A Novel Class of Potent Anti-Tyrosinase Compounds with Antioxidant Activity, 2-(Substituted phenyl)-5-(trifluoromethyl)benzo[d]thiazoles: In Vitro and In Silico Insights
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Chemistry
2.2.1. General Methods
2.2.2. General Synthetic Procedure for Compounds 1a–1l
2.2.3. Synthetic Procedure for Compound 1m
2.2.4. Synthetic Procedure for Compound 1n
2.2.5. Synthetic Procedure for Compound 1o
2.2.6. Synthetic Procedure for Compound 1p
2.2.7. Characterization of compounds 1c–1p
4-(5-(Trifluoromethyl)benzo[d]thiazol-2-yl)phenol (1a)
4-(5-(Trifluoromethyl)benzo[d]thiazol-2-yl)benzene-1,3-diol (1b)
4-(5-(Trifluoromethyl)benzo[d]thiazol-2-yl)benzene-1,2-diol (1c)
2-Methoxy-4-(5-(trifluoromethyl)benzo[d]thiazol-2-yl)phenol (1d)
2-Ethoxy-4-(5-(trifluoromethyl)benzo[d]thiazol-2-yl)phenol (1e)
2-Methoxy-5-(5-(trifluoromethyl)benzo[d]thiazol-2-yl)phenol (1f)
2-(5-(Trifluoromethyl)benzo[d]thiazol-2-yl)phenol (1g)
2-(4-Methoxyphenyl)-5-(trifluoromethyl)benzo[d]thiazole (1h)
2-(2,4-Dimethoxyphenyl)-5-(trifluoromethyl)benzo[d]thiazole (1i)
2-(3,4-Dimethoxyphenyl)-5-(trifluoromethyl)benzo[d]thiazole (1j)
5-(Trifluoromethyl)-2-(3,4,5-trimethoxyphenyl)benzo[d]thiazole (1k)
2,6-Dimethoxy-4-(5-(trifluoromethyl)benzo[d]thiazol-2-yl)phenol (1l)
2,6-Dimethyl-4-(5-(trifluoromethyl)benzo[d]thiazol-2-yl)phenol (1m)
5-(5-(Trifluoromethyl)benzo[d]thiazol-2-yl)benzene-1,3-diol (1n)
2,6-Dibromo-4-(5-(trifluoromethyl)benzo[d]thiazol-2-yl)phenol (1o)
2-Bromo-4-(5-(trifluoromethyl)benzo[d]thiazol-2-yl)phenol (1p)
2.2.8. Synthetic Procedure for Compound m
4-Hydroxy-3,5-dimethylbenzaldehyde (m)
2.3. Tyrosinase Inhibition—Kinetic, In Silico, and In Vitro Studies
2.3.1. Mushroom Tyrosinase Inhibition Assay
2.3.2. Kinetic Studies on the Inhibition of Mushroom Tyrosinase by Compound 1b
2.3.3. In Silico Study of Interactions between Mushroom Tyrosinase and Compounds 1a and 1b, and Kojic Acid
2.3.4. In Silico Analysis of Molecular Interactions between Compounds 1a and 1b, and Kojic Acid, and a Human Tyrosinase Homology Model
2.3.5. Cell Culture
2.3.6. B16F10 Cell Viability Assays
2.3.7. Anti-Melanogenesis Activity Assay
2.3.8. Evaluations of Anti-Tyrosinase Activities
2.3.9. Protein Extraction and Western Blot Analysis
2.3.10. Total RNA Extraction and Quantitative Real-Time PCR (qRT-PCR)
2.4. Antioxidant Activity
2.4.1. DPPH Radical Scavenging Activity Assay
2.4.2. ABTS Radical Scavenging Activity Assay
2.4.3. ROS Scavenging Evaluation
2.5. Statistical Analysis
3. Results and Discussion
3.1. Chemistry
3.2. Mushroom Tyrosinase Inhibition and Log p Values
3.3. Enzyme Kinetics Mechanism Study
3.4. Docking Studies on Compounds 1a and 1b
3.4.1. Binding Behaviors of Compounds 1a and 1b at the Active Site of Mushroom Tyrosinase
3.4.2. Binding Behaviors of Compounds 1a and 1b at the Active Site in the Human Tyrosinase Homology Model
3.5. Cytotoxic Effects of Compounds 1a and 1b
3.6. Inhibitory Effects of Compounds 1a and 1b on Extracellular Melanin Secretion by B16F10 Cells
3.7. Inhibitory Effect of Compounds 1a and 1b on Intracellular Melanin Production in B16F10 cells
3.8. Inhibitory Effect of Compounds 1a and 1b on Cellular Tyrosinase Activities in B16F10 Cells
3.9. Effects of Compound 1b on the Expressions of Melanogenesis-Related Genes in B16F10 Cells
3.10. DPPH Radical Scavenging Activities of Compounds 1a and 1b
3.11. The ABTS Radical Scavenging Effects of Compounds 1a–1p
3.12. The Intracellular ROS Scavenging Effects of the 16 2-Arylbenzothiazole Derivatives
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wang, R.; Chai, W.M.; Yang, Q.; Wei, M.K.; Peng, Y. 2-(4-Fluorophenyl)-quinazolin-4(3H)-one as a novel tyrosinase inhibitor: Synthesis, inhibitory activity, and mechanism. Bioorg. Med. Chem. 2016, 24, 4620–4625. [Google Scholar] [CrossRef] [PubMed]
- Maymone, M.B.C.; Neamah, H.H.; Wirya, S.A.; Patzelt, N.M.; Secemsky, E.A.; Zancanaro, P.Q.; Vashi, N.A. The impact of skin hyperpigmentation and hyperchromia on quality of life: A cross-sectional study. J. Am. Acad. Dermatol. 2017, 77, 775–778. [Google Scholar] [CrossRef] [PubMed]
- Raper, H.S. The aerobic oxidases. Physiol. Rev. 1928, 8, 245–282. [Google Scholar] [CrossRef]
- Chen, Q.-X.; Kubo, I. Kinetics of mushroom tyrosinase inhibition by quercetin. J. Agric. Food Chem. 2002, 50, 4108–4112. [Google Scholar] [CrossRef]
- Roulier, B.; Pérès, B.; Haudecoeur, R. Advances in the Design of Genuine Human Tyrosinase Inhibitors for Targeting Melanogenesis and Related Pigmentations. J. Med. Chem. 2020, 63, 13428–13443. [Google Scholar] [CrossRef]
- Olivares, C.; Solano, F. New insights into the active site structure and catalytic mechanism of tyrosinase and its related proteins. Pigment. Cell Melanoma Res. 2009, 22, 750–760. [Google Scholar] [CrossRef]
- Solano, F.; Briganti, S.; Picardo, M.; Ghanem, G. Hypopigmenting agents: An updated review on biological, chemical and clinical aspects. Pigment. Cell Res. 2006, 19, 550–571. [Google Scholar] [CrossRef]
- Khan, M.T. Novel tyrosinase inhibitors from natural resources—Their computational studies. Curr. Med. Chem. 2012, 19, 2262–2272. [Google Scholar] [CrossRef]
- Bao, K.; Dai, Y.; Zhu, Z.B.; Tu, F.J.; Zhang, W.G.; Yao, X.S. Design and synthesis of biphenyl derivatives as mushroom tyrosinase inhibitors. Bioorg. Med. Chem. 2010, 18, 6708–6714. [Google Scholar] [CrossRef]
- Jimbow, K.; Obata, H.; Pathak, M.A.; Fitzpatrick, T.B. Mechanism of depigmentation by hydroquinone. J. Invest. Dermatol. 1974, 62, 436–449. [Google Scholar] [CrossRef] [Green Version]
- Zachary, C.M.; Wang, J.V.; Saedi, N. Kojic Acid for Melasma: Popular Ingredient in Skincare Products. Skinmed 2020, 18, 271–273. [Google Scholar] [PubMed]
- Gupta, A.K.; Gover, M.D.; Nouri, K.; Taylor, S. The treatment of melasma: A review of clinical trials. J. Am. Acad. Dermatol. 2006, 55, 1048–1065. [Google Scholar] [CrossRef] [PubMed]
- O’Donoghue, J.L. Hydroquinone and its analogues in dermatology—A risk-benefit viewpoint. J. Cosmet. Dermatol. 2006, 5, 196–203. [Google Scholar] [CrossRef]
- Maeda, K.; Fukuda, M. Arbutin: Mechanism of its depigmenting action in human melanocyte culture. J. Pharmacol. Exp. Ther. 1996, 276, 765–769. [Google Scholar]
- Gaskell, M.; McLuckie, K.I.; Farmer, P.B. Genotoxicity of the benzene metabolites para-benzoquinone and hydroquinone. Chem. Biol. Interact. 2005, 153, 267–270. [Google Scholar] [CrossRef]
- Ogiwara, Y.; Sugiura, M.; Watanabe, K.; Tawara, J.; Endo, E.; Maruyama, H.; Tsuji, S.; Matsue, K.; Yamada, H.; Wako, Y. Evaluation of the repeated-dose liver, bone marrow and peripheral blood micronucleus and comet assays using kojic acid. Mutat. Res. Genet. Toxicol. Environ. Mutagenesis 2015, 780, 111–116. [Google Scholar] [CrossRef] [PubMed]
- Seo, S.-Y.; Sharma, V.K.; Sharma, N. Mushroom Tyrosinase: Recent Prospects. J. Agric. Food Chem. 2003, 51, 2837–2853. [Google Scholar] [CrossRef] [PubMed]
- Zolghadri, S.; Bahrami, A.; Hassan Khan, M.T.; Munoz-Munoz, J.; Garcia-Molina, F.; Garcia-Canovas, F.; Saboury, A.A. A comprehensive review on tyrosinase inhibitors. J. Enzym. Inhib. Med. Chem. 2019, 34, 279–309. [Google Scholar] [CrossRef] [Green Version]
- Ullah, S.; Kang, D.; Lee, S.; Ikram, M.; Park, C.; Park, Y.; Yoon, S.; Chun, P.; Moon, H.R. Synthesis of cinnamic amide derivatives and their anti-melanogenic effect in α-MSH-stimulated B16F10 melanoma cells. Eur. J. Med. Chem. 2019, 161, 78–92. [Google Scholar] [CrossRef]
- Ryu, I.Y.; Choi, I.; Jung, H.J.; Ullah, S.; Choi, H.; Al-Amin, M.; Chun, P.; Moon, H.R. In vitro anti-melanogenic effects of chimeric compounds, 2-(substituted benzylidene)-1,3-indanedione derivatives with a β-phenyl-α, β -unsaturated dicarbonyl scaffold. Bioorganic Chem. 2021, 109, 104688. [Google Scholar] [CrossRef]
- Choi, I.; Park, Y.; Ryu, I.Y.; Jung, H.J.; Ullah, S.; Choi, H.; Park, C.; Kang, D.; Lee, S.; Chun, P.; et al. In silico and in vitro insights into tyrosinase inhibitors with a 2-thioxooxazoline-4-one template. Comput. Struct. Biotechnol. J. 2021, 19, 37–50. [Google Scholar] [CrossRef] [PubMed]
- Choi, H.; Ryu, I.Y.; Choi, I.; Ullah, S.; Jung, H.J.; Park, Y.; Jeong, Y.; Hwang, Y.; Hong, S.; Yoon, I.-S.; et al. Novel Anti-Melanogenic Compounds, (Z)-5-(Substituted Benzylidene)-4-thioxothiazolidin-2-one Derivatives: In Vitro and In Silico Insights. Molecules 2021, 26, 4963. [Google Scholar] [CrossRef] [PubMed]
- Sharma, P.C.; Sinhmar, A.; Sharma, A.; Rajak, H.; Pathak, D.P. Medicinal significance of benzothiazole scaffold: An insight view. J. Enzym. Inhib. Med. Chem. 2013, 28, 240–266. [Google Scholar] [CrossRef] [PubMed]
- Ghannam, I.A.Y.; Abd El-Meguid, E.A.; Ali, I.H.; Sheir, D.H.; El Kerdawy, A.M. Novel 2-arylbenzothiazole DNA gyrase inhibitors: Synthesis, antimicrobial evaluation, QSAR and molecular docking studies. Bioorganic Chem. 2019, 93, 103373. [Google Scholar] [CrossRef] [PubMed]
- Chhabra, M.; Sinha, S.; Banerjee, S.; Paira, P. An efficient green synthesis of 2-arylbenzothiazole analogues as potent antibacterial and anticancer agents. Bioorganic Med. Chem. Lett. 2016, 26, 213–217. [Google Scholar] [CrossRef] [PubMed]
- Stenger-Smith, J.; Chakraborty, I.; Mascharak, P.K. Cationic Au(I) complexes with aryl-benzothiazoles and their antibacterial activity. J. Inorg. Biochem. 2018, 185, 80–85. [Google Scholar] [CrossRef]
- Sun, Q.; Wang, Y.; Fu, Q.; Ouyang, A.; Liu, S.; Wang, Z.; Su, Z.; Song, J.; Zhang, Q.; Zhang, P.; et al. Sulfur-Coordinated Organoiridium(III) Complexes Exert Breast Anticancer Activity via Inhibition of Wnt/β-Catenin Signaling. Angew. Chem. Int. Ed. 2021, 60, 4841–4848. [Google Scholar] [CrossRef]
- Mokesch, S.; Cseh, K.; Geisler, H.; Hejl, M.; Klose, M.H.M.; Roller, A.; Meier-Menches, S.M.; Jakupec, M.A.; Kandioller, W.; Keppler, B.K. Investigations on the Anticancer Potential of Benzothiazole-Based Metallacycles. Front. Chem. 2020, 8, 209. [Google Scholar] [CrossRef]
- Abdel-Mohsen, H.T.; Abd El-Meguid, E.A.; El Kerdawy, A.M.; Mahmoud, A.E.E.; Ali, M.M. Design, synthesis, and molecular docking of novel 2-arylbenzothiazole multiangiokinase inhibitors targeting breast cancer. Arch Pharm. Weinh. 2020, 353, e1900340. [Google Scholar] [CrossRef]
- Kamila, S.; Koh, B.; Biehl, E.R. Microwave-assisted “green” synthesis of 2-alkyl/arylbenzothiazoles in one pot: A facile approach to anti-tumor drugs. J. Heterocycl. Chem. 2006, 43, 1609–1612. [Google Scholar] [CrossRef]
- Racané, L.; Ptiček, L.; Fajdetić, G.; Tralić-Kulenović, V.; Klobučar, M.; Kraljević Pavelić, S.; Perić, M.; Paljetak, H.Č.; Verbanac, D.; Starčević, K. Green synthesis and biological evaluation of 6-substituted-2-(2-hydroxy/methoxy phenyl)benzothiazole derivatives as potential antioxidant, antibacterial and antitumor agents. Bioorganic Chem. 2020, 95, 103537. [Google Scholar] [CrossRef] [PubMed]
- Venugopala, K.N.; Khedr, M.A.; Pillay, M.; Nayak, S.K.; Chandrashekharappa, S.; Aldhubiab, B.E.; Harsha, S.; Attimard, M.; Odhav, B. Benzothiazole analogs as potential anti-TB agents: Computational input and molecular dynamics. J. Biomol. Struct. Dyn. 2019, 37, 1830–1842. [Google Scholar] [CrossRef] [PubMed]
- Ramaiah, M.J.; Karthikeyan, D.; Mathavan, S.; Yamajala, R.B.R.D.; Ramachandran, S.; Vasavi, P.J.; Chandana, N.V. Synthesis, in vitro and structural aspects of benzothiazole analogs as anti-oxidants and potential neuroprotective agents. Environ. Toxicol. Pharmacol. 2020, 79, 103415. [Google Scholar] [CrossRef] [PubMed]
- Algul, O.; Kaessler, A.; Apcin, Y.; Yilmaz, A.; Jose, J. Comparative studies on conventional and microwave synthesis of some benzimidazole, benzothiazole and indole derivatives and testing on inhibition of hyaluronidase. Molecules 2008, 13, 736–748. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Parle, A.; Amin, S. Synthesis, characterization and evaluation of novel 2-aryl benzothiazole derivatives as potential antifungal agents. Int. J. Pharm. Sci. Res. 2018, 9, 4332–4337. [Google Scholar]
- Hyun, S.K.; Lee, W.-H.; Jeong, D.M.; Kim, Y.; Choi, J.S. Inhibitory Effects of Kurarinol, Kuraridinol, and Trifolirhizin from Sophora flavescens on Tyrosinase and Melanin Synthesis. Biol. Pharm. Bull. 2008, 31, 154–158. [Google Scholar] [CrossRef] [Green Version]
- Hassan, M.; Ashraf, Z.; Abbas, Q.; Raza, H.; Seo, S.-Y. Exploration of Novel Human Tyrosinase Inhibitors by Molecular Modeling, Docking and Simulation Studies. Interdiscip. Sci. Comput. Life Sci. 2018, 10, 68–80. [Google Scholar] [CrossRef]
- Saeed, A.; Mahesar, P.A.; Channar, P.A.; Abbas, Q.; Larik, F.A.; Hassan, M.; Raza, H.; Seo, S.-Y. Synthesis, molecular docking studies of coumarinyl-pyrazolinyl substituted thiazoles as non-competitive inhibitors of mushroom tyrosinase. Bioorganic Chem. 2017, 74, 187–196. [Google Scholar] [CrossRef]
- Larik, F.A.; Saeed, A.; Channar, P.A.; Muqadar, U.; Abbas, Q.; Hassan, M.; Seo, S.-Y.; Bolte, M. Design, synthesis, kinetic mechanism and molecular docking studies of novel 1-pentanoyl-3-arylthioureas as inhibitors of mushroom tyrosinase and free radical scavengers. Eur. J. Med. Chem. 2017, 141, 273–281. [Google Scholar] [CrossRef]
- Friesner, R.A.; Murphy, R.B.; Repasky, M.P.; Frye, L.L.; Greenwood, J.R.; Halgren, T.A.; Sanschagrin, P.C.; Mainz, D.T. Extra precision glide: Docking and scoring incorporating a model of hydrophobic enclosure for protein−ligand complexes. J. Med. Chem. 2006, 49, 6177–6196. [Google Scholar] [CrossRef] [Green Version]
- Farid, R.; Day, T.; Friesner, R.A.; Pearlstein, R.A. New insights about HERG blockade obtained from protein modeling, potential energy mapping, and docking studies. Bioorganic Med. Chem. 2006, 14, 3160–3173. [Google Scholar] [CrossRef] [PubMed]
- Ishiyama, M.; Tominaga, H.; Shiga, M.; Sasamoto, K.; Ohkura, Y.; Ueno, K. A combined assay of cell viability and in vitro cytotoxicity with a highly water-soluble tetrazolium salt, neutral red and crystal violet. Biol. Pharm. Bull. 1996, 19, 1518–1520. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, L.G.; Chang, W.L.; Lee, C.J.; Lee, L.T.; Shih, C.M.; Wang, C.C. Melanogenesis inhibition by gallotannins from Chinese galls in B16 mouse melanoma cells. Biol. Pharm. Bull. 2009, 32, 1447–1452. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bae, S.J.; Ha, Y.M.; Kim, J.A.; Park, J.Y.; Ha, T.K.; Park, D.; Chun, P.; Park, N.H.; Moon, H.R.; Chung, H.Y. A novel synthesized tyrosinase inhibitor: (E)-2-((2,4-dihydroxyphenyl)diazenyl)phenyl 4-methylbenzenesulfonate as an azo-resveratrol analog. Biosci. Biotechnol. Biochem. 2013, 77, 65–72. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, S.; Ullah, S.; Park, C.; Won Lee, H.; Kang, D.; Yang, J.; Akter, J.; Park, Y.; Chun, P.; Moon, H.R. Inhibitory effects of N-(acryloyl)benzamide derivatives on tyrosinase and melanogenesis. Bioorganic. Amp. Med. Chem. 2019, 27, 3929–3937. [Google Scholar] [CrossRef]
- Re, R.; Pellegrini, N.; Proteggente, A.; Pannala, A.; Yang, M.; Rice-Evans, C. Antioxidant activity applying an improved ABTS radical cation decolorization assay. Free. Radic. Biol. Med. 1999, 26, 1231–1237. [Google Scholar] [CrossRef]
- Ali, S.F.; LeBel, C.P.; Bondy, S.C. Reactive oxygen species formation as a biomarker of methylmercury and trimethyltin neurotoxicity. Neurotoxicology 1992, 13, 637–648. [Google Scholar]
- LeBel, C.P.; Bondy, S.C. Sensitive and rapid quantitation of oxygen reactive species formation in rat synaptosomes. Neurochem. Int. 1990, 17, 435–440. [Google Scholar] [CrossRef] [Green Version]
- Park, M.H.; Park, J.Y.; Lee, H.J.; Kim, D.H.; Park, D.; Jeong, H.O.; Park, C.H.; Chun, P.; Moon, H.R.; Chung, H.Y. Potent anti-diabetic effects of MHY908, a newly synthesized PPAR α/γ dual agonist in db/db mice. PLoS ONE 2013, 8, e78815. [Google Scholar] [CrossRef] [Green Version]
- Amitina, S.A.; Zaytseva, E.V.; Dmitrieva, N.A.; Lomanovich, A.V.; Kandalintseva, N.V.; Ten, Y.A.; Artamonov, I.A.; Markov, A.F.; Mazhukin, D.G. 5-Aryl-2-(3,5-dialkyl-4-hydroxyphenyl)-4,4-dimethyl-4H-imidazole 3-Oxides and Their Redox Species: How Antioxidant Activity of 1-Hydroxy-2,5-dihydro-1H-imidazoles Correlates with the Stability of Hybrid Phenoxyl–Nitroxides. Molecules 2020, 25, 3118. [Google Scholar] [CrossRef]
- Song, K.; An, S.M.; Kim, M.; Koh, J.-S.; Boo, Y.C. Comparison of the antimelanogenic effects of p-coumaric acid and its methyl ester and their skin permeabilities. J. Dermatol. Sci. 2011, 63, 17–22. [Google Scholar] [CrossRef] [PubMed]
- Mann, T.; Gerwat, W.; Batzer, J.; Eggers, K.; Scherner, C.; Wenck, H.; Stäb, F.; Hearing, V.J.; Röhm, K.H.; Kolbe, L. Inhibition of Human Tyrosinase Requires Molecular Motifs Distinctively Different from Mushroom Tyrosinase. J. Invest. Dermatol. 2018, 138, 1601–1608. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mikami, M.; Sonoki, T.; Ito, M.; Funasaka, Y.; Suzuki, T.; Katagata, Y. Glycosylation of tyrosinase is a determinant of melanin production in cultured melanoma cells. Mol. Med. Rep. 2013, 8, 818–822. [Google Scholar] [CrossRef] [Green Version]
- Yen, F.-L.; Wang, M.-C.; Liang, C.-J.; Ko, H.-H.; Lee, C.-W. Melanogenesis Inhibitor(s) from Phyla nodiflora Extract. Evid. Based Complementary Altern. Med. 2012, 2012, 867494. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, H.-C.; Chang, S.-J.; Wu, C.-Y.; Ke, H.-J.; Chang, T.-M. Shogaol Inhibits α-MSH-Induced Melanogenesis through the Acceleration of ERK and PI3K/Akt-Mediated MITF Degradation. BioMed Res. Int. 2014, 2014, 842569. [Google Scholar] [CrossRef] [Green Version]
- Chaiprasongsuk, A.; Panich, U. Role of Phytochemicals in Skin Photoprotection via Regulation of Nrf2. Front. Pharm. 2022, 13, 823881. [Google Scholar] [CrossRef]
- Chen, X.; Zhong, Z.; Xu, Z.; Chen, L.; Wang, Y. 2′,7′-Dichlorodihydrofluorescein as a fluorescent probe for reactive oxygen species measurement: Forty years of application and controversy. Free Radic. Res. 2010, 44, 587–604. [Google Scholar] [CrossRef]
- Choi, Y.J.; Uehara, Y.; Park, J.Y.; Kim, S.J.; Kim, S.R.; Lee, H.W.; Moon, H.R.; Chung, H.Y. MHY884, a newly synthesized tyrosinase inhibitor, suppresses UVB-induced activation of NF-κB signaling pathway through the downregulation of oxidative stress. Bioorganic Med. Chem. Lett. 2014, 24, 1344–1348. [Google Scholar] [CrossRef]
- He, Y.; Zhang, Y.; Zhang, D.; Zhang, M.; Wang, M.; Jiang, Z.; Otero, M.; Chen, J. 3-morpholinosydnonimine (SIN-1)-induced oxidative stress leads to necrosis in hypertrophic chondrocytes in vitro. Biomed. Pharmacother. 2018, 106, 1696–1704. [Google Scholar] [CrossRef]
- Shin, H.S.; Satsu, H.; Bae, M.-J.; Totsuka, M.; Shimizu, M. Catechol Groups Enable Reactive Oxygen Species Scavenging-Mediated Suppression of PKD-NFkappaB-IL-8 Signaling Pathway by Chlorogenic and Caffeic Acids in Human Intestinal Cells. Nutrients 2017, 9, 165. [Google Scholar] [CrossRef]
- Jung, H.J.; Choi, D.C.; Noh, S.G.; Choi, H.; Choi, I.; Ryu, I.Y.; Chung, H.Y.; Moon, H.R. New Benzimidazothiazolone Derivatives as Tyrosinase Inhibitors with Potential Anti-Melanogenesis and Reactive Oxygen Species Scavenging Activities. Antioxidants 2021, 10, 1078. [Google Scholar] [CrossRef] [PubMed]















| Genes | Gene Accession Number a | Ensembl Version a | Primers Sequence (Forward: 5′→3′, Reverse: 3′→5′) |
|---|---|---|---|
| Tyrosinase | NC_000073.7 | ENSMUSG00000004651.7 | Forward = GGAACAGCAACGAGCTAAGG Reverse = TGATGATCCGATTCACCAGA |
| TRP-1 | NC_000070.7 | ENSMUSG00000005994.15 | Forward = GGAACAGCAACGAGCTAAGG Reverse = TGATGATCCGATTCACCAGA |
| TRP-2 | NC_000080.7 | ENSMUSG00000022129.5 | Forward = GGAACAGCAACGAGCTAAGG Reverse = TGATGATCCGATTCACCAGA |
| GAPDH | NC_000072.7 | ENSMUSG00000057666 | Forward = ACCACAGTCCATGCCATCAC Reverse = CCACCACCCTGTTGCTGTAG |

| Compound | R1 | R2 | R3 | R4 | IC50 (µM) a | Log p b |
|---|---|---|---|---|---|---|
| 1a | H | H | OH | H | 54.2 ± 0.82 | 4.83 |
| 1b | OH | H | OH | H | 0.2 ± 0.01 | 4.44 |
| 1c | H | OH | OH | H | >300 | 4.44 |
| 1d | H | OMe | OH | H | 291.1 ± 63.78 | 4.71 |
| 1e | H | OEt | OH | H | >300 | 5.05 |
| 1f | H | OH | OMe | H | >300 | 4.71 |
| 1g | OH | H | H | H | >300 | 4.83 |
| 1h | H | H | OMe | H | >300 | 5.10 |
| 1i | OMe | H | OMe | H | >300 | 4.97 |
| 1j | H | OMe | OMe | H | 263.9 ± 56.65 | 4.97 |
| 1k | H | OMe | OMe | OMe | >300 | 4.84 |
| 1l | H | OMe | OH | OMe | >300 | 4.58 |
| 1m | H | Me | OH | Me | 128.9 ± 19.80 | 5.81 |
| 1n | H | OH | H | OH | 216.5 ± 32.72 | 4.44 |
| 1o | H | Br | OH | Br | >300 | 6.49 |
| 1p | H | Br | OH | H | 101.9 ± 12.35 | 5.66 |
| Kojic acid c | 12.6 ± 0.36 | –2.45 |
| l-Tyrosine (Inhibition Type a: Competitive) | l-DOPA (Inhibition Type a: Competitive) | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| IC50 (µM) b | Conc. (µM) | Km (mM) | Vmax (mM/min) | Ki (µM) | IC50 (µM) b | Conc. (µM) | Km (mM) | Vmax (mM/min) | Ki (µM) | |
| 1b | 0.2 ± 0.01 | 0 | 1.77 | 1.01 × 10−2 | 3.76 × 10−2 | 1.7 ± 0.11 | 0 | 1.78 | 4.97 × 10−3 | 2.45 |
| 0.1 | 7.05 | 1.01 × 10−2 | 1 | 3.09 | 4.97 × 10−3 | |||||
| 0.2 | 13.42 | 1.01 × 10−2 | 2 | 4.19 | 4.97 × 10−3 | |||||
| 0.4 | 18.79 | 1.01 × 10−2 | 4 | 5.20 | 4.97 × 10−3 | |||||
| KA c | 12.6 ± 0.36 | - | NT d | NT | NT | 12.3 ± 2.74 | - | NT d | NT | NT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hwang, Y.; Lee, J.; Jung, H.J.; Ullah, S.; Ko, J.; Jeong, Y.; Park, Y.J.; Kang, M.K.; Yun, H.; Kim, M.-S.; et al. A Novel Class of Potent Anti-Tyrosinase Compounds with Antioxidant Activity, 2-(Substituted phenyl)-5-(trifluoromethyl)benzo[d]thiazoles: In Vitro and In Silico Insights. Antioxidants 2022, 11, 1375. https://doi.org/10.3390/antiox11071375
Hwang Y, Lee J, Jung HJ, Ullah S, Ko J, Jeong Y, Park YJ, Kang MK, Yun H, Kim M-S, et al. A Novel Class of Potent Anti-Tyrosinase Compounds with Antioxidant Activity, 2-(Substituted phenyl)-5-(trifluoromethyl)benzo[d]thiazoles: In Vitro and In Silico Insights. Antioxidants. 2022; 11(7):1375. https://doi.org/10.3390/antiox11071375
Chicago/Turabian StyleHwang, YeJi, Jieun Lee, Hee Jin Jung, Sultan Ullah, Jeongin Ko, Yeongmu Jeong, Yu Jung Park, Min Kyung Kang, Hwayoung Yun, Min-Soo Kim, and et al. 2022. "A Novel Class of Potent Anti-Tyrosinase Compounds with Antioxidant Activity, 2-(Substituted phenyl)-5-(trifluoromethyl)benzo[d]thiazoles: In Vitro and In Silico Insights" Antioxidants 11, no. 7: 1375. https://doi.org/10.3390/antiox11071375
APA StyleHwang, Y., Lee, J., Jung, H. J., Ullah, S., Ko, J., Jeong, Y., Park, Y. J., Kang, M. K., Yun, H., Kim, M.-S., Chun, P., Chung, H. Y., & Moon, H. R. (2022). A Novel Class of Potent Anti-Tyrosinase Compounds with Antioxidant Activity, 2-(Substituted phenyl)-5-(trifluoromethyl)benzo[d]thiazoles: In Vitro and In Silico Insights. Antioxidants, 11(7), 1375. https://doi.org/10.3390/antiox11071375

