Cyanidin Alleviated CCl4-Induced Acute Liver Injury by Regulating the Nrf2 and NF-κB Signaling Pathways
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. Animals and Experimental Design
2.3. Determination of Serum Liver Function Indices
2.4. In Vivo Histopathological Assessment
2.5. Assessment of Antioxidant Activity and Inflammatory Response in the Liver
2.6. qRT-PCR Assay
2.7. Tissue Immunofluorescence Staining
2.8. Western Blotting
2.9. Molecular Docking Analysis
2.10. Statistical Analysis
3. Results
3.1. Cy Treatment Alleviated CCl4-Induced Liver Damage in Mice
3.2. H&E and TUNEL Staining
3.3. Cy Treatment Decreased Hepatic Oxidative Stress in Mice
3.4. Cy Treatment Decreased Hepatic Inflammatory Responses in Mice
3.5. Cy Treatment Activated the Nrf2 Signaling Pathway and Inhibited the NF-κB Signaling Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Meng, X.; Tang, G.-Y.; Liu, P.-H.; Zhao, C.-J.; Liu, Q.; Li, H.-B. Antioxidant activity and hepatoprotective effect of 10 medicinal herbs on CCl4-induced liver injury in mice. World J. Gastroenterol. 2020, 26, 5629. [Google Scholar] [CrossRef] [PubMed]
- Chang, S.N.; Kim, S.H.; Dey, D.K.; Park, S.M.; Nasif, O.; Bajpai, V.K.; Kang, S.C.; Lee, J.; Park, J.G. 5-O-Demethylnobiletin alleviates CCl4-Induced acute liver injury by equilibrating ROS-mediated apoptosis and autophagy induction. Int. J. Mol. Sci. 2021, 22, 1083. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; He, Y.; Wang, R.; Zhao, X. Preventive effect of flavonoid extract from the peel of gonggan (Citrus reticulata Blanco Var. Gonggan) on CCl4-induced acute liver injury in mice. J. Inflamm. Res. 2021, 14, 5111. [Google Scholar] [CrossRef] [PubMed]
- Xin, C.; Liu, S.; Qu, H.; Wang, Z. The novel nanocomplexes containing deoxycholic acid-grafted chitosan and oleanolic acid displays the hepatoprotective effect against CCl4-induced liver injury in vivo. Int. J. Biol. Macromol. 2021, 185, 338–349. [Google Scholar] [CrossRef]
- Cheng, Y.; Xie, Y.; Ge, J.-C.; Wang, L.; Peng, D.-Y.; Yu, N.-J.; Zhang, Y.; Jiang, Y.-H.; Luo, J.-P.; Chen, W.-D. Structural characterization and hepatoprotective activity of a galactoglucan from Poria cocos. Carbohyd. Polym. 2021, 263, 117979. [Google Scholar] [CrossRef]
- Dai, C.; Li, H.; Wang, Y.; Tang, S.; Velkov, T.; Shen, J. Inhibition of oxidative stress and ALOX12 and NF-κB pathways contribute to the protective effect of baicalein on carbon tetrachloride-induced acute liver injury. Antioxidants 2021, 10, 976. [Google Scholar] [CrossRef]
- Wang, Y.; Liu, F.; Liu, M.; Zhou, X.; Wang, M.; Cao, K.; Jin, S.; Shan, A.; Feng, X. Curcumin mitigates aflatoxin B1-induced liver injury via regulating the NLRP3 inflammasome and Nrf2 signaling pathway. Food Chem. Toxicol. 2022, 161, 112823. [Google Scholar] [CrossRef]
- de Souza Basso, B.; Haute, G.V.; Ortega-Ribera, M.; Luft, C.; Antunes, G.L.; Bastos, M.S.; Carlessi, L.P.; Levorse, V.G.; Cassel, E.; Donadio, M.V.F. Methoxyeugenol deactivates hepatic stellate cells and attenuates liver fibrosis and inflammation through a PPAR-γ and NF-kB mechanism. J. Ethnopharmacol. 2021, 280, 114433. [Google Scholar] [CrossRef]
- Khashkhashi-Moghadam, S.; Ezazi-Toroghi, S.; Kamkar-Vatanparast, M.; Jouyaeian, P.; Mokaberi, P.; Yazdyani, H.; Amiri-Tehranizadeh, Z.; Saberi, M.R.; Chamani, J. Novel perspective into the interaction behavior study of the cyanidin with human serum albumin-holo transferrin complex: Spectroscopic, calorimetric and molecular modeling approaches. J. Mol. Liq. 2022, 356, 119042. [Google Scholar] [CrossRef]
- Lee, D.-Y.; Yun, S.-M.; Song, M.-Y.; Jung, K.; Kim, E.-H. Cyanidin chloride induces apoptosis by inhibiting NF-κB signaling through activation of Nrf2 in colorectal cancer cells. Antioxidants 2020, 9, 285. [Google Scholar] [CrossRef]
- Dou, C.; Li, J.; Kang, F.; Cao, Z.; Yang, X.; Jiang, H.; Yang, B.; Xiang, J.; Xu, J.; Dong, S. Dual effect of cyanidin on RANKL-induced differentiation and fusion of osteoclasts. J. Cell. Physiol. 2016, 231, 558–567. [Google Scholar] [CrossRef] [PubMed]
- Niu, J.; Wang, S.; Wang, B.; Chen, L.; Zhao, G.; Liu, S.; Wang, S.; Wang, Z. Structure and anti-tumor activity of a polysaccharide from Bletilla ochracea Schltr. Int. J. Biol. Macromol. 2020, 154, 1548–1555. [Google Scholar] [CrossRef] [PubMed]
- He, Z.; Chen, S.; Pan, T.; Li, A.; Wang, K.; Lin, Z.; Liu, W.; Wang, Y.; Wang, Y. Ginsenoside Rg2 ameliorating CDAHFD-induced hepatic fibrosis by regulating AKT/mTOR-mediated autophagy. J. Agric. Food Chem. 2022, 70, 1911–1922. [Google Scholar] [CrossRef] [PubMed]
- Morris, G.M.; Huey, R.; Lindstrom, W.; Sanner, M.F.; Belew, R.K.; Goodsell, D.S.; Olson, A.J. AutoDock4 and AutoDockTools4: Automated docking with selective receptor flexibility. J. Comput. Chem. 2009, 30, 2785–2791. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Zhao, Y.; Sun, N.; Song, M.; Chen, Y.; Li, L.; Cui, H.; Yang, H.; Wang, C.; Zhang, H. Lycopene alleviates chronic stress-induced spleen apoptosis and immunosuppression via inhibiting the notch signaling pathway in rats. J. Agric. Food Chem. 2022, 70, 2889–2897. [Google Scholar] [CrossRef] [PubMed]
- Liu, F.; Qu, Y.-K.; Geng, C.; Wang, A.-M.; Zhang, J.-H.; Chen, K.-J.; Liu, B.; Tian, H.-Y.; Yang, W.-P.; Yu, Y.-B. Effects of hesperidin on the growth performance, antioxidant capacity, immune responses and disease resistance of red swamp crayfish (Procambarus clarkii). Fish Shellfish Immunol. 2020, 99, 154–166. [Google Scholar] [CrossRef] [PubMed]
- Mahdavi, A.; Mohammadsadeghi, N.; Mohammadi, F.; Saadati, F.; Nikfard, S. Evaluation of inhibitory effects of some novel phenolic derivatives on the mushroom tyrosinase activity: Insights from spectroscopic analyses, molecular docking and in vitro assays. Food Chem. 2022, 387, 132938. [Google Scholar] [CrossRef]
- Yue, H.; Cai, W.; Li, Y.; Feng, X.; Dong, P.; Xue, C.; Wang, J. A novel sialoglycopeptide from Gadus morhua eggs prevents liver fibrosis induced by CCl4 via downregulating FXR/FGF15 and TLR4/TGF-β/Smad pathways. J. Agric. Food Chem. 2021, 69, 13093–13101. [Google Scholar] [CrossRef]
- Guo, W.; Xiang, Q.; Mao, B.; Tang, X.; Cui, S.; Li, X.; Zhao, J.; Zhang, H.; Chen, W. Protective effects of microbiome-derived inosine on lipopolysaccharide-induced acute liver damage and inflammation in mice via mediating the TLR4/NF-κB pathway. J. Agric. Food Chem. 2021, 69, 7619–7628. [Google Scholar] [CrossRef]
- Wang, R.; Yang, Z.; Zhang, J.; Mu, J.; Zhou, X.; Zhao, X. Liver injury induced by carbon tetrachloride in mice is prevented by the antioxidant capacity of Anji white tea polyphenols. Antioxidants 2019, 8, 64. [Google Scholar] [CrossRef]
- Zhan, J.; Cao, H.; Hu, T.; Shen, J.; Wang, W.; Wu, P.; Yang, G.; Ho, C.-T.; Li, S. Efficient preparation of black tea extract (BTE) with the high content of theaflavin mono-and digallates and the protective effects of BTE on CCl4-induced rat liver and renal injury. J. Agric. Food Chem. 2021, 69, 5938–5947. [Google Scholar] [CrossRef] [PubMed]
- Bekkouch, O.; Dalli, M.; Harnafi, M.; Touiss, I.; Mokhtari, I.; Assri, S.E.; Harnafi, H.; Choukri, M.; Ko, S.-J.; Kim, B. Ginger (Zingiber officinale Roscoe), lemon (Citrus limon L.) juices as preventive agents from chronic liver damage induced by CCl4: A Biochemical and Histological Study. Antioxidants 2022, 11, 390. [Google Scholar] [CrossRef] [PubMed]
- Long, X.; Wang, P.; Zhou, Y.; Wang, Q.; Ren, L.; Li, Q.; Zhao, X. Preventive effect of Lactobacillus plantarum HFY15 on carbon tetrachloride (CCl4)-induced acute liver injury in mice. J. Food Sci. 2022, 87, 2626–2639. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Sun, L.; Chen, R.; Wen, S.; Li, Q.; Lai, X.; Zhang, Z.; Cao, F.; Sun, S. Chinese tea alleviates CCl4-induced liver injury through the NF-κB or Nrf2 signaling pathway in C57BL-6J mice. Nutrients 2022, 14, 972. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Liao, X.; Jiang, L.; Zhao, J.; Wu, S.; Ming, J. Orientin attenuated-GalN/LPS-induced liver injury through the inhibition of oxidative stress via Nrf2/Keap1 Pathway. J. Agric. Food Chem. 2022, 70, 7953–7967. [Google Scholar] [CrossRef]
- Guo, F.; Zhuang, X.; Han, M.; Lin, W. Polysaccharides from Enteromorpha prolifera protect against carbon tetrachloride-induced acute liver injury in mice via activation of Nrf2/HO-1 signaling, and suppression of oxidative stress, inflammation and apoptosis. Food Funct. 2020, 11, 4485–4498. [Google Scholar] [CrossRef]
- Zeng, L.; Zhou, J.; Wang, X.; Zhang, Y.; Wang, M.; Su, P. Cadmium attenuates testosterone synthesis by promoting ferroptosis and blocking autophagosome-lysosome fusion. Free Radic. Biol. Med. 2021, 176, 176–188. [Google Scholar] [CrossRef]
- Yue, H.; Wang, P.; Zhang, L.; Ning, D.; Cai, W.; Wang, Y.; Wang, J. Sialoglycoproteins isolated from the eggs of Carassius auratus alleviates CCl4-induced liver injury via downregulation of the IRE-α/NF-κB signaling pathway. J. Food Biochem. 2021, 45, e13964. [Google Scholar] [CrossRef]
- Li, Y.; Lv, L.; Ye, J.; Fang, D.; Shi, D.; Wu, W.; Wang, Q.; Wu, J.; Yang, L.; Bian, X. Bifidobacterium adolescentis CGMCC 15058 alleviates liver injury, enhances the intestinal barrier and modifies the gut microbiota in D-galactosamine-treated rats. Appl. Microbiol. Biotechnol. 2019, 103, 375–393. [Google Scholar] [CrossRef]
- Yang, K.; Zou, Z.; Wu, Y.; Hu, G. MiR-195 suppression alleviates apoptosis and oxidative stress in CCl4-induced ALI in mice by targeting Pim-1. Exp. Mol. Pathol. 2020, 115, 104438. [Google Scholar] [CrossRef]
- Zhang, X.; Chen, Y.; Li, H.; Chen, B.; Liu, Z.; Wu, G.; Li, C.; Li, R.; Cao, Y.; Zhou, J. Sulforaphane acts through NFE2L2 to prevent hypoxia-induced apoptosis in porcine granulosa cells via activating antioxidant defenses and mitophagy. J. Agric. Food Chem. 2022, 70, 8097–8110. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Tang, X.; Mao, B.; Zhang, Q.; Tian, F.; Zhao, J.; Cui, S.; Chen, W. Anti-aging effects and mechanisms of anthocyanins and their intestinal microflora metabolites. Crit. Rev. Food Sci. 2022, 21, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.; Zhu, J.; Zhang, L.; Ge, X.; Ren, M.; Liang, H. Dietary Supplementation with Eucommia ulmoides Leaf extract improved the intestinal antioxidant capacity, immune response, and disease resistance against Streptococcus agalactiae in genetically improved farmed tilapia (GIFT.; Oreochromis niloticus). Antioxidants 2022, 11, 1800. [Google Scholar] [CrossRef] [PubMed]
- Dong, J.; Ping, L.; Meng, Y.; Zhang, K.; Tang, H.; Liu, D.; Li, B.; Huo, G. Bifidobacterium longum BL-10 with Antioxidant Capacity ameliorates lipopolysaccharide-induced acute liver injury in mice by the nuclear factor-κB pathway. J. Agric. Food Chem. 2022, 70, 8680–8692. [Google Scholar] [CrossRef]
- Joubert, M.B.V.; Ingaramo, P.; Oliva, M.E.; D’Alessandro, M.E. Salvia hispanica L. (chia) seed ameliorates liver injury and oxidative stress by modulating NrF2 and NF-κB expression. Food Funct. 2022, 13, 7333–7345. [Google Scholar] [CrossRef]
Genes | Primer Sequences (5′→3′) |
---|---|
HO-1 | Forward: CGTGCTCGAATGAACACTCT Reverse: GGAAGCTGAGAGTGAGGACC |
NQO-1 | Forward: CAGCCAATCAGCGTTCGGTA Reverse: TTGCTGTTGAGGTCGCAGGAG |
Nrf2 | Forward: CAGCCATGACTGATTTAAGCAG Reverse: CAGCTGCTTGTTTTCGGTATTA |
Keap1 | Forward: GACTGGGTCAAATACGACTGC Reverse: GAATATCTGCACCAGGTAGTCC |
NF-κB/p65 | Forward: AGGCTTCTGGGCCTTATGTG Reverse: TGCTTCTCTCGCCAGGAATAC |
TNF-α | Forward: ATGTCTCAGCCTCTTCTCATTC Reverse: GCTTGTCACTCGAATTTTGAGA |
iNOS | Forward: AGACTGGATTTGGCTGGTCCCTCC Reverse: AGAACTGAGGGTACATGCTGGAGCC |
COX-2 | Forward: GGGTGTCCCTTCACTTCTTTCA Reverse: COX-2 TGGGAGGCACTTGCATTGA |
GAPDH | Forward: GGTGAAGGTCGGTGTGAACG Reverse: CCCGTAGGGCGATTACAGTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, B.; Cui, S.; Mao, B.; Zhang, Q.; Tian, F.; Zhao, J.; Tang, X.; Chen, W. Cyanidin Alleviated CCl4-Induced Acute Liver Injury by Regulating the Nrf2 and NF-κB Signaling Pathways. Antioxidants 2022, 11, 2383. https://doi.org/10.3390/antiox11122383
Wang B, Cui S, Mao B, Zhang Q, Tian F, Zhao J, Tang X, Chen W. Cyanidin Alleviated CCl4-Induced Acute Liver Injury by Regulating the Nrf2 and NF-κB Signaling Pathways. Antioxidants. 2022; 11(12):2383. https://doi.org/10.3390/antiox11122383
Chicago/Turabian StyleWang, Bulei, Shumao Cui, Bingyong Mao, Qiuxiang Zhang, Fengwei Tian, Jianxin Zhao, Xin Tang, and Wei Chen. 2022. "Cyanidin Alleviated CCl4-Induced Acute Liver Injury by Regulating the Nrf2 and NF-κB Signaling Pathways" Antioxidants 11, no. 12: 2383. https://doi.org/10.3390/antiox11122383
APA StyleWang, B., Cui, S., Mao, B., Zhang, Q., Tian, F., Zhao, J., Tang, X., & Chen, W. (2022). Cyanidin Alleviated CCl4-Induced Acute Liver Injury by Regulating the Nrf2 and NF-κB Signaling Pathways. Antioxidants, 11(12), 2383. https://doi.org/10.3390/antiox11122383