Anti-Hypertensive Property of an NO Nanoparticle in an Adenine-Induced Chronic Kidney Disease Young Rat Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Synthesis of Cu-Doped ZIF-8
2.2. Preparation of GSNO-Loaded Cu/ZIF-8
2.3. In Vitro NO Generation Measurement
2.4. Animal Model of CKD
2.5. Analysis of NO Parameters
2.6. Western Blot
2.7. Detection of Oxidative Stress by 8-OHdG Immunostaining
2.8. Quantitative PCR
2.9. Statistical Analysis
3. Results
3.1. GSNO-Loaded Cu/ZIF-8 Nanparticle Characterization
3.2. Effects of NO Nanoparticles and DETA NONOate on Renal Outcomes
3.3. Effects of NO Nanoparticles and DETA NONOate on NO Pathway
3.4. Effects of NO Nanoparticles and DETA NONOate on Oxidative Stress
3.5. Effects of NO Nanoparticles and DETA NONOate on the RAS
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- GBD 2017 Risk Factor Collaborators. Global, regional, and national comparative risk assessment of 84 behavioural, environmental and occupational, and metabolic risks or clusters of risks for 195 countries and territories, 1990–2017: A systematic analysis for the Global Burden of Disease Study 2017. Lancet 2018, 392, 1923–1994. [Google Scholar]
- Rapsomaniki, E.; Timmis, A.; George, J.; Pujades-Rodriguez, M.; Shah, A.D.; Denaxas, S.; White, I.R.; Caulfield, M.J.; Deanfield, J.E.; Smeeth, L.; et al. Blood pressure and incidence of twelve cardiovascular diseases: Lifetime risks, healthy life-years lost, and age-specific associations in 1·25 million people. Lancet 2014, 383, 1899–1911. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, C.N.; Tain, Y.L. Early Origins of Hypertension: Should Prevention Start Before Birth Using Natural Antioxidants? Antioxidants 2020, 9, 1034. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wyszynska, T.; Cichocka, E.; Wieteska-Klimczak, A.; Jobs, K.; Januszewicz, P. A single pediatric center experience with 1025 children with hypertension. Acta Paediatr. 1992, 81, 244–246. [Google Scholar] [CrossRef] [Scilit]
- Wong, H.; Mylrea, K.; Feber, J.; Drukker, A.; Filler, G. Prevalence of complications in children with chronic kidney disease according to KDOQI. Kidney Int. 2006, 70, 585–590. [Google Scholar] [CrossRef] [Scilit]
- Samuels, J.; Ng, D.; Flynn, J.T.; Mitsnefes, M.; Poffenbarger, T.; Warady, B.A.; Furth, S. Chronic Kidney Disease in Children Study Group. Ambulatory blood pressure patterns in children with chronic kidney disease. Hypertension 2012, 60, 43–50. [Google Scholar] [CrossRef] [Scilit]
- Hsu, C.N.; Lu, P.C.; Lo, M.H.; Lin, I.C.; Tain, Y.L. The Association between Nitric Oxide Pathway, Blood Pressure Abnormalities, and Cardiovascular Risk Profile in Pediatric Chronic Kidney Disease. Int. J. Mol. Sci. 2019, 20, 5301. [Google Scholar] [CrossRef] [Scilit]
- Hadtstein, C.; Schaefer, F. Hypertension in children with chronic kidney disease: Pathophysiology and management. Pediatr. Nephrol. 2008, 23, 363–371. [Google Scholar] [CrossRef] [Scilit]
- Carey, R.M.; Sakhuja, S.; Calhoun, D.A.; Whelton, P.K.; Muntner, P. Prevalence of Apparent Treatment-Resistant Hypertension in the United States. Hypertension 2019, 73, 424–431. [Google Scholar] [CrossRef] [Scilit]
- Baylis, C.; Vallance, P. Nitric oxide and blood pressure: Effects of nitric oxide deficiency. Curr. Opin. Nephrol. Hypertens. 1996, 5, 80–88. [Google Scholar] [CrossRef] [Scilit]
- Wilcox, C.S. Oxidative stress and nitric oxide deficiency in the kidney: A critical link to hypertension? Am. J. Physiol. Regul. Integr. Comp. Physiol. 2005, 289, R913–R935. [Google Scholar] [CrossRef] [Scilit]
- Baylis, C. Arginine, arginine analogs and nitric oxide production in chronic kidney disease. Nat. Clin. Pract. Nephrol. 2006, 2, 209–220. [Google Scholar] [CrossRef] [Scilit]
- Török, J. Participation of nitric oxide in different models of experimental hypertension. Physiol. Res. 2008, 57, 813–825. [Google Scholar] [CrossRef] [Scilit]
- Megson, I.L.; Webb, D.J. Nitric oxide donor drugs: Current status and future trends. Expert Opin. Investig. Drugs 2002, 11, 587–601. [Google Scholar]
- Li, B.; Ming, Y.; Liu, Y.; Xing, H.; Fu, R.; Li, Z.; Ni, R.; Li, L.; Duan, D.; Xu, J.; et al. Recent Developments in Pharmacological Effect, Mechanism and Application Prospect of Diazeniumdiolates. Front. Pharmacol. 2020, 11, 92. [Google Scholar] [CrossRef] [Scilit]
- Rahimi, N.; Dehpour, A.R.; Javadi-Paydar, M.; Sohanaki, H.; Rabbani, S.; Ansari, M.; Tafti, S.H. Effect of DETA-NONOate and papaverine on vasodilation of human internal mammary artery. Can. J. Physiol. Pharmacol. 2011, 89, 945–951. [Google Scholar] [CrossRef] [Scilit]
- Chen, Q.; Sievers, R.E.; Varga, M.; Kharait, S.; Haddad, D.J.; Patton, A.K.; Delany, C.S.; Mutka, S.C.; Blonder, J.P.; Dubé, G.P.; et al. Pharmacological inhibition of S-nitrosoglutathione reductase improves endothelial vasodilatory function in rats in vivo. J. Appl. Physiol. 2013, 114, 752–760. [Google Scholar] [CrossRef] [Scilit]
- Quinn, J.F.; Whittaker, M.R.; Davis, T.P. Delivering nitric oxide with nanoparticles. J. Control. Release 2015, 205, 190–205. [Google Scholar] [CrossRef] [Scilit]
- Hsu, C.N.; Yang, H.W.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Melatonin Prevents Chronic Kidney Disease-Induced Hypertension in Young Rat Treated with Adenine: Implications of Gut Microbiota-Derived Metabolites. Antioxidants 2021, 10, 1211. [Google Scholar] [CrossRef] [Scilit]
- Monti, M.; Ciccone, V.; Pacini, A.; Roggeri, R.; Monzani, E.; Casella, L.; Morbidelli, L. Anti-hypertensive property of a nickel-piperazine/NO donor in spontaneously hypertensive rats. Pharmacol. Res. 2016, 107, 352–359. [Google Scholar] [CrossRef] [Scilit]
- Bode-Böger, S.M.; Scalera, F.; Ignarro, L.J. The L-arginine paradox: Importance of the L-arginine/asymmetrical dimethylarginine ratio. Pharmacol. Ther. 2007, 114, 295–306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marrocco, I.; Altieri, F.; Peluso, I. Measurement and Clinical Significance of Biomarkers of Oxidative Stress in Humans. Oxid. Med. Cell Longev. 2017, 2017, 6501046. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gorren, A.C.F.; Schrammel, A.; Schmidt, K.; Mayer, B. Decomposition of s-nitrosoglutathione in the presence of copper ions and glutathione. Arch. Biochem. Biophys. 1996, 330, 219–228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schulman, I.H.; Zhou, M.S.; Raij, L. Interaction between nitric oxide and angiotensin II in the endothelium: Role in atherosclerosis and hypertension. J. Hypertens. Suppl. 2006, 24, S45–S50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, C.N.; Tain, Y.L. Regulation of Nitric Oxide Production in the Developmental Programming of Hypertension and Kidney Disease. Int. J. Mol. Sci. 2019, 20, 681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gokce, N. L-Arginine and hypertension. J. Nutr. 2004, 134, 2807S–2811S. [Google Scholar] [CrossRef] [Scilit]
- Wu, G.; Morris, S.M., Jr. Arginine metabolism: Nitric oxide and beyond. Biochem. J. 1998, 336, 1–17. [Google Scholar] [CrossRef] [Scilit]
- Romero, M.J.; Platt, D.H.; Caldwell, R.B.; Caldwell, R.W. Therapeutic use of citrulline in cardiovascular disease. Cardiovasc. Drug Rev. 2006, 24, 275–290. [Google Scholar] [CrossRef] [Scilit]
- Tain, Y.L.; Hsu, C.N. Toxic Dimethylarginines: Asymmetric Dimethylarginine (ADMA) and Symmetric Dimethylarginine (SDMA). Toxins 2017, 9, E92. [Google Scholar] [CrossRef] [Scilit]
- Da Silva, G.M.; da Silva, M.C.; Nascimento, D.V.G.; Lima Silva, E.M.; Gouvêa, F.F.F.; de França Lopes, L.G.; Araújo, A.V.; Ferraz Pereira, K.N.; de Queiroz, T.M. Nitric Oxide as a Central Molecule in Hypertension: Focus on the Vasorelaxant Activity of New Nitric Oxide Donors. Biology 2021, 10, 1041. [Google Scholar] [CrossRef] [Scilit]
- Daiber, A.; Münzel, T. Organic Nitrate Therapy, Nitrate Tolerance, and Nitrate-Induced Endothelial Dysfunction: Emphasis on Redox Biology and Oxidative Stress. Antioxid. Redox Signal. 2015, 23, 899–942. [Google Scholar] [CrossRef] [Scilit]
- Shah, S.U.; Socha, M.; Fries, I.; Gibaud, S. Synthesis of S-nitrosoglutathione-alginate for prolonged delivery of nitric oxide in intestines. Drug Deliv. 2016, 23, 2927–2935. [Google Scholar] [CrossRef] [Scilit]
- Shin, H.Y.; George, S.C. Microscopic modeling of NO and S-nitrosoglutathione kinetics and transport in human airways. J. Appl. Physiol. 2001, 90, 777–788. [Google Scholar] [CrossRef] [Scilit]
- Dong, C.; Feng, W.; Xu, W.; Yu, L.; Xiang, H.; Chen, Y.; Zhou, J. The Coppery Age: Copper (Cu)-Involved Nanotheranostics. Adv. Sci. 2020, 7, 2001549. [Google Scholar] [CrossRef] [Scilit]
- Tang, H.; Xu, M.; Zhou, X.; Zhang, Y.; Zhao, L.; Ye, G.; Shi, F.; Lv, C.; Li, Y. Acute toxicity and biodistribution of different sized copper nano-particles in rats after oral administration. Mater. Sci. Eng. C Mater. Biol. Appl. 2018, 93, 649–663. [Google Scholar] [CrossRef] [Scilit]
- Zhou, X.; Zhao, L.; Luo, J.; Tang, H.; Xu, M.; Wang, Y.; Yang, X.; Chen, H.; Li, Y.; Ye, G.; et al. The Toxic Effects and Mechanisms of Nano-Cu on the Spleen of Rats. Int. J. Mol. Sci. 2019, 20, 1469. [Google Scholar] [CrossRef] [Scilit]
- Hsu, C.N.; Tain, Y.L. Targeting the Renin–Angiotensin–Aldosterone System to Prevent Hypertension and Kidney Disease of Developmental Origins. Int. J. Mol. Sci. 2021, 22, 2298. [Google Scholar] [CrossRef] [Scilit]
- Te Riet, L.; van Esch, J.H.; Roks, A.J.; van den Meiracker, A.H.; Danser, A.H. Hypertension: Renin-angiotensin-aldosterone system alterations. Circ. Res. 2015, 116, 960–975. [Google Scholar] [CrossRef] [Scilit]
- Chobanyan, K.; Thum, T.; Suchy, M.T.; Zhu, B.; Mitschke, A.; Gutzki, F.M.; Beckmann, B.; Stichtenoth, D.O.; Tsikas, D. GC-MS assay for hepatic DDAH activity in diabetic and non-diabetic rats by measuring dimethylamine (DMA) formed from asymmetric dimethylarginine (ADMA): Evaluation of the importance of S-nitrosothiols as inhibitors of DDAH activity in vitro and in vivo in humans. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 2007, 858, 32–41. [Google Scholar]
- Zhang, H.; Snead, C.; Catravas, J.D. Nitric oxide differentially regulates induction of type II nitric oxide synthase in rat vascular smooth muscle cells versus macrophages. Arterioscler. Thromb. Vasc. Biol. 2001, 21, 529–535. [Google Scholar] [CrossRef] [Scilit]
- Huang, C.F.; Hsu, C.N.; Chien, S.J.; Lin, Y.J.; Huang, L.T.; Tain, Y.L. Aminoguanidine attenuates hypertension, whereas 7-nitroindazole exacerbates kidney damage in spontaneously hypertensive rats: The role of nitric oxide. Eur. J. Pharmacol. 2013, 699, 233–240. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Protein | Host | Company | Catalog No. | Dilution |
|---|---|---|---|---|
| eNOS | Mouse | BD Biosciences | BD610297 | 1:250 |
| nNOS | Mouse | Santa Cruz | SC-5302 | 1:200 |
| DDAH1 | Mouse | Santa Cruz | SC-271337 | 1:500 |
| DDAH2 | Rabbit | Abcam | Ab184166 | 1:2000 |
| Gene | 5′ Primer | 3′ Primer |
|---|---|---|
| Agt | 5 gcccaggtcgcgatgat 3 | 5 tgtacaagatgctgagtgaggcaa 3 |
| Renin | 5 aacattaccagggcaactttcact 3 | 5 acccccttcatggtgatctg 3 |
| PRR | 5 gaggcagtgaccctcaacat 3 | 5 ccctcctcacacaacaaggt 3 |
| ACE1 | 5 caccggcaaggtctgctt 3 | 5 cttggcatagtttcgtgaggaa 3 |
| ACE2 | 5 acccttcttacatcagccctactg 3 | 5 tgtccaaaacctaccccacatat 3 |
| AT1R | 5 gctgggcaacgagtttgtct 3 | 5 cagtccttcagctggatcttca 3 |
| MAS | 5 catctctcctctcggctttgtg 3 | 5 cctcatccggaagcaaagg 3 |
| R18S | 5 gccgcggtaattccagctcca 3 | 5 cccgcccgctcccaagatc 3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tain, Y.-L.; Yang, H.-W.; Hou, C.-Y.; Chang-Chien, G.-P.; Lin, S.; Hsu, C.-N. Anti-Hypertensive Property of an NO Nanoparticle in an Adenine-Induced Chronic Kidney Disease Young Rat Model. Antioxidants 2023, 12, 513. https://doi.org/10.3390/antiox12020513
Tain Y-L, Yang H-W, Hou C-Y, Chang-Chien G-P, Lin S, Hsu C-N. Anti-Hypertensive Property of an NO Nanoparticle in an Adenine-Induced Chronic Kidney Disease Young Rat Model. Antioxidants. 2023; 12(2):513. https://doi.org/10.3390/antiox12020513
Chicago/Turabian StyleTain, You-Lin, Hung-Wei Yang, Chih-Yao Hou, Guo-Ping Chang-Chien, Sufan Lin, and Chien-Ning Hsu. 2023. "Anti-Hypertensive Property of an NO Nanoparticle in an Adenine-Induced Chronic Kidney Disease Young Rat Model" Antioxidants 12, no. 2: 513. https://doi.org/10.3390/antiox12020513
APA StyleTain, Y.-L., Yang, H.-W., Hou, C.-Y., Chang-Chien, G.-P., Lin, S., & Hsu, C.-N. (2023). Anti-Hypertensive Property of an NO Nanoparticle in an Adenine-Induced Chronic Kidney Disease Young Rat Model. Antioxidants, 12(2), 513. https://doi.org/10.3390/antiox12020513

