Influence of Mild Chronic Stress and Social Isolation on Acute Ozone-Induced Alterations in Stress Biomarkers and Brain-Region-Specific Gene Expression in Male Wistar–Kyoto Rats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Experimental Manipulations (Different Stress Conditions and O3 Exposure)
2.2.1. No Stress (Control; NS)
2.2.2. Social Isolation Only (SI)
2.2.3. Unpredicted Chronic Mild Stress plus Social Isolation (CS)
2.2.4. O3 Generation and Exposure
2.3. Tissue Sample Collection and Processing
2.3.1. Serum/Plasma Biomarkers
2.3.2. Tissue Processing, RNA Isolation and Quantitative Polymerase Chain Reaction
2.3.3. Serum Metabolomics Analysis
2.4. Statistical Analysis
3. Results
3.1. Phenotype Measures of the Stress Response
3.2. Gene Expression of Stress-Related HPA Activation
3.3. Gene Expression of Glucocorticoid-Associated Chaperone Proteins
3.4. Gene Expression for Bdnf, Endocannabinoid Receptor (Cnr1) and Tyrosine Hydroxylase (Th)
3.5. Metabolomic Analysis of Rat Serum Following Air or O3 Exposure in NS and SI
4. Discussion
4.1. Preexistent Stressors and O3-Induced Brain-Region-Specific Transcriptional Response
4.2. Systemic Metabolic Impacts of SI and O3 through Neuroendocrine System
4.3. Study Limitations
4.4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Landrigan, P.J.; Fuller, R.; Acosta, N.J.R.; Adeyi, O.; Arnold, R.; Basu, N.; Baldé, A.B.; Bertollini, R.; Bose-O’Reilly, S.; Boufford, J.I.; et al. The Lancet Commission on pollution and health. Lancet 2018, 391, 462–512. [Google Scholar] [CrossRef] [PubMed]
- Hahad, O.; Lelieveld, J.; Birklein, F.; Lieb, K.; Daiber, A.; Munzel, T. Ambient Air Pollution Increases the Risk of Cerebrovascular and Neuropsychiatric Disorders through Induction of Inflammation and Oxidative Stress. Int. J. Mol. Sci. 2020, 21, 4306. [Google Scholar] [CrossRef]
- Younan, D.; Wang, X.; Casanova, R.; Barnard, R.; Gaussoin, S.A.; Saldana, S.; Petkus, A.J.; Beavers, D.P.; Resnick, S.M.; Manson, J.E.; et al. PM2.5 associated with gray matter atrophy reflecting increased Alzheimers risk in older women. Neurology 2020, 96, e1190–e1201. [Google Scholar] [CrossRef] [PubMed]
- Nunez, Y.; Boehme, A.K.; Li, M.; Goldsmith, J.; Weisskopf, M.G.; Re, D.B.; Navas-Acien, A.; van Donkelaar, A.; Martin, R.V.; Kioumourtzoglou, M.A. Parkinson’s disease aggravation in association with fine particle components in New York State. Environ. Res. 2021, 201, 111554. [Google Scholar] [CrossRef] [PubMed]
- Shi, L.; Steenland, K.; Li, H.; Liu, P.; Zhang, Y.; Lyles, R.H.; Requia, W.J.; Ilango, S.D.; Chang, H.H.; Wingo, T.; et al. A national cohort study (2000–2018) of long-term air pollution exposure and incident dementia in older adults in the United States. Nat. Commun. 2021, 12, 6754. [Google Scholar] [CrossRef] [PubMed]
- Christensen, G.M.; Li, Z.; Pearce, J.; Marcus, M.; Lah, J.J.; Waller, L.A.; Ebelt, S.; Huls, A. The complex relationship of air pollution and neighborhood socioeconomic status and their association with cognitive decline. Environ. Int. 2022, 167, 107416. [Google Scholar] [CrossRef] [PubMed]
- Petkus, A.J.; Resnick, S.M.; Wang, X.; Beavers, D.P.; Espeland, M.A.; Gatz, M.; Gruenewald, T.; Millstein, J.; Chui, H.C.; Kaufman, J.D.; et al. Ambient air pollution exposure and increasing depressive symptoms in older women: The mediating role of the prefrontal cortex and insula. Sci. Total Environ. 2022, 823, 153642. [Google Scholar] [CrossRef]
- Newbury, J.B.; Stewart, R.; Fisher, H.L.; Beevers, S.; Dajnak, D.; Broadbent, M.; Pritchard, M.; Shiode, N.; Heslin, M.; Hammoud, R.; et al. Association between air pollution exposure and mental health service use among individuals with first presentations of psychotic and mood disorders: Retrospective cohort study. Br. J. Psychiatry 2021, 219, 678–685. [Google Scholar] [CrossRef]
- Balboni, E.; Filippini, T.; Crous-Bou, M.; Guxens, M.; Erickson, L.D.; Vinceti, M. The association between air pollutants and hippocampal volume from magnetic resonance imaging: A systematic review and meta-analysis. Environ. Res. 2022, 204, 111976. [Google Scholar] [CrossRef] [PubMed]
- Hajat, A.; Hazlehurst, M.F.; Golden, S.H.; Merkin, S.S.; Seeman, T.; Szpiro, A.A.; Kaufman, J.D.; Roux, A.D. The cross-sectional and longitudinal association between air pollution and salivary cortisol: Evidence from the Multi-Ethnic Study of Atherosclerosis. Environ. Int. 2019, 131, 105062. [Google Scholar] [CrossRef]
- Clougherty, J.E.; Humphrey, J.L.; Kinnee, E.J.; Remigio, R.; Sheffield, P.E. What Is “Socioeconomic Position (SEP),” and How Might It Modify Air Pollution-Health Associations? Cohering Findings, Identifying Challenges, and Disentangling Effects of SEP and Race in US City Settings. Curr. Environ. Health Rep. 2022, 9, 355–365. [Google Scholar] [CrossRef]
- Clougherty, J.E.; Humphrey, J.L.; Kinnee, E.J.; Robinson, L.F.; McClure, L.A.; Kubzansky, L.D.; Reid, C.E. Social Susceptibility to Multiple Air Pollutants in Cardiovascular Disease. Res. Rep. Health Eff. Inst. 2021, 206, 1–71. [Google Scholar]
- Guidi, J.; Lucente, M.; Sonino, N.; Fava, G.A. Allostatic Load and Its Impact on Health: A Systematic Review. Psychother. Psychosom. 2021, 90, 11–27. [Google Scholar] [CrossRef] [PubMed]
- Levesque, S.; Taetzsch, T.; Lull, M.E.; Kodavanti, U.; Stadler, K.; Wagner, A.; Johnson, J.A.; Duke, L.; Kodavanti, P.; Surace, M.J.; et al. Diesel exhaust activates and primes microglia: Air pollution, neuroinflammation, and regulation of dopaminergic neurotoxicity. Environ. Health Perspect. 2011, 119, 1149–1155. [Google Scholar] [CrossRef] [PubMed]
- Santiago-Lopez, D.; Bautista-Martinez, J.A.; Hernandex, C.I.; Aguilar-Martinez, M.; Rivas-Arancibia, A. Oxidative stress, progressive damage in the substantia nigra and plasma dopamine oxidation, in rats chronically exposed to ozone. Toxicol. Lett. 2010, 197, 193–200. [Google Scholar] [CrossRef]
- Hernandez-Zimbron, L.F.; Rivas-Arancibia, S. Syntaxin 5 Overexpression and beta-Amyloid 1-42 Accumulation in Endoplasmic Reticulum of Hippocampal Cells in Rat Brain Induced by Ozone Exposure. Biomed. Res. Int. 2016, 2016, 2125643. [Google Scholar] [CrossRef]
- Peters, A. Ambient air pollution and Alzheimer’s disease: The role of the composition of fine particles. Proc. Natl. Acad. Sci. USA 2023, 120, e2220028120. [Google Scholar] [CrossRef]
- Patten, K.T.; Valenzuela, A.E.; Wallis, C.; Berg, E.L.; Silverman, J.L.; Bein, K.J.; Wexler, A.S.; Lein, P.J. The Effects of Chronic Exposure to Ambient Traffic-Related Air Pollution on Alzheimer’s Disease Phenotypes in Wildtype and Genetically Predisposed Male and Female Rats. Environ. Health Perspect. 2021, 129, 57005. [Google Scholar] [CrossRef]
- Kochi, C.; Salvi, A.; Atrooz, F.; Salim, S. Simulated vehicle exhaust exposure induces sex-dependent behavioral deficits in rats. Environ. Toxicol. Pharmacol. 2021, 86, 103660. [Google Scholar] [CrossRef]
- Wang, C.; Lin, J.; Niu, Y.; Wang, W.; Wen, J.; Lv, L.; Liu, C.; Du, X.; Zhang, Q.; Chen, B.; et al. Impact of ozone exposure on heart rate variability and stress hormones: A randomized-crossover study. J. Hazard Mater. 2022, 421, 126750. [Google Scholar] [CrossRef]
- Miller, J.G.; Gillette, J.S.; Kircanski, K.; LeMoult, J.; Gotlib, I.H. Air pollution is associated with elevated HPA-Axis response to stress in anxious adolescent girls. Compr. Psychoneuroendocrinol. 2020, 4, 100015. [Google Scholar] [CrossRef] [PubMed]
- Snow, S.J.; Henriquez, A.R.; Costa, D.L.; Kodavanti, U.P. Neuroendocrine Regulation of Air Pollution Health Effects: Emerging Insights. Toxicol. Sci. 2018, 164, 9–20. [Google Scholar] [CrossRef] [PubMed]
- Herman, J.P. The neuroendocrinology of stress: Glucocorticoid signaling mechanisms. Psychoneuroendocrinology 2022, 137, 105641. [Google Scholar] [CrossRef] [PubMed]
- McEwen, B.S. Neurobiological and Systemic Effects of Chronic Stress. Chronic Stress 2017, 1, 2470547017692328. [Google Scholar] [CrossRef]
- Gackiere, F.; Saliba, L.; Baude, A.; Bosler, O.; Strube, C. Ozone inhalation activates stress-responsive regions of the CNS. J. Neurochem. 2011, 117, 961–972. [Google Scholar] [CrossRef]
- Kodavanti, U.P. Stretching the stress boundary: Linking air pollution health effects to a neurohormonal stress response. Biochim. Biophys. Acta 2016, 1860, 2880–2890. [Google Scholar] [CrossRef]
- Miller, D.B.; Snow, S.J.; Schladweiler, M.C.; Richards, J.E.; Ghio, A.J.; Ledbetter, A.D.; Kodavanti, U.P. Acute Ozone-Induced Pulmonary and Systemic Metabolic Effects Are Diminished in Adrenalectomized Rats. Toxicol. Sci. 2016, 150, 312–322. [Google Scholar] [CrossRef]
- Bello-Medina, P.C.; Rodríguez-Martínez, E.; Prado-Alcalá, R.A.; Rivas-Arancibia, S. Ozone pollution, oxidative stress, synaptic plasticity, and neurodegeneration. Neurologia 2022, 37, 277–286. [Google Scholar] [CrossRef]
- Rivas-Arancibia, S.; Hernández-Orozco, E.; Rodríguez-Martínez, E.; Valdés-Fuentes, M.; Cornejo-Trejo, V.; Pérez-Pacheco, N.; Dorado-Martínez, C.; Zequeida-Carmona, D.; Espinosa-Caleti, I. Ozone Pollution, Oxidative Stress, Regulatory T Cells and Antioxidants. Antioxidants 2022, 11, 1553. [Google Scholar] [CrossRef]
- Kodavanti, P.R.S.; Valdez, M.; Richards, J.E.; Agina-Obu, D.I.; Phillips, P.M.; Jarema, K.A.; Kodavanti, U.P. Ozone-induced changes in oxidative stress parameters in brain regions of adult, middle-age, and senescent Brown Norway rats. Toxicol. Appl. Pharmacol. 2021, 410, 115351. [Google Scholar] [CrossRef]
- McAuley, J.D.; Stewart, A.L.; Webber, E.S.; Cromwell, H.C.; Servatius, R.J.; Pang, K.C. Wistar-Kyoto rats as an animal model of anxiety vulnerability: Support for a hypervigilance hypothesis. Behav. Brain Res. 2009, 204, 162–168. [Google Scholar] [CrossRef] [PubMed]
- Servatius, R.J.; Jiao, X.; Beck, K.D.; Pang, K.C.; Minor, T.R. Rapid avoidance acquisition in Wistar-Kyoto rats. Behav. Brain Res. 2008, 192, 191–197. [Google Scholar] [CrossRef] [PubMed]
- Pardon, M.C.; Gould, G.G.; Garcia, A.; Phillips, L.; Cook, M.C.; Miller, S.A.; Mason, P.A.; Morilak, D.A. Stress reactivity of the brain noradrenergic system in three rat strains differing in their neuroendocrine and behavioral responses to stress: Implications for susceptibility to stress-related neuropsychiatric disorders. Neuroscience 2002, 115, 229–242. [Google Scholar] [CrossRef] [PubMed]
- Henriquez, A.R.; Snow, S.J.; Jackson, T.W.; House, J.S.; Alewel, D.I.; Schladweiler, M.C.; Valdez, M.C.; Freeborn, D.L.; Miller, C.N.; Grindstaff, R.; et al. Social isolation exacerbates acute ozone inhalation induced pulmonary and systemic health outcomes. Toxicol. Appl. Pharmacol. 2022, 457, 116295. [Google Scholar] [CrossRef] [PubMed]
- Lebow, M.A.; Chen, A. Overshadowed by the amygdala: The bed nucleus of the stria terminalis emerges as key to psychiatric disorders. Mol. Psychiatry 2016, 21, 450–463. [Google Scholar] [CrossRef]
- National Research Council. Guide for the Care and Use of Laboratory Animals, 8th ed.; The National Academies Press: Washington, DC, USA, 2011; p. 246. [Google Scholar] [CrossRef]
- Will, C.C.; Aird, F.; Redei, E.E. Selectively bred Wistar-Kyoto rats: An animal model of depression and hyper-responsiveness to antidepressants. Mol. Psychiatry 2003, 8, 925–932. [Google Scholar] [CrossRef]
- Perdigones, B.C.; Lee, S.; Cohen, R.C.; Park, J.H.; Min, K.E. Two Decades of Changes in Summertime Ozone Production in California’s South Coast Air Basin. Environ. Sci. Technol. 2022, 56, 10586–10595. [Google Scholar] [CrossRef]
- Hatch, G.E.; Slade, R.; Harris, L.P.; McDonnell, W.F.; Devlin, R.B.; Koren, H.S.; Costa, D.L.; McKee, J. Ozone dose and effect in humans and rats. A comparison using oxygen-18 labeling and bronchoalveolar lavage. Am. J. Respir. Crit. Care Med. 1994, 150, 676–683. [Google Scholar] [CrossRef]
- Calderon-Garciduenas, L.; Mora-Tiscareno, A.; Chung, C.J.; Valencia, G.; Fordham, L.A.; Garcia, R.; Osnaya, N.; Romero, L.; Acuna, H.; Villarreal-Calderon, A.; et al. Exposure to air pollution is associated with lung hyperinflation in healthy children and adolescents in Southwest Mexico City: A pilot study. Inhal. Toxicol. 2000, 12, 537–561. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Jackson, T.; House, J.S.; Henriquez, A.R.; Schladweller, M.C.; Jackson, K.M.P.; Fisher, A.A.; Snow, S.J.; Alewel, D.I.; Motsinger-Reif, A.; Kodavanti, U.P. Multi-tissue transcriptomic and serum metabolomic assessment reveals systemic implications of acute ozone-induced stress response in male Wistar Kyoto rats. Metabolomics 2023, 19, 81. [Google Scholar] [CrossRef] [PubMed]
- RStudio. RStudio: Integrated Development Environment for R; RStudio, Inc.: Boston, MA, USA, 2015. [Google Scholar]
- Wickham, H.; François, R.; Henry, L.; Müller, K. dplyr: A Grammar of Data Manipulation. 2018; 0.7.6. Available online: https://CRAN.R-766project.org/package=dplyr (accessed on 31 January 2023).
- Lenth, R.; Singmann, H.; Love, J.; Buerkner, P.; Herve, M. emmeans: Estimated Marginal Means, aka Least-Squares Means. 2019. 768. Available online: https://github.com/rvlenth/emmeans (accessed on 31 January 2023).
- Wickham, H. ggplot2: Elegant Graphics for Data Analysis; Springer: New York, NY, USA, 2016; Available online: https://ggplot2.tidyverse.org (accessed on 31 January 2023).
- Wilke, C.O. Cowplot: Streamlined Plot Theme and Plot Annotations for ‘ggplot2’. 2019. Available online: https://wilkelab.org/cowplot (accessed on 31 January 2023).
- Miller, D.B.; Karoly, E.D.; Jones, J.C.; Ward, W.O.; Vallanat, B.D.; Andrews, D.L.; Schladweiler, M.C.; Snow, S.J.; Bass, V.L.; Richards, J.E.; et al. Inhaled ozone (O3)-induces changes in serum metabolomic and liver transcriptomic profiles in rats. Toxicol Appl. Pharmacol. 2015, 286, 65–79. [Google Scholar] [CrossRef] [PubMed]
- Henriquez, A.R.; Snow, S.J.; Jackson, T.W.; House, J.S.; Motsinger-Reif, A.A.; Ward-Caviness, C.K.; Schladweiler, M.C.; Alewel, D.I.; Miller, C.N.; Farraj, A.K.; et al. Stress Drivers of Glucose Dynamics during Ozone Exposure Measured Using Radiotelemetry in Rats. Environ. Health Perspect. 2022, 130, 127006. [Google Scholar] [CrossRef]
- Hausl, A.S.; Brix, L.M.; Hartmann, J.; Pohlmann, M.L.; Lopez, J.P.; Menegaz, D.; Brivio, E.; Engelhardt, C.; Roeh, S.; Bajaj, T.; et al. The co-chaperone Fkbp5 shapes the acute stress response in the paraventricular nucleus of the hypothalamus of male mice. Mol. Psychiatry 2021, 26, 3060–3076. [Google Scholar] [CrossRef] [PubMed]
- Lee, R.S.; Tamashiro, K.L.; Yang, X.; Purcell, R.H.; Harvey, A.; Willour, V.L.; Huo, Y.; Rongione, M.; Wand, G.S.; Potash, J.B. Chronic corticosterone exposure increases expression and decreases deoxyribonucleic acid methylation of Fkbp5 in mice. Endocrinology 2010, 151, 4332–4343. [Google Scholar] [CrossRef]
- Timmusk, T.; Palm, K.; Metsis, M.; Reintam, T.; Paalme, V.; Saarma, M.; Persson, H. Multiple promoters direct tissue-specific expression of the rat BDNF gene. Neuron 1993, 10, 475–489. [Google Scholar] [CrossRef]
- Hofer, M.; Pagliusi, S.R.; Hohn, A.; Leibrock, J.; Barde, Y.A. Regional distribution of brain-derived neurotrophic factor mRNA in the adult mouse brain. EMBO J. 1990, 9, 2459–2464. [Google Scholar] [CrossRef]
- Snow, S.J.; Broniowska, K.; Karoly, E.D.; Henriquez, A.R.; Phillips, P.M.; Ledbetter, A.D.; Schladweiler, M.C.; Miller, C.N.; Gordon, C.J.; Kodavanti, U.P. Offspring susceptibility to metabolic alterations due to maternal high-fat diet and the impact of inhaled ozone used as a stressor. Sci. Rep. 2020, 10, 16353. [Google Scholar] [CrossRef]
- Henriquez, A.R.; Snow, S.J.; Schladweiler, M.C.; Miller, C.N.; Dye, J.A.; Ledbetter, A.D.; Richards, J.E.; Hargrove, M.M.; Williams, W.C.; Kodavanti, U.P. Beta-2 Adrenergic and Glucocorticoid Receptor Agonists Modulate Ozone-Induced Pulmonary Protein Leakage and Inflammation in Healthy and Adrenalectomized Rats. Toxicol. Sci. 2018, 166, 288–305. [Google Scholar] [CrossRef]
- Henriquez, A.R.; Snow, S.J.; Dye, J.A.; Schladweiler, M.C.; Alewel, D.I.; Miller, C.N.; Kodavanti, U.P. The contribution of the neuroendocrine system to adaption after repeated daily ozone exposure in rats. Toxicol. Appl. Pharmacol. 2022, 447, 116085. [Google Scholar] [CrossRef]
- Colmers, P.L.W.; Bains, J.S. Balancing tonic and phasic inhibition in hypothalamic corticotropin-releasing hormone neurons. J. Physiol. 2018, 596, 1919–1929. [Google Scholar] [CrossRef] [PubMed]
- Weiser, M.; Goel, N.; Sandau, U.S.; Bale, T.L.; Handa, R.J. Androgen regulation of corticotropin-releasing hormone receptor 2 (CRHR2) mRNA expression and receptor binding in the rat brain. Exp. Neurol. 2008, 214, 62–68. [Google Scholar] [CrossRef] [PubMed]
- Garcia, I.; Quast, K.B.; Huang, L.; Herman, A.M.; Selever, J.; Deussing, J.M.; Justice, N.J.; Arenkiel, B.R. Local CRH signaling promotes synaptogenesis and circuit integration of adult-born neurons. Dev. Cell. 2014, 30, 645–659. [Google Scholar] [CrossRef] [PubMed]
- Muttray, A.; Gosepath, J.; Schmall, F.; Brieger, J.; Mayer-Popken, O.; Melia, M.; Letzel, S. An acute exposure to ozone impairs human olfactory functioning. Environ. Res. 2018, 167, 42–50. [Google Scholar] [CrossRef]
- Joëls, M.; Sarabdjitsingh, R.A.; Karst, H. Unraveling the time domains of corticosteroid hormone influences on brain activity: Rapid, slow, and chronic modes. Pharmacol. Rev. 2012, 64, 901–938. [Google Scholar] [CrossRef]
- Alt, S.R.; Turner, J.D.; Klok, M.D.; Meijer, O.C.; Lakke, E.A.; Derijk, R.H.; Muller, C.P. Differential expression of glucocorticoid receptor transcripts in major depressive disorder is not epigenetically programmed. Psychoneuroendocrinology 2010, 35, 544–556. [Google Scholar] [CrossRef]
- Fries, G.R.; Gassen, N.C.; Schmidt, U.; Rein, T. The FKBP51-Glucocorticoid Receptor Balance in Stress-Related Mental Disorders. Curr. Mol. Pharmacol. 2015, 9, 126–140. [Google Scholar] [CrossRef]
- Zannas, A.S.; Binder, E.B. Gene-environment interactions at the FKBP5 locus: Sensitive periods, mechanisms and pleiotropism. Genes Brain Behav. 2014, 13, 25–37. [Google Scholar] [CrossRef]
- Miranda, M.; Morici, J.F.; Zanoni, M.B.; Bekinschtein, P. Brain-Derived Neurotrophic Factor: A Key Molecule for Memory in the Healthy and the Pathological Brain. Front. Cell Neurosci. 2019, 13, 363. [Google Scholar] [CrossRef]
- Murakami, S.; Imbe, H.; Morikawa, Y.; Kubo, C.; Senba, E. Chronic stress, as well as acute stress, reduces BDNF mRNA expression in the rat hippocampus but less robustly. Neurosci. Res. 2005, 53, 129–139. [Google Scholar] [CrossRef]
- Berry, A.; Bellisario, V.; Capoccia, S.; Tirassa, P.; Calza, A.; Alleva, E.; Cirulli, F. Social deprivation stress is a triggering factor for the emergence of anxiety- and depression-like behaviours and leads to reduced brain BDNF levels in C57BL/6J mice. Psychoneuroendocrinology 2012, 37, 762–772. [Google Scholar] [CrossRef] [PubMed]
- Domitrovic Spudic, S.; Nikolac Perkovic, M.; Uzun, S.; Nedic Erjavec, G.; Kozumplik, O.; Svob Strac, D.; Mimica, N.; Pivac, N. Reduced plasma BDNF concentration and cognitive decline in veterans with PTSD. Psychiatry Res. 2022, 316, 114772. [Google Scholar] [CrossRef] [PubMed]
- Taliaz, D.; Loya, A.; Gersner, R.; Haramati, S.; Chen, A.; Zangen, A. Resilience to chronic stress is mediated by hippocampal brain-derived neurotrophic factor. J. Neurosci. 2011, 31, 4475–4483. [Google Scholar] [CrossRef] [PubMed]
- Fukuchi, M.; Fujii, H.; Takachi, H.; Ichinose, H.; Kuwana, Y.; Tabuchi, A.; Tsuda, M. Activation of tyrosine hydroxylase (TH) gene transcription induced by brain-derived neurotrophic factor (BDNF) and its selective inhibition through Ca2+ signals evoked via the N-methyl-D-aspartate (NMDA) receptor. Brain Res. 2010, 1366, 18–26. [Google Scholar] [CrossRef]
- Lee, B.; Sur, B.; Park, J.; Kim, S.H.; Kwon, S.; Yeom, M.; Shim, I.; Lee, H.; Hahm, D.H. Chronic administration of baicalein decreases depression-like behavior induced by repeated restraint stress in rats. Korean J. Physiol. Pharmacol. 2013, 17, 393–403. [Google Scholar] [CrossRef]
- Bharani, K.L.; Rebecca, D.; Granholm, A.C.; Ledreux, A. A noradrenergic lesion aggravates the effects of systemic inflammation on the hippocampus of aged rats. PLoS ONE 2017, 19, e0189821. [Google Scholar] [CrossRef]
- McGuinness, O.P.; Shau, V.; Benson, E.M.; Lewis, M.; Snowden, R.T.; Greene, J.F.; Neal, D.W.; Cherrington, A.D. Role of epinephrine and norepinephrine in the metabolic response to stress hormone infusion in the conscious dog. Am. J. Physiol. Endocrinol. Metab. 1997, 273, E364–E681. [Google Scholar] [CrossRef]
- Gulbins, A.; Schumacher, F.; Becker, K.A.; Wilker, B.; Soddemann, M.; Boldrin, F.; Müller, C.P.; Edwards, M.J.; Goodman, M.; Caldwell, C.C.; et al. Antidepressants act by inducing autophagy controlled by sphingomyelin-ceramide. Mol. Psychiatry 2018, 23, 2324–2346. [Google Scholar] [CrossRef]
- Shen, Y.H.; Pham, A.K.; Davis, B.; Smiley-Jewell, S.; Wang, L.; Kodavanti, U.P.; Takeuchi, M.; Tancredi, D.J.; Pinkerton, K.E. Sex and strain-based inflammatory response to repeated tobacco smoke exposure in spontaneously hypertensive and Wistar Kyoto rats. Inhal. Toxicol. 2016, 28, 677–685. [Google Scholar] [CrossRef]
- de Kloet, E.R.; Joels, M. The cortisol switch between vulnerability and resilience. Mol. Psychiatry, 2023; online ahead of print. [Google Scholar] [CrossRef]
Stressor | Description |
---|---|
Restraint | Rats are placed in size-appropriate nose-only inhalation exposure tubes that are arranged on a rack for 1 h. To ensure the rat is immobilized and unable to turn around in the tube, foam pieces are added to decrease the length of the tube where needed. |
Tilted cage | Rats (1/cage) are placed in cages tilted at 45° for 1 h. The cages have a wire mesh bottom for added grip but are without bedding, food or water. |
Shaking | Rats are placed in cages with dividers that separate the cages into 4 equal quadrants (1 rat/quadrant). Three cages are placed on a modified orbital plate shaker set at 100 rpm for 1 h. |
Noise | Intermittent white noise of 85 dB is broadcast from speakers located above each individual cage. A timer is set to vary on–off times of the noise, from 5 to 25 min with 5 to 45 min between noise bursts for a total of 6 h. |
Predator odor | Rats are exposed to a predator odor (2,5-dihydro-2,4,5-trimethylthiazoline, a chemical isolated from fox urine, which is extensively used for triggering defensive behaviors in rodents) for 1 h. Since this chemical is volatile, a small amount is placed on gauze pads in an open Petri dish placed in the middle of the animal room. The room is maintained at negative pressure to avoid spreading of odor in other areas. |
Gene Symbol | Accession Number | Forward Primer Sequence | Forward Tm | Reverse Primer Sequence | Reverse Tm | Product Length | Efficiency |
---|---|---|---|---|---|---|---|
Actb | NM_031144.3 | GTGTGGATTGGTGGCTCTATC | 58.43 | AACGCAGCTCAGTAACAGTC | 58.22 | 137 | 96.184 |
* Gapdh | NM_017008.4 | ACTCCCATTCTTCCACCTTTG | 57.84 | GTCCAGGGTTTCTTACTCCTTG | 58.32 | 155 | 109.310 |
* Rpl13A | XM_017589309.1 | TACTCTGGAGGAGAAACGGAAG | 58.91 | ACCTACAGGAGCAGTGACTAAG | 58.91 | 257 | 96.689 |
Fkbp4 | NM_001191863.1 | TCATCAAGAGAGAGGGTACAGG | 58.36 | TGGTTGCCACAGCAATATCC | 58.53 | 183 | 103.394 |
Fkbp5 | NM_001012174 | CACCAGTAACAATGAAGAAAACCC | 58.47 | CCTCACTAGTCCCCACTCTT | 57.76 | 116 | 108.288 |
Hsp90aa1 | NM_175761.2 | AAACAGCACTCCTGTCTTCC | 57.74 | GCCTAGTCTACTTCTTCCATGC | 58.28 | 199 | 103.447 |
Hspa4 | NM_153629.1 | ACCACCTCAAGCAAAGAAGG | 58.01 | CCGTTCCTTCTCCAGTTTATCC | 58.47 | 154 | 97.097 |
nr3c1 | NM_012576.2 | CCTTTGTTCTAAGCTAGGGAAGG | 58.48 | GTGGATGAGGATGGTTAGAATGG | 58.61 | 127 | 96.072 |
nr3c2 | NM_013131.1 | GGCAAATCTCAACAACTCAAGG | 58.09 | TGAAGTGGCATAGCTGAAGG | 57.59 | 142 | 105.798 |
Th | NM_012740 | TCGGGCTATGTAAACAGAATGG | 58.20 | CTGGTAGGTTTGATCTTGGTAGG | 58.23 | 158 | 96.901 |
Bdnf | NM_001270630.1 | GGTCGATTAGGTGGCTTCATAG | 58.35 | CGGAAACAGAACGAACAGAAAC | 58.40 | 160 | 98.044 |
Crhr1 | NM_030999 | GGTATACACTGACTACATCTACCAG | 57.80 | CAGCCTTCCTGTACTGAATGG | 58.36 | 143 | 100.945 |
Crhr2 | NM_022714 | CAGATTGTGTTCATCTACTTCAACTC | 58.26 | GTGCCACCGCTTTCTCA | 57.46 | 117 | 106.529 |
Cnr1 | NM_012784.5 | GGCATCAGGGTTATCTACTTCC | 57.99 | ACAGCTTTGGAGACATCTGG | 57.51 | 263 | 106.874 |
ANOVA Global | Two-Way ANOVA Contrasts | ||||||
---|---|---|---|---|---|---|---|
SI | O3 | Interaction | NH | SI | SI:NH | ||
Pathway | O3:Air | O3:Air | Air:Air | O3:O3 | |||
Glycerolipid Metabolism | |||||||
glycerol | - | Y | - | 1.37 (↑) | 1.53 (↑) | 0.85 | 0.94 |
glycerophosphoglycerol | - | Y | - | 1.27 (↑) | 1.62 (↑) | 0.81 | 1.03 |
Monoacylglycerols | |||||||
1-oleoylglycerol (18:1) | - | Y | - | 1.26 | 1.76 (↑) | 0.70 | 0.97 |
1-linoleoylglycerol (18:2) | - | Y | - | 1.70 (↑) | 1.69 (↑) | 0.87 | 0.86 |
1-linolenoylglycerol (18:3) | - | Y | - | 2.03 (↑) | 1.75 (↑) | 0.84 | 0.72 |
Diacylglycerols | |||||||
palmitoyl-oleoyl-glycerol (16:0/18:1) | Y | Y | - | 1.57 (↑) | 1.64 (↑) | 0.80 | 0.84 |
palmitoyl-linoleoyl-glycerol (16:0/18:2) | Y | Y | - | 1.56 (↑) | 1.63 (↑) | 0.76 (↓) | 0.79 (↓) |
palmitoyl-arachidonoyl-glycerol (16:0/20:4) | - | Y | - | 2.04 (↑) | 2.61 (↑) | 0.81 | 1.04 |
linoleoyl-linoleoyl-glycerol (18:2/18:2) | Y | Y | - | 1.45 (↑) | 1.23 | 0.74 (↓) | 0.63 (↓) |
Sphingomyelins (SPs) | |||||||
palmitoyl sphingomyelin (d18:1/16:0) | Y | Y | - | 1.11 (↑) | 1.13 (↑) | 1.07 | 1.09 (↑) |
stearoyl sphingomyelin (d18:1/18:0) | Y | Y | - | 1.14 (↑) | 1.14 (↑) | 1.15 (↑) | 1.15 (↑) |
behenoyl sphingomyelin (d18:1/22:0) | Y | Y | - | 1.24 (↑) | 1.18 (↑) | 1.17 (↑) | 1.11 (↑) |
tricosanoyl sphingomyelin (d18:1/23:0) | Y | Y | - | 1.25 (↑) | 1.15 (↑) | 1.15 (↑) | 1.06 |
lignoceroyl sphingomyelin (d18:1/24:0) | Y | Y | - | 1.24 (↑) | 1.22 (↑) | 1.11 (↑) | 1.09 (↑) |
SP (d18:2/18:1) | Y | Y | - | 1.71 (↑) | 1.45 (↑) | 1.33 (↑) | 1.13 |
SP (d18:2/23:1) | Y | Y | - | 1.14 (↑) | 1.12 | 1.14 (↑) | 1.12 |
SP (d18:2/24:2) | Y | Y | - | 1.15 (↑) | 1.09 | 1.13 (↑) | 1.07 |
SP (d18:1/14:0, d16:1/16:0) | Y | Y | - | 1.13 (↑) | 1.16 (↑) | 1.13 (↑) | 1.16 (↑) |
SP (d18:1/19:0, d19:1/18:0) | Y | Y | - | 1.50 (↑) | 1.43 (↑) | 1.23 (↑) | 1.18 (↑) |
SP (d18:1/20:0, d16:1/22:0) | Y | Y | - | 1.28 (↑) | 1.25 (↑) | 1.16 (↑) | 1.13 (↑) |
SP (d18:1/20:1, d18:2/20:0) | Y | Y | - | 1.15 (↑) | 1.17 (↑) | 1.17 (↑) | 1.19 (↑) |
SP (d18:1/20:2, d18:2/20:1, d16:1/22:2) | Y | Y | - | 2.35 (↑) | 2.40 (↑) | 1.58 | 1.61 (↑) |
Fatty Acid Metabolism, Dicarboxylate | |||||||
3-hydroxyadipate | Y | Y | Y | 2.52 (↑) | 1.44 (↑) | 0.98 | 0.56 (↓) |
pimelate (C7-DC) | - | - | Y | 1.43 (↑) | 0.90 | 1.09 | 0.69 (↓) |
tetradecanedioate (C14-DC) | Y | Y | Y | 1.49 (↑) | 1.13 | 0.99 | 0.75 (↓) |
Fatty Acid Metabolism, Acylcarnitine | |||||||
oleoylcarnitine (C18:1) | Y | Y | Y | 1.45 (↑) | 1.23 (↑) | 0.97 | 0.83 (↓) |
(R)-3-hydroxybutyrylcarnitine | - | Y | Y | 2.51 (↑) | 1.67 (↑) | 1.18 | 0.79 (↓) |
(S)-3-hydroxybutyrylcarnitine | - | Y | Y | 1.29 (↑) | 1.04 | 1.06 | 0.85 (↓) |
Mevalonate Metabolism | |||||||
3-hydroxy-3-methylglutarate | Y | Y | Y | 1.34 (↑) | 1.03 | 0.97 | 0.75 (↓) |
mevalonolactone | Y | - | Y | 1.29 | 0.69 | 0.87 | 0.46 (↓) |
Lipid Metabolism | |||||||
nicotinamide | - | Y | Y | 1.87 (↑) | 1.31 (↑) | 1.06 | 0.74 (↓) |
carnitine | - | Y | Y | 0.77 (↓) | 0.88 (↓) | 0.99 | 1.13 |
3-hydroxybutyrate (BHBA) | Y | Y | - | 1.38 (↑) | 1.16 | 0.97 | 0.82 (↓) |
4-hydroxybutyrate (GHB) | Y | Y | Y | 1.59 (↑) | 1.10 | 1.03 | 0.72 (↓) |
Serum/Brain Region | Marker | CS Effect in Air | SI Effect in Air | O3 Effect in NS | O3 Effect in CS | O3 Effect in SI |
---|---|---|---|---|---|---|
Serum | Epinephrine | - | - | ↑ | ↑ | ↑ |
Nor-epinephrine | - | - | - | - | - | |
ACTH | - | - | - | - | - | |
Corticosterone | - | - | ↑ | ↑ | ↑ | |
Lymphocytes | - | - | ↓ | ↓ | ↓ | |
BDNF | ↓ | ↓ | - | ↓ | ↓ | |
BNST | Fkbp4 | - | - | - | - | - |
Fkbp5 | - | - | ↑ | ↑ | ↑ | |
Hsp90aa1 | - | - | - | - | ↑ | |
Hspa4 | - | - | - | - | - | |
Nr3c1 | - | - | ↓ | - | ↓ | |
Nr3c2 | ↓ | - | - | ↓ | - | |
Th | - | - | - | - | ↓ | |
Bdnf | - | - | - | - | - | |
Crhr1 | - | - | - | - | - | |
Crhr2 | - | - | - | - | - | |
Cnr1 | ↓ | - | - | - | ↓ | |
Hippocampus | Fkbp4 | - | - | ↓ | ↓ | - |
Fkbp5 | - | - | ↑ | ↑ | ↑ | |
Hsp90aa1 | - | ↑ | - | - | - | |
Hspa4 | - | - | - | - | - | |
Nr3c1 | - | - | ↓ | ↓ | ↓ | |
Nr3c2 | - | - | ↓ | ↓ | ↓ | |
Th | - | - | ↑ | ↑ | ↑ | |
Bdnf | - | - | ↓ | ↓ | ↓ | |
Crhr1 | - | - | - | - | - | |
Crhr2 | - | - | - | - | - | |
Cnr1 | - | - | - | - | - | |
Hypothalamus | Fkbp4 | - | - | ↓ | - | - |
Fkbp5 | - | - | ↑ | ↑ | ↑ | |
Hsp90aa1 | - | ↓ | - | - | ↑ | |
Hspa4 | - | ↓ | - | - | - | |
Nr3c1 | - | ↓ | ↓ | ↓ | ↓ | |
Nr3c2 | - | ↓ | - | ↓ | ↓ | |
Th | - | - | - | - | - | |
Bdnf | - | - | - | - | - | |
Crhr1 | - | - | - | - | - | |
Crhr2 | - | - | ↑ | - | ↑ | |
Cnr1 | - | - | - | - | - | |
Olfactory bulb | Fkbp4 | - | - | - | - | - |
Fkbp5 | - | - | ↑ | ↑ | ↑ | |
Hsp90aa1 | - | - | - | - | - | |
Hspa4 | - | - | ↓ | ↓ | ↓ | |
Nr3c1 | - | - | ↓ | ↓ | ↓ | |
Nr3c2 | - | - | - | ↓ | - | |
Th | - | - | - | - | - | |
Bdnf | - | - | - | - | ↓ | |
Crhr1 | - | - | - | - | - | |
Crhr2 | - | - | ↑ | - | ↑ | |
Cnr1 | - | - | ↓ | - | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Valdez, M.C.; Freeborn, D.L.; Valdez, J.M.; Henriquez, A.R.; Snow, S.J.; Jackson, T.W.; Kodavanti, P.R.S.; Kodavanti, U.P. Influence of Mild Chronic Stress and Social Isolation on Acute Ozone-Induced Alterations in Stress Biomarkers and Brain-Region-Specific Gene Expression in Male Wistar–Kyoto Rats. Antioxidants 2023, 12, 1964. https://doi.org/10.3390/antiox12111964
Valdez MC, Freeborn DL, Valdez JM, Henriquez AR, Snow SJ, Jackson TW, Kodavanti PRS, Kodavanti UP. Influence of Mild Chronic Stress and Social Isolation on Acute Ozone-Induced Alterations in Stress Biomarkers and Brain-Region-Specific Gene Expression in Male Wistar–Kyoto Rats. Antioxidants. 2023; 12(11):1964. https://doi.org/10.3390/antiox12111964
Chicago/Turabian StyleValdez, Matthew C., Danielle L. Freeborn, Joseph M. Valdez, Andres R. Henriquez, Samantha J. Snow, Thomas W. Jackson, Prasada Rao S. Kodavanti, and Urmila P. Kodavanti. 2023. "Influence of Mild Chronic Stress and Social Isolation on Acute Ozone-Induced Alterations in Stress Biomarkers and Brain-Region-Specific Gene Expression in Male Wistar–Kyoto Rats" Antioxidants 12, no. 11: 1964. https://doi.org/10.3390/antiox12111964