Ferrous Ion Alleviates Lipid Deposition and Inflammatory Responses Caused by a High Cottonseed Meal Diet by Modulating Hepatic Iron Transport Homeostasis and Controlling Ferroptosis in Juvenile Ctenopharyngodon idellus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Diet Preparation
2.2. Experimental Fish
2.3. Sample Collection
2.4. Analysis of Plasma and Hepatic Indicators
2.5. Oil Red O Staining of Liver Tissue
2.6. Determination of Relative Genes mRNA Expressions in the Liver
2.7. Statistical Analysis
3. Results
3.1. Plasma Biochemical Parameters
3.2. Hepatic Lipid-Metabolism-Related Indices
3.3. Expression of Iron-Transport-Related Genes in the Liver
3.4. Expression of Ferroptosis-Related Genes in the Liver
3.5. Expression of Inflammation-Related Genes in the Liver
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dani, D. A review on replacing fish meal in aqua feeds using plant protein sources. Int. J. Fish. Aquat. Stud. 2018, 6, 164–179. [Google Scholar]
- Kumar, B.P.; Ramudu, K.R.; Devi, B.C. Mini review on incorporation of cotton seed meal, an alternative to fish meal in aquaculture feeds. Int. J. Biol. Res. 2014, 22, 99–105. [Google Scholar]
- Dawood, M.A.O.; Koshio, S. Application of fermentation strategy in aquafeed for sustainable aquaculture. Rev. Aquacult. 2020, 122, 987–1002. [Google Scholar] [CrossRef]
- Lim, S.J.; Lee, K.J. Partial replacement of fish meal by cottonseed meal and soybean meal with iron and phytase supplementation for parrot fish Oplegnathus fasciatus. Aquaculture 2009, 290, 283–289. [Google Scholar] [CrossRef]
- Hardy, R.W. Worldwide fish meal production outlook and the use of alternative protein meals for aquaculture. Av. Nutr. Acuicola 2006, 410–419. [Google Scholar]
- Zhang, Y.R.; Zhang, J.M.; Ren, Y.H.; Zhang, M.D.; Liang, J.P. Lipotoxic Effects of gossypol acetate supplementation on hepatopancreas fat accumulation and fatty acid profile in Cyprinus carpio. Aquacult. Nutr. 2022, 2022, 2969246. [Google Scholar] [CrossRef]
- Chen, S.; Lin, Y.; Miao, L.; Liu, B.; Ge, X. Iron homeostasis of liver-gut axis alleviates inflammation caused by dietary cottonseed meal through dietary Fe2+ supplementation in juvenile grass carp (Ctenopharyngodon idellus). Aquaculture 2022, 561, 738647. [Google Scholar] [CrossRef]
- Fu, S.L.; Qian, K.; Liu, H.S.; Song, F.; Ye, J.M. Effects of fish meal replacement with low-gossypol cottonseed meal on the intestinal barrier of juvenile golden pompano (Trachinotus ovatus). Aquac. Res. 2022, 531, 285–299. [Google Scholar] [CrossRef]
- Zheng, Q.; Wen, X.; Han, C.; Li, H.; Xie, X. Effect of replacing soybean meal with cottonseed meal on growth, hematology, antioxidant enzymes activity and expression for juvenile grass carp, Ctenopharyngodon idellus. Fish Physiol. Biochem. 2012, 384, 1059–1069. [Google Scholar] [CrossRef]
- Baram, N.I.; Ismailov, A.I.; Ziyaev, K.L.; Rezhepov, K.Z. Biological activity of gossypol and its derivatives. Chem. Nat. Compd. 2004, 403, 199–205. [Google Scholar] [CrossRef]
- Yildirim, M.; Lim, C.; Wan, P.J.; Klesius, P.H. Growth performance and immune response of channel catfish (Ictalurus puctatus) fed diets containing graded levels of gossypol-acetic acid. Aquaculture 2003, 219, 751–768. [Google Scholar] [CrossRef]
- Chen, S.; Lin, Y.; Shi, H.; Miao, L.; Liu, B.; Ge, X. Dietary ferulic acid supplementation improved cottonseed meal-based diet utilisation by enhancing intestinal physical barrier function and liver antioxidant capacity in grass carp (Ctenopharyngodon Idellus). Front. Physiol. 2022, 13, 922037. [Google Scholar] [CrossRef] [PubMed]
- Lim, S.J.; Lee, K.J. A microbial fermentation of soybean and cottonseed meal increases antioxidant activity and gossypol detoxification in diets for Nile tilapia, Oreochromis niloticus. J. World Aquacult. Soc. 2011, 424, 494–503. [Google Scholar] [CrossRef]
- Barros, M.M.; Lim, C.; Evans, J.J.; Klesius, P.H. Effect of iron supplementation to cottonseed meal diets on the growth performance of channel catfish, Ictalurus punctatus. J. Appl. Aquacult. 2000, 10, 65–86. [Google Scholar] [CrossRef]
- Barraza Pacheco, M.L. The Use of Iron Sulfate and Feed Pelleting as Detoxifying Mechanisms for Free Gossypol in Cotton Diets for Dairy Cattle; Texas A&M University: College Station, TX, USA, 1991; p. 4652. [Google Scholar]
- El-Saidy, D.; Gaber, M.M. Use of cottonseed meal supplemented with iron for detoxification of gossypol as a total replacement of fish meal in Nile tilapia, Oreochromis niloticus (L.) diets. Aquac. Res. 2004, 359, 859–865. [Google Scholar] [CrossRef]
- Emerit, J.; Beaumont, C.; Trivin, F. Iron metabolism, free radicals, and oxidative injury. Biomed. Pharmacother. 2001, 556, 333–339. [Google Scholar] [CrossRef]
- Yu, Y.; Yan, Y.; Niu, F.L.; Wang, Y.J.; Chen, X.Y.; Su, G.D.; Liu, Y.R.; Zhao, X.L.; Qian, L.; Liu, P.; et al. Ferroptosis: A cell death connecting oxidative stress, inflammation and cardiovascular diseases. Cell Death Discov. 2021, 7, 193. [Google Scholar] [CrossRef] [PubMed]
- Zheng, J.; Conrad, M. The metabolic underpinnings of ferroptosis. Cell Metab. 2020, 326, 920–937. [Google Scholar] [CrossRef]
- Galaris, D.; Barbouti, A.; Pantopoulos, K. Iron homeostasis and oxidative stress: An intimate relationship. Bba.-Mol. Cell Res. 2019, 186612, 118535. [Google Scholar] [CrossRef]
- Yang, W.S.; Stockwell, B.R. Ferroptosis: Death by lipid peroxidation. Trends Cell Biol. 2016, 263, 165–176. [Google Scholar] [CrossRef]
- Sun, Y.H.; Xue, Z.X.; Huang, T.; Che, X.Y.; Wu, G.Z. Lipid metabolism in ferroptosis and ferroptosis-based cancer therapy. Front. Oncol. 2022, 12, 941618. [Google Scholar] [CrossRef]
- Rochette, L.; Dogon, G.; Rigal, E.; Zeller, M.; Cottin, Y.; Vergely, C. Lipid peroxidation and iron metabolism: Two corner stones in the homeostasis control of ferroptosis. Int. J. Mol. Sci. 2022, 241, 449. [Google Scholar] [CrossRef] [PubMed]
- Dixon, S.J.; Lemberg, K.M.; Lamprecht, M.R.; Skouta, R.; Zaitsev, E.M.; Gleason, C.E.; Patel, D.N.; Bauer, A.J.; Cantley, A.M.; Yang, W.S.; et al. Ferroptosis: An iron-dependent form of nonapoptotic cell death. Cell 2012, 1495, 1060–1072. [Google Scholar] [CrossRef] [PubMed]
- Koppula, P.; Zhuang, L.; Gan, B. Cystine transporter SLC7A11/xCT in cancer: Ferroptosis, nutrient dependency, and cancer therapy. Protein Cell 2021, 128, 599–620. [Google Scholar] [CrossRef] [PubMed]
- Iida, Y.; Okamoto-Katsuyama, M.; Maruoka, S.; Mizumura, K.; Shimizu, T.; Shikano, S.; Hikichi, M.; Takahashi, M.; Tsuya, K.; Okamoto, S.; et al. Effective ferroptotic small-cell lung cancer cell death from SLC7A11 inhibition by sulforaphane. Oncol. Lett. 2021, 21, 71. [Google Scholar] [CrossRef] [PubMed]
- Gao, F.; Shi, X.W.; Pei, C.; Zhao, X.L.; Zhu, L.; Zhang, J.; Li, L.; Li, C.; Kong, X.H. The role of ferroptosis in fish inflammation. Rev. Aquacult. 2023, 15, 318–332. [Google Scholar] [CrossRef]
- Liu, H.; Yan, Q.; Han, D.; Jin, J.; Zhu, X.; Yang, Y.; Xie, S. Effect of dietary inclusion of cottonseed meal on growth performance and physiological and immune responses in juvenile grass carp, Ctenopharyngodon idellus. Aquacult. Nutr. 2019, 252, 414–426. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 254, 402–408. [Google Scholar] [CrossRef]
- Wei, X.; Babu, V.S.; Lin, L.; Hu, Y.; Zhang, Y.; Liu, X.; Su, J.; Li, J.; Zhao, L.; Yuan, G. Hepcidin protects grass carp (Ctenopharyngodon idellus) against Flavobacterium columnare infection via regulating iron distribution and immune gene expression. Fish Shellfish Immun. 2018, 75, 274–283. [Google Scholar] [CrossRef]
- Yang, M.; Lu, Z.; Li, F.; Shi, F.; Qin, Z. Escherichia coli induced ferroptosis in red blood cells of grass carp (Ctenopharyngodon idella). Fish Shellfish Immun. 2021, 112, 159–167. [Google Scholar] [CrossRef]
- Xu, J.; Wu, P.; Jiang, W.-D.; Liu, Y.; Jiang, J.; Kuang, S.-Y.; Tang, L.; Tang, W.-N.; Zhang, Y.-A.; Zhou, X.-Q.; et al. Optimal dietary protein level improved growth, disease resistance, intestinal immune and physical barrier function of young grass carp (Ctenopharyngodon idella). Fish Shellfish Immun. 2016, 55, 64–87. [Google Scholar] [CrossRef] [PubMed]
- Bian, F.; Zhou, H.; He, G.; Wang, C.; Peng, H.; Pu, X.; Jiang, H.; Wang, X.; Mai, K. Effects of replacing fishmeal with different cottonseed meals on growth, feed utilization, haematological indexes, intestinal and liver morphology of juvenile turbot (Scophthalmus maximus L.). Aquacult. Nutr. 2017, 236, 1429–1439. [Google Scholar] [CrossRef]
- Jiao, H. Effect of Cotton Meal on Production Performance and Liver Lipid Metabolism of Laying Hens and the Underlying Mechanism. Ph.D. Thesis, Shandong Agricultural University, Tai’an, Shandong, 2014. [Google Scholar]
- Yu, J.; Yang, H.M.; Sun, Q.Y.; Xu, X.A.; Yang, Z.; Wang, Z.Y. Effects of cottonseed meal on performance, gossypol residue, liver function, lipid metabolism, and cecal microbiota in geese. J. Anim. Sci. 2023, 101, skad020. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.L.; Lu, Q.S.; Xi, L.W.; Gong, Y.L.; Su, J.Z.; Han, D.; Zhang, Z.M.; Liu, H.K.; Jin, J.Y.; Yang, Y.X.; et al. Effects of replacement of dietary fishmeal by cottonseed protein concentrate on growth performance, liver health, and intestinal histology of largemouth bass (Micropterus salmoides). Front. Physiol. 2021, 12, 2308. [Google Scholar] [CrossRef] [PubMed]
- Yin, B.; Liu, H.Y.; Tan, B.P.; Dong, X.H.; Chi, S.Y.; Yang, Q.H.; Zhang, S.; Chen, L.Q. Cottonseed protein concentrate (CPC) suppresses immune function in different intestinal segments of hybrid grouper female Epinephelus fuscoguttatus x male Epinephelus lanceolatu via TLR-2/MyD88 signaling pathways. Fish Shellfish Immun. 2018, 81, 318–328. [Google Scholar] [CrossRef] [PubMed]
- Osborne, T.F.; Espenshade, P.J. Evolutionary conservation and adaptation in the mechanism that regulates SREBP action: What a long, strange tRIP it’s been. Gene Dev. 2009, 2322, 2578–2591. [Google Scholar] [CrossRef] [PubMed]
- Eberle, D.; Hegarty, B.; Bossard, P.; Ferre, P.; Foufelle, F. SREBP transcription factors: Master regulators of lipid homeostasis. Biochimie 2004, 8611, 839–848. [Google Scholar] [CrossRef] [PubMed]
- Jeon, T.I.; Osborne, T.F. SREBPs: Metabolic integrators in physiology and metabolism. Trends Endocrin. Met. 2012, 232, 65–72. [Google Scholar] [CrossRef]
- Chen, M.; Xu, J.G.; Wang, Y.; Wang, Z.; Guo, L.P.; Li, X.P.; Huang, L.Q. Arctium lappa L. polysaccharide can regulate lipid metabolism in type 2 diabetic rats through the SREBP-1/SCD-1 axis. Carbohyd. Res. 2020, 494, 108055. [Google Scholar] [CrossRef]
- Fon Tacer, K.; Rozman, D. Nonalcoholic Fatty liver disease: Focus on lipoprotein and lipid deregulation. J. Lipids 2011, 2011, 783976. [Google Scholar] [CrossRef]
- McGill, M.R. The past and present of serum aminotransferases and the future of liver injury biomarkers. Excli J. 2016, 15, 817–828. [Google Scholar] [PubMed]
- Xu, Z.; Cao, J.; Qin, X.; Qiu, W.; Mei, J.; Xie, J. Toxic effects on bioaccumulation, hematological parameters, oxidative stress, immune responses and tissue structure in fish exposed to ammonia nitrogen: A Review. Animal 2021, 11, 3304. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Ou, Z.; Xie, M.; Kang, R.; Fan, Y.; Niu, X.; Wang, H.; Cao, L.; Tang, D. HSPB1 as a novel regulator of ferroptotic cancer cell death. Oncogene 2015, 3445, 5617–5625. [Google Scholar] [CrossRef] [PubMed]
- Stein, J.; Hartmann, F.; Dignass, A.U. Diagnosis and management of iron deficiency anemia in patients with IBD. Nat. Rev. Gastro. Hepat. 2010, 711, 599–610. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Jiang, W.; Xu, Y.W.; Chen, R.Y.; Xu, Q. Sequence analysis of hepcidin in barbel steed (Hemibarbus labeo): QSHLS motif confers hepcidin iron-regulatory activity but limits its antibacterial activity. Dev. Comp. Immunol. 2021, 114, 103845. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.; Gan, Z.S.; Ma, W.; Xiong, H.T.; Li, Y.Q.; Wang, Y.Z.; Du, H.H. Synthetic porcine Hepcidin exhibits different roles in Escherichia coli and Salmonella infections. Antimicrob. Agents Ch. 2017, 61, 10–1128. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.-H.; Song, C.-C.; Pantopoulos, K.; Wei, X.-L.; Zheng, H.; Luo, Z. Mitochondrial oxidative stress mediated Fe-induced ferroptosis via the NRF2-ARE pathway. Free Radic. Bio. Med. 2022, 180, 95–107. [Google Scholar] [CrossRef] [PubMed]
- Yiannikourides, A.; Latunde-Dada, G.O. A short review of iron metabolism and pathophysiology of iron disorders. Medicines 2019, 63, 85. [Google Scholar] [CrossRef]
- Chen, X.; Li, J.; Kang, R.; Klionsky, D.J.; Tang, D. Ferroptosis: Machinery and regulation. Autophagy 2021, 179, 2054–2081. [Google Scholar] [CrossRef]
- Seibt, T.M.; Proneth, B.; Conrad, M. Role of GPX4 in ferroptosis and its pharmacological implication. Free Radic. Biol. Med. 2019, 133, 144–152. [Google Scholar] [CrossRef]
- Wu, L.; Dong, B.; Chen, Q.; Wang, Y.; Han, D.; Zhu, X.; Liu, H.; Zhang, Z.; Yang, Y.; Xie, S. Effects of curcumin on oxidative stress and ferroptosis in acute ammonia stress-induced liver injury in gibel carp (Carassius gibelio). Int. J. Mol. Sci. 2023, 247, 6441. [Google Scholar] [CrossRef] [PubMed]
- Forcina, G.C.; Dixon, S.J. GPX4 at the crossroads of lipid homeostasis and ferroptosis. Proteomics 2019, 19, 1800311. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Chen, P.; Zhai, B.; Zhang, M.; Xiang, Y.; Fang, J.; Xu, S.; Gao, Y.; Chen, X.; Sui, X. The emerging role of ferroptosis in inflammation. Biomed. Pharmacother. 2020, 127, 110108. [Google Scholar] [CrossRef] [PubMed]
- Li, W.J.; Zhang, L.; Wu, H.X.; Li, M.; Wang, T.; Zhang, W.B.; Du, Z.Y.; Zhang, M.L. Intestinal microbiota mediates gossypol-induced intestinal inflammation, oxidative stress, and apoptosis in fish. J. Agric. Food. Chem. 2022, 7022, 6688–6697. [Google Scholar] [CrossRef]
- Wang, K.Z.; Feng, L.; Jiang, W.D.; Wu, P.; Liu, Y.; Jiang, J.; Kuang, S.Y.; Tang, L.; Zhang, Y.A.; Zhou, X.Q. Dietary gossypol reduced intestinal immunity and aggravated inflammation in on-growing grass carp (Ctenopharyngodon idella). Fish Shellfish Immun. 2019, 86, 814–831. [Google Scholar] [CrossRef] [PubMed]
- Hao, Q.; Zhang, C.; Gao, Y.; Wang, S.; Li, J.; Li, M.; Xue, X.; Li, W.; Zhang, W.; Zhang, Y. FOXP3 inhibits NF-κB activity and hence COX2 expression in gastric cancer cells. Cell Signal. 2014, 263, 564–569. [Google Scholar] [CrossRef]
- Marrogi, A.J.; Travis, W.D.; Welsh, J.A.; Khan, M.A.; Rahim, H.; Tazelaar, H.; Pairolero, P.; Trastek, V.; Jett, J.; Caporaso, N.E.; et al. Nitric oxide synthase, cyclooxygenase 2, and vascular endothelial growth factor in the angiogenesis of non-small cell lung carcinoma. Clin. Cancer Res. 2000, 612, 4739–4744. [Google Scholar]
- Kuwano, T.; Nakao, S.; Yamamoto, H.; Tsuneyoshi, M.; Yamamoto, T.; Kuwano, M.; Ono, M. Cyclooxygenase 2 is a key enzyme for inflammatory cytokine-induced angiogenesis. Faseb J. 2004, 182, 300–310. [Google Scholar] [CrossRef]
- Xu, T.; Cui, J.; Xu, R.; Cao, J.; Guo, M.-y. Microplastics induced inflammation and apoptosis via ferroptosis and the NF-κB pathway in carp. Aquat. Toxicol. 2023, 262, 106659. [Google Scholar] [CrossRef]






| Ingredients | Diets | |||
|---|---|---|---|---|
| LCM | HCM | HCM + 0.2%Fe2+ | HCM + 0.4%Fe2+ | |
| Fish meal 1 | 53.3 | 53.3 | 53.3 | 53.3 |
| Soybean meal 1 | 215.9 | 64.8 | 64.8 | 64.8 |
| Rapeseed meal 1 | 162.2 | 0 | 0 | 0 |
| Cottonseed meal 1 | 163.1 | 384.6 | 384.6 | 384.6 |
| Cottonseed protein concentrate 2 | 42.2 | 84.5 | 84.5 | 84.5 |
| 177.2 | 177.2 | 177.2 | 177.2 | |
| Rice bran | 120.1 | 120.1 | 120.1 | 120.1 |
| Wheat bran | 0 | 49.5 | 47.5 | 45.5 |
| Soybean oil | 20 | 20 | 20 | 20 |
| Calcium dihydrogen phosphate | 10 | 10 | 10 | 10 |
| Mineral premix 3 | 5 | 5 | 5 | 5 |
| Vitamins premix 3 | 5 | 5 | 5 | 5 |
| Vitamin C (55%) | 5 | 5 | 5 | 5 |
| Choline chloride | 5 | 5 | 5 | 5 |
| Microcrystalline cellulose | 10 | 10 | 10 | 10 |
| Bentonite | 6 | 6 | 6 | 6 |
| FeSO4·7H2O | 2 | 4 | ||
| Total | 1000 | 1000 | 1000 | 1000 |
| Nutrient contents | ||||
| Crude protein (%) | 37.14 | 39.67 | 39.62 | 39.35 |
| Crude lipid (%) | 7.45 | 7.24 | 7.30 | 7.45 |
| Ash (%) | 8.53 | 8.66 | 8.75 | 8.79 |
| Gross energy (MJ/kg) | 19.69 | 19.60 | 19.64 | 19.61 |
| Fe (mg/kg) | 740 | 700 | 1100 | 1500 |
| Free gossypol (mg/kg) | 222 | 406 | 416 | 403 |
| Genes | Primer (5′-3′) | Accession No./Reference | Product Length (bps) |
|---|---|---|---|
| tfr2 | F: AGCTGGGATGGAGGAGACTT | XM_051881185.1 | 113 |
| R: AGGATGGCCTGATCCAGACT | |||
| hepcidin | F: CAGCCGTTCCGTTCGTACA | Wei et al. (2018) [30] | 192 |
| R: AGCCTTTGTTACGACAGCAG | |||
| ferritin | F: TTGAGACACACTACTTGGACGAG | Yang et al. (2021) [31] | 191 |
| R: GGCATGTAGGGCATTAAACACTC | |||
| fpn1 | F: GACCAGTTAACCAACATTCTGGC | Yang et al. (2021) [31] | 197 |
| R: TCCTGGTCATCAGTTTCCTTCTG | |||
| acsl4b | F: CGTCTGATCTCGCAGTGGTT | XM_051895363.1 | 180 |
| R: CTGTCAGCTCCAGCACATGA | |||
| lpcat3 | F: TTACGCCGTCTCTGTTGGAG | XM_051864303.1 | 160 |
| R: CGCTTCATTGCTGGAACCAC | |||
| lox | F: TTTGCCGTCAGGTATCGGTG | XM_051908919.1 | 111 |
| R: TGCAGCTGATCCGTGTGATT | |||
| cox | F: TGTGGATGTGTTCAACCGCT | XM_051865758.1 | 197 |
| R: GCTTCCTGTTCTTGCCTGGA | |||
| gpx4a | F: TTATCCATCGCGTCTTGCTGT | XM_051907667.1 | 100 |
| R: TAAATGGATGTGGCCGTCTGC | |||
| gcl | F: ACGAATCGGACCACTTCGAG | XM_051916883.1 | 177 |
| R: TCACACGGGTGAGAAGAACG | |||
| hspbap1 | F: CGAGTGCACACCGTTACTCT | XM_051904930.1 | 141 |
| R: TACTCTGGCCTCATCGTCCA | |||
| srebp1 | F: AGAAACTGCCCATCAATCGC | XM_051886061.1 | 189 |
| R: TCCTCAACACTGCCGACTTATT | |||
| scd | F: GTTTGTGCCCTGGTTCTT | XM_051914897.1 | 154 |
| R: GGGGTTAATGGTGCTGTC | |||
| cpt | F: GCCACTGTAAAGGAGAACC | XM_051899001.1 | 272 |
| R: GGATGCCTCATAAGTCAAG | |||
| cyp7b1 | F: ACGGTACTTATTGCAGGGAG | XM_051916835.1 | 135 |
| R: TGGGTAATCGAACGTCCTGG | |||
| nfκb | F: AGTCCGATCCATCCGCACTA | XM_051918333.1 | 85 |
| R: ACTGGAGCCGGTCATTTCAG | |||
| il-1β | F: AGAGTTTGGTGAAGAAGAGG | Xu et al. (2016) [32] | 292 |
| R: TTATTGTGGTTACGCTGGA | |||
| il-10 | F: AACGAGAACGTGCAACAGAA | XM_051913375.1 | 101 |
| R: TGGACAGCTGTTGGCAGAAT | |||
| il-15 | F: TTGCCAATGGCTGAAGGTCA | XM_051909817.1 | 108 |
| R: TGGTGTGTACAAGCGTGCAT | |||
| β-actin | F: CGTGACATCAAGGAGAAG | XM_051886219.1 | 215 |
| R: GAGTTGAAGGTGGTCTCAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, H.; Chen, S.; Lin, Y.; Jiang, W.; Zhao, Y.; Lu, S.; Miao, L.; Ge, X. Ferrous Ion Alleviates Lipid Deposition and Inflammatory Responses Caused by a High Cottonseed Meal Diet by Modulating Hepatic Iron Transport Homeostasis and Controlling Ferroptosis in Juvenile Ctenopharyngodon idellus. Antioxidants 2023, 12, 1968. https://doi.org/10.3390/antiox12111968
Liu H, Chen S, Lin Y, Jiang W, Zhao Y, Lu S, Miao L, Ge X. Ferrous Ion Alleviates Lipid Deposition and Inflammatory Responses Caused by a High Cottonseed Meal Diet by Modulating Hepatic Iron Transport Homeostasis and Controlling Ferroptosis in Juvenile Ctenopharyngodon idellus. Antioxidants. 2023; 12(11):1968. https://doi.org/10.3390/antiox12111968
Chicago/Turabian StyleLiu, Hengchen, Shiyou Chen, Yan Lin, Wenqiang Jiang, Yongfeng Zhao, Siyue Lu, Linghong Miao, and Xianping Ge. 2023. "Ferrous Ion Alleviates Lipid Deposition and Inflammatory Responses Caused by a High Cottonseed Meal Diet by Modulating Hepatic Iron Transport Homeostasis and Controlling Ferroptosis in Juvenile Ctenopharyngodon idellus" Antioxidants 12, no. 11: 1968. https://doi.org/10.3390/antiox12111968
APA StyleLiu, H., Chen, S., Lin, Y., Jiang, W., Zhao, Y., Lu, S., Miao, L., & Ge, X. (2023). Ferrous Ion Alleviates Lipid Deposition and Inflammatory Responses Caused by a High Cottonseed Meal Diet by Modulating Hepatic Iron Transport Homeostasis and Controlling Ferroptosis in Juvenile Ctenopharyngodon idellus. Antioxidants, 12(11), 1968. https://doi.org/10.3390/antiox12111968

