; Gómez, D.; Salinas, I.; Zhang, Y.A.; Von, G.J.L.; Heinecke, R.D.; Buchmann, K.; LaPatra, S.; Sunyer, J.O. Teleost skin, an ancient mucosal surface that elicits gut-like immune responses. Proc. Natl. Acad. Sci. USA 2013, 110, 13097–13102. [Google Scholar] [CrossRef]
Antioxidants 12 01565 g001
Figure 1. Glutathione (GSH), glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), total antioxidant capacity (T-AOC), malondialdehyde (MDA), and catalase (CAT). Data are expressed as means with standard error. Values with different alphabetical superscripts were significantly different (p < 0.05).
Figure 1. Glutathione (GSH), glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), total antioxidant capacity (T-AOC), malondialdehyde (MDA), and catalase (CAT). Data are expressed as means with standard error. Values with different alphabetical superscripts were significantly different (p < 0.05).
Antioxidants 12 01565 g001
Antioxidants 12 01565 g002
Figure 2. Albumin (ALB) (A), total protein (TP) (B), glutathione peroxidase (GSH-Px) (C), and glutathione (GSH) (D). The data were described in terms of mean ± standard error.
Figure 2. Albumin (ALB) (A), total protein (TP) (B), glutathione peroxidase (GSH-Px) (C), and glutathione (GSH) (D). The data were described in terms of mean ± standard error.
Antioxidants 12 01565 g002
Antioxidants 12 01565 g003
Figure 3. Correlation analysis between samples (A), the circle size indicated a correlation between samples (the larger the size, the stronger the correlation); The PCA diagram shows the distribution of data in the principal component space (B); The bubble map shows the upregulated and downregulated DEGs (C); Total DEGs in M. salmoides fed CHL76 in comparison with the control diet (D).
Figure 3. Correlation analysis between samples (A), the circle size indicated a correlation between samples (the larger the size, the stronger the correlation); The PCA diagram shows the distribution of data in the principal component space (B); The bubble map shows the upregulated and downregulated DEGs (C); Total DEGs in M. salmoides fed CHL76 in comparison with the control diet (D).
Antioxidants 12 01565 g003
Antioxidants 12 01565 g004
Figure 4. The visual heatmap between pro-cathepsin H, caspase-3-like, caspase-7, cathepsin K-like, cathepsin L1 (ctsl1), interleukin-12 receptor subunit beta-2 (il-12rβ2), chemokine (C-X-C motif) receptor 2 (cxcr2), interleukin-17 receptor A-like (il-17ra), interlukin-8 (il-8), C-C motif chemokine 4-like (cxcr4), claudin-4, occludin b, eosinophil peroxidase (epo), and immunoglobulin tau heavy chain (igt) in RNA-seq results and samples (A,B). qPCR is used to verify the validity of DEGs (C–H). The data were described in terms of mean ± standard error. The asterisk indicates a significant difference between the two groups (p < 0.05).
Figure 4. The visual heatmap between pro-cathepsin H, caspase-3-like, caspase-7, cathepsin K-like, cathepsin L1 (ctsl1), interleukin-12 receptor subunit beta-2 (il-12rβ2), chemokine (C-X-C motif) receptor 2 (cxcr2), interleukin-17 receptor A-like (il-17ra), interlukin-8 (il-8), C-C motif chemokine 4-like (cxcr4), claudin-4, occludin b, eosinophil peroxidase (epo), and immunoglobulin tau heavy chain (igt) in RNA-seq results and samples (A,B). qPCR is used to verify the validity of DEGs (C–H). The data were described in terms of mean ± standard error. The asterisk indicates a significant difference between the two groups (p < 0.05).
Antioxidants 12 01565 g004
Antioxidants 12 01565 g005
Figure 5. The correlation analysis among DEGs (A) and the correlation analysis between DEGs and serum biochemical indexes and antioxidant parameters (B). The asterisk indicates a significant difference between the two indicators (* p < 0.05, ** p < 0.01). Cathepsin L1 (ctsl1), interleukin-12 receptor subunit beta-2 (il-12rβ2), chemokine (C-X-C motif) receptor 2 (cxcr2), interleukin-17 receptor A-like (il-17ra), interlukin-8 (il-8), C-C motif chemokine 4-like (cxcr4), eosinophil peroxidase (epo), immunoglobulin tau heavy chain (igt). Glutathione (GSH), glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), total antioxidant capacity (T-AOC), malondialdehyde (MDA), catalase (CAT), albumin (ALB), and total protein (TP).
Figure 5. The correlation analysis among DEGs (A) and the correlation analysis between DEGs and serum biochemical indexes and antioxidant parameters (B). The asterisk indicates a significant difference between the two indicators (* p < 0.05, ** p < 0.01). Cathepsin L1 (ctsl1), interleukin-12 receptor subunit beta-2 (il-12rβ2), chemokine (C-X-C motif) receptor 2 (cxcr2), interleukin-17 receptor A-like (il-17ra), interlukin-8 (il-8), C-C motif chemokine 4-like (cxcr4), eosinophil peroxidase (epo), immunoglobulin tau heavy chain (igt). Glutathione (GSH), glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), total antioxidant capacity (T-AOC), malondialdehyde (MDA), catalase (CAT), albumin (ALB), and total protein (TP).
Antioxidants 12 01565 g005
Antioxidants 12 01565 g006
Figure 6. The potential regulatory hanisms for enhancing antioxidant capacity and improving immunity in juvenile M. salmoides fed with C. vulgaris. Cathepsin L1 (ctsl1), interleukin-12 receptor subunit beta-2 (il-12rβ2), chemokine (C-X-C motif) receptor 2 (cxcr2), interleukin-17 receptor A-like (il-17ra), interlukin-8 (il-8), C-C motif chemokine 4-like (cxcr4), eosinophil peroxidase (epo), immunoglobulin tau heavy chain (igt). Glutathione (GSH), glutathione peroxidase (GSH-Px) total antioxidant capacity (T-AOC), malondialdehyde (MDA),albumin (ALB), and total protein (TP).
Figure 6. The potential regulatory hanisms for enhancing antioxidant capacity and improving immunity in juvenile M. salmoides fed with C. vulgaris. Cathepsin L1 (ctsl1), interleukin-12 receptor subunit beta-2 (il-12rβ2), chemokine (C-X-C motif) receptor 2 (cxcr2), interleukin-17 receptor A-like (il-17ra), interlukin-8 (il-8), C-C motif chemokine 4-like (cxcr4), eosinophil peroxidase (epo), immunoglobulin tau heavy chain (igt). Glutathione (GSH), glutathione peroxidase (GSH-Px) total antioxidant capacity (T-AOC), malondialdehyde (MDA),albumin (ALB), and total protein (TP).
Antioxidants 12 01565 g006
Table 1. The assay kits or testing equipment of serum biochemical indices and intestinal antioxidant parameters.
Table 1. The assay kits or testing equipment of serum biochemical indices and intestinal antioxidant parameters.
ItemsMethods/Assay Kits/Testing Equipment
ALTThe serum biochemical indices were measured using an automatic biochemical analyzer, a Mindary BS-400 (Shenzhen, China) and assay kits (Mindray) purchased from Gansu Heyuan Biotechnology Co., Ltd. (Gansu, China).
AST
ALB
TP
GSHThe intestinal antioxidant parameters were detected using the kits purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China), and the samples were prepared according to the manufacturer’s instructions.
GSH-Px
SOD
T-AOC
CAT
MDA
Note: Alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB), and total protein (TP), glutathione (GSH), glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), total antioxidant capacity (T-AOC), malondialdehyde (MDA), and catalase (CAT).
Table 2. Primer sequences for quantitative real-time PCR assay.
Table 2. Primer sequences for quantitative real-time PCR assay.
Gene Name SequenceTm (°C)GC (%)Accession No.
pro-cathepsin HFAAGGCCATGGTTGATGCTGT60.2550XM_038701870.1
RCAGACTGTGCCCCAAGAGTT59.8955
caspase-3-likeFCCCTCAGCAAACTGGGCTT60.2357.89XM_038739762.1
RTGAGGAACACTTTGGCCTTTTTC59.8743.48
caspase 7FCCTACACCTTCCAGGCCAAA59.655XM_038734228.1
RCGCAGACATCAGTTGCTCAC59.5655
cathepsin K-likeFAGGGCCATTTGGGAGAAGAAC60.2752.38XM_038694428.1
RCGATTTGGGAAGCTTGGACAC59.852.38
ctsl1FAGATCGAGCTGCACAACCTG60.3955XM_038704447.1
RCACTGACCCTGGTCCTTCAC59.9660
il-12rβ2FTCCAGTATCGGACTGAGGCA60.0355XM_038698864.1
RTCGAAGCTTGCAGGGAATGT59.9650
cxcr2FCAGGTTGGACATAGTGCCGT60.0455XM_038721015.1
RAAGACCTGCTGCTTCTTGCT59.8950
il-17raFATGTGTGGCGACAAAGAGGT59.8950
RGTGATTCACTCTGCCCGGTT60.3255
il-8FGAGGGTACATGTCTGGGGGA60.3360XM_038713529.1
RCCTTGAAGGTTTGTTCTTCATCGT59.7241.67
cxcr4FGGTCCAGATGACTGCTGCTT60.0455XM_038726066.1
RGCTGGATCACTCGGATGGTT59.8255
claudin-4FTGAGGTACTCCAAGGCTCGT60.2555XM_038707645.1
RGCAACAATGGTGTAGGGGGA59.9655
occludin bFGGTCTGGGAAGTGGAGTTGG59.9660XM_038703759.1
RTGGTGAGCGGGCAGTATTTT59.9650
igtFCTTCTGCTGGTTGCTCTCTCT59.7252.38
RGCTGGCGTAATCTGTTTTGCT59.847.62
epoFATCTCGGCAGTCCTCTCCTT60.0355XM_038733743.1
RTTGCGTTGAGTGAGCGTTTG59.9750
Note: cathepsin L1 (ctsl1), interleukin-12 receptor subunit beta-2 (il-12rβ2), chemokine (C-X-C motif) receptor 2 (cxcr2), interleukin-17 receptor A-like (il-17ra), interlukin-8 (il-8), C-C motif chemokine 4-like (cxcr4), eosinophil peroxidase (epo), immunoglobulin tau heavy chain (igt).
Table 3. Effects of C. vulgaris on serum biochemical indices of M. salmoides.
Table 3. Effects of C. vulgaris on serum biochemical indices of M. salmoides.
Dietary C. vulgaris Levels (g/kg)ALT (U/L)AST (U/L)ALB (g/L)TP (g/L)
03.78 ± 0.677.75 ± 1.0613.77 ± 0.58 a46.56 ± 1.14 a
383.29 ± 0.7510.71 ± 1.2117.09 ± 0.42 b49.52 ± 0.70 ab
763.63 ± 0.8510.85 ± 2.2217.54 ± 0.34 b51.62 ± 1.52 b
1142.79 ± 0.3810.99 ± 1.8715.60 ± 0.81 ab45.11 ± 0.97 a
1521.49 ± 0.278.84 ± 0.6015.18 ± 0.67 ab44.78 ± 1.53 a
Note: Alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB), and total protein (TP). The data were described in terms of mean ± standard error. Values with different alphabetical superscripts were significantly different (p < 0.05).
Table 4. Quality evaluation of sequencing data.
Table 4. Quality evaluation of sequencing data.
SampleTotal ReadsValid Ratio (%)Q30 (%)GC Content (%)
CHL0-140,723,12095.40%94.7447.26
CHL0-244,880,61296.08%95.0147.33
CHL0-343,214,73096.13%94.8847.26
CHL76-144,842,09696.66%95.0849.08
CHL76-247,363,89895.60%94.1947.35
CHL76-338,524,89495.53%93.6247.43
Table 5. Information statistics of DEGs in the intestine of juvenile M. salmoides fed CHL76 diet compared to that fed CHL0 diet.
Table 5. Information statistics of DEGs in the intestine of juvenile M. salmoides fed CHL76 diet compared to that fed CHL0 diet.
Signaling Pathway NameGene Nameq ValueRegulationLog2FC
Apoptosispro-cathepsin H0.000up2.46
caspase-3-like0.000down−1.62
caspase-70.000down−1.80
cathepsin K-like0.000up9.66
ctsl10.000up3.51
Cytokine–cytokine receptor interactionil-12rβ20.000down−1.25
cxcr20.001down−1.18
il-17ra0.048down−1.04
il-80.032down−1.00
cxcr40.002down−1.18
Tight junctionclaudin-40.001up1.28
occludin b0.000up2.75
Phagosomeigt0.000up5.94
epo0.000up1.53
Note: cathepsin L1 (ctsl1), interleukin-12 receptor subunit beta-2 (il-12rβ2), chemokine (C-X-C motif) receptor 2 (cxcr2), interleukin-17 receptor A-like (il-17ra), interlukin-8 (il-8), C-C motif chemokine 4-like (cxcr4), eosinophil peroxidase (epo), immunoglobulin tau heavy chain (igt).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yu, H.; Ge, X.; Huang, D.; Xue, C.; Ren, M.; Liang, H. Dietary Supplementation of Chlorella vulgaris Effectively Enhanced the Intestinal Antioxidant Capacity and Immune Status of Micropterus salmoides. Antioxidants 2023, 12, 1565. https://doi.org/10.3390/antiox12081565

AMA Style

Yu H, Ge X, Huang D, Xue C, Ren M, Liang H. Dietary Supplementation of Chlorella vulgaris Effectively Enhanced the Intestinal Antioxidant Capacity and Immune Status of Micropterus salmoides. Antioxidants. 2023; 12(8):1565. https://doi.org/10.3390/antiox12081565

Chicago/Turabian Style

Yu, Heng, Xianping Ge, Dongyu Huang, Chunyu Xue, Mingchun Ren, and Hualiang Liang. 2023. "Dietary Supplementation of Chlorella vulgaris Effectively Enhanced the Intestinal Antioxidant Capacity and Immune Status of Micropterus salmoides" Antioxidants 12, no. 8: 1565. https://doi.org/10.3390/antiox12081565

APA Style

Yu, H., Ge, X., Huang, D., Xue, C., Ren, M., & Liang, H. (2023). Dietary Supplementation of Chlorella vulgaris Effectively Enhanced the Intestinal Antioxidant Capacity and Immune Status of Micropterus salmoides. Antioxidants, 12(8), 1565. https://doi.org/10.3390/antiox12081565

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop