NADPH Oxidase 5 (NOX5) Overexpression Promotes Endothelial Dysfunction via Cell Apoptosis, Migration, and Metabolic Alterations in Human Brain Microvascular Endothelial Cells (hCMEC/D3)
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Proteomic Analysis
2.3. Quantitative PCR (qPCR)
2.4. Western Blotting
2.5. Extracellular H2O2 Production Measurement
2.6. Intracellular Superoxide (O2●− ) Production Detection
2.7. Apoptotic Levels Measurement
2.8. Telomere Length Measurement by qPCR
2.9. Real Time Proliferation Measurement
2.10. XFp Cell Mito Stress Assay
2.11. Wound-Healing Assay
2.12. Statistical Analysis
3. Results
3.1. hCMEC/D3 Infection with NOX5-β Adenovirus Resulted in a Functional Protein Overexpression
3.2. NOX5-β Overexpression Induces a Widespread hCMEC/D3 Proteomic Remodelling
3.3. Proteomic Analysis of NOX5-β Overexpression in hCMEC/D3 Cells Predicts Alterations in CELL Proliferation and General Metabolism
3.4. The NOX5-β Overproduction Inhibits Proliferation and Promotes Apoptosis in hCMEC/D3 Cells
3.5. NOX5-β Overexpression in hCMEC/D3 Cells Promotes Oxidative Phosphorylation and Energy Expenditure
3.6. NOX5-β Overexpression in hCMEC/D3 Cells Promotes Cell Migration and Ezrin/Radixin/Moesin System Dephosphorylation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Godo, S.; Shimokawa, H. Endothelial Functions. Arter. Thromb. Vasc. Biol. 2017, 37, e108–e114. [Google Scholar] [CrossRef] [PubMed]
- Furchgott, R.F.; Zawadzki, J.V. The obligatory role of endothelial cells in the relaxation of arterial smooth muscle by acetylcholine. Nature 1980, 288, 373–376. [Google Scholar] [CrossRef] [PubMed]
- Hong, N.; Ye, Z.; Lin, Y.; Liu, W.; Xu, N.; Wang, Y. Agomelatine prevents angiotensin II-induced endothelial and mononuclear cell adhesion. Aging 2021, 13, 18515–18526. [Google Scholar] [CrossRef] [PubMed]
- Guillot, N.; Kollins, D.; Gilbert, V.; Xavier, S.; Chen, J.; Gentle, M.; Reddy, A.; Bottinger, E.; Jiang, R.; Rastaldi, M.P.; et al. BAMBI Regulates Angiogenesis and Endothelial Homeostasis through Modulation of Alternative TGFβ Signaling. PLoS ONE 2012, 7, e39406. [Google Scholar] [CrossRef]
- Daiber, A.; Steven, S.; Weber, A.; Shuvaev, V.V.; Muzykantov, V.R.; Laher, I.; Li, H.; Lamas, S.; Münzel, T. Targeting vascular (endothelial) dysfunction. Br. J. Pharmacol. 2017, 174, 1591–1619. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Horke, S.; Förstermann, U. Vascular oxidative stress, nitric oxide and atherosclerosis. Atherosclerosis 2014, 237, 208–219. [Google Scholar] [CrossRef]
- Lozhkin, A.; Vendrov, A.E.; Pan, H.; Wickline, S.A.; Madamanchi, N.R.; Runge, M.S. NADPH oxidase 4 regulates vascular inflammation in aging and atherosclerosis. J. Mol. Cell Cardiol. 2017, 102, 10–21. [Google Scholar] [CrossRef] [PubMed]
- Yu, W.; Xiao, L.; Que, Y.; Li, S.; Chen, L.; Hu, P.; Xiong, R.; Seta, F.; Chen, H.; Tong, X. Smooth muscle NADPH oxidase 4 promotes angiotensin II-induced aortic aneurysm and atherosclerosis by regulating osteopontin. Biochim. Biophys. Acta Mol. Basis Dis. 2020, 1866, 165912. [Google Scholar] [CrossRef] [PubMed]
- Ngarashi, D.; Fujikawa, K.; Ferdaus, M.Z.; Zahid, H.M.; Ohara, H.; Nabika, T. Dual inhibition of NADPH oxidases and xanthine oxidase potently prevents salt-induced stroke in stroke-prone spontaneously hypertensive rats. Hypertens. Res. 2019, 42, 981–989. [Google Scholar] [CrossRef] [PubMed]
- Vara, D.; Mailer, R.K.; Tarafdar, A.; Wolska, N.; Heestermans, M.; Konrath, S.; Spaeth, M.; Renné, T.; Schröder, K.; Pula, G. NADPH Oxidases Are Required for Full Platelet Activation In Vitro and Thrombosis In Vivo but Dispensable for Plasma Coagulation and Hemostasis. Arter. Thromb. Vasc. Biol. 2021, 41, 683–697. [Google Scholar] [CrossRef] [PubMed]
- Marqués, J.; Cortés, A.; Pejenaute, Á.; Zalba, G. Implications of NADPH oxidase 5 in vascular diseases. Int. J. Biochem. Cell Biol. 2020, 128, 105851. [Google Scholar] [CrossRef] [PubMed]
- Da Silva, J.F.; Alves, J.V.; Silva-Neto, J.A.; Costa, R.M.; Neves, K.B.; Alves-Lopes, R.; Carmargo, L.L.; Rios, F.J.; Montezano, A.C.; Touyz, R.M.; et al. Lysophosphatidylcholine induces oxidative stress in human endothelial cells via NOX5 activation—Implications in atherosclerosis. Clin. Sci. 2021, 135, 1845–1858. [Google Scholar] [CrossRef] [PubMed]
- Marqués, J.; Cortés, A.; Pejenaute, Á.; Ansorena, E.; Abizanda, G.; Prósper, F.; Martínez-Irujo, J.J.; de Miguel, C.; Zalba, G. Induction of Cyclooxygenase-2 by Overexpression of the Human NADPH Oxidase 5 (NOX5) Gene in Aortic Endothelial Cells. Cells 2020, 9, 637. [Google Scholar] [CrossRef] [PubMed]
- Guzik, T.J.; Chen, W.; Gongora, M.C.; Guzik, B.; Lob, H.E.; Mangalat, D.; Hoch, N.; Dikalov, S.; Rudzinski, P.; Kapelak, B.; et al. Calcium-Dependent NOX5 Nicotinamide Adenine Dinucleotide Phosphate Oxidase Contributes to Vascular Oxidative Stress in Human Coronary Artery Disease. J. Am. Coll. Cardiol. 2008, 52, 1803–1809. [Google Scholar] [CrossRef] [PubMed]
- Petheő, G.L.; Kerekes, A.; Mihálffy, M.; Donkó, Á.; Bodrogi, L.; Skoda, G.; Baráth, M.; Hoffmann, O.I.; Szeles, Z.; Balázs, B.; et al. Disruption of the NOX5 Gene Aggravates Atherosclerosis in Rabbits. Circ. Res. 2021, 128, 1320–1322. [Google Scholar] [CrossRef] [PubMed]
- Cortés, A.; Solas, M.; Pejenaute, Á.; Abellanas, M.A.; Garcia-Lacarte, M.; Aymerich, M.S.; Marqués, J.; Ramírez, M.J.; Zalba, G. Expression of Endothelial NOX5 Alters the Integrity of the Blood-Brain Barrier and Causes Loss of Memory in Aging Mice. Antioxidants 2021, 10, 1311. [Google Scholar] [CrossRef]
- Casas, A.I.; Kleikers, P.W.; Geuss, E.; Langhauser, F.; Adler, T.; Busch, D.H.; Gailus-Durner, V.; De Angelis, M.H.; Egea, J.; Lopez, M.G.; et al. Calcium-dependent blood-brain barrier breakdown by NOX5 limits postreperfusion benefit in stroke. J. Clin. Investig. 2019, 129, 1772–1778. [Google Scholar] [CrossRef] [PubMed]
- Deliyanti, D.; AlRashdi, S.F.; Touyz, R.M.; Kennedy, C.R.; Jha, J.C.; Cooper, M.E.; Jandeleit-Dahm, K.A.; Wilkinson-Berka, J.L. Nox (NADPH Oxidase) 1, Nox4, and Nox5 Promote Vascular Permeability and Neovascularization in Retinopathy. Hypertension 2020, 75, 1091–1101. [Google Scholar] [CrossRef] [PubMed]
- Cortés, A.; Pejenaute, Á.; Marqués, J.; Izal, Í.; Cenoz, S.; Ansorena, E.; Martínez-Irujo, J.J.; de Miguel, C.; Zalba, G. NADPH Oxidase 5 Induces Changes in the Unfolded Protein Response in Human Aortic Endothelial Cells and in Endothelial-Specific Knock-in Mice. Antioxidants 2021, 10, 194. [Google Scholar] [CrossRef] [PubMed]
- Shevchenko, A.; Tomas, H.; Havli, J.; Olsen, J.V.; Mann, M. In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nat. Protoc. 2006, 1, 2856–2860. [Google Scholar] [CrossRef]
- Cox, J.; Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 2008, 26, 1367–1372. [Google Scholar] [CrossRef] [PubMed]
- Cox, J.; Neuhauser, N.; Michalski, A.; Scheltema, R.A.; Olsen, J.V.; Mann, M. Andromeda: A Peptide Search Engine Integrated into the MaxQuant Environment. J. Proteome Res. 2011, 10, 1794–1805. [Google Scholar] [CrossRef] [PubMed]
- Tyanova, S.; Temu, T.; Sinitcyn, P.; Carlson, A.; Hein, M.Y.; Geiger, T.; Mann, M.; Cox, J. The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat. Methods 2016, 13, 731–740. [Google Scholar] [CrossRef] [PubMed]
- Okuda, S.; Watanabe, Y.; Moriya, Y.; Kawano, S.; Yamamoto, T.; Matsumoto, M.; Takami, T.; Kobayashi, D.; Araki, N.; Yoshizawa, A.C.; et al. jPOSTrepo: An international standard data repository for proteomes. Nucleic Acids Res. 2017, 45, D1107–D1111. [Google Scholar] [CrossRef] [PubMed]
- Pejenaute, Á.; Cortés, A.; Marqués, J.; Montero, L.; Beloqui, Ó.; Fortuño, A.; Martí, A.; Orbe, J.; Zalba, G. NADPH Oxidase Overactivity Underlies Telomere Shortening in Human Atherosclerosis. Int. J. Mol. Sci. 2020, 21, 1434. [Google Scholar] [CrossRef]
- Dao, V.T.; Elbatreek, M.H.; Altenhöfer, S.; Casas, A.I.; Machado, M.P.; Neullens, C.T.; Knaus, U.G.; Schmidt, H.H.H.W. Isoform-selective NADPH oxidase inhibitor panel for pharmacological target validation. Free Radic. Biol. Med. 2020, 148, 60–69. [Google Scholar] [CrossRef] [PubMed]
- Furmanik, M.; Chatrou, M.; Van Gorp, R.; Akbulut, A.; Willems, B.; Schmidt, H.; Van Eys, G.; Bochaton-Piallat, M.-L.; Proudfoot, D.; Biessen, E.; et al. Reactive Oxygen-Forming Nox5 Links Vascular Smooth Muscle Cell Phenotypic Switching and Extracellular Vesicle-Mediated Vascular Calcification. Circ. Res. 2020, 127, 911–927. [Google Scholar] [CrossRef] [PubMed]
- Pai, W.-Y.; Lo, W.-Y.; Hsu, T.; Peng, C.-T.; Wang, H.-J. Angiotensin-(1–7) Inhibits Thrombin-Induced Endothelial Phenotypic Changes and Reactive Oxygen Species Production via NADPH Oxidase 5 Downregulation. Front. Physiol. 2017, 8, 994. [Google Scholar] [CrossRef] [PubMed]
- Huang, Z.; Su, Q.; Li, W.; Ren, H.; Huang, H.; Wang, A. Suppressed mitochondrial respiration via NOX5-mediated redox imbalance contributes to the antitumor activity of anlotinib in oral squamous cell carcinoma. J. Genet. Genom. 2021, 48, 582–593. [Google Scholar] [CrossRef] [PubMed]
- Andueza, A.; Garde, N.; García-Garzón, A.; Ansorena, E.; López-Zabalza, M.J.; Iraburu, M.J.; Zalba, G.; Martínez-Irujo, J.J. NADPH oxidase 5 promotes proliferation and fibrosis in human hepatic stellate cells. Free Radic. Biol. Med. 2018, 126, 15–26. [Google Scholar] [CrossRef] [PubMed]
- Brar, S.S.; Corbin, Z.; Kennedy, T.P.; Hemendinger, R.; Thornton, L.; Bommarius, B.; Arnold, R.S.; Whorton, A.R.; Sturrock, A.B.; Huecksteadt, T.P.; et al. NOX5 NAD(P)H oxidase regulates growth and apoptosis in DU 145 prostate cancer cells. Am. J. Physiol. Cell Physiol. 2003, 285, C353–C369. [Google Scholar] [CrossRef] [PubMed]
- Dho, S.H.; Kim, J.Y.; Lee, K.-P.; Kwon, E.-S.; Lim, J.C.; Kim, C.-J.; Jeong, D.; Kwon, K.-S. STAT5A-mediated NOX5-L expression promotes the proliferation and metastasis of breast cancer cells. Exp. Cell Res. 2017, 351, 51–58. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Lu, K.; Zhu, M.; Xie, X.; Ding, Y.; Shao, X.; Chen, Y.; Liu, J.; Xu, M.; Xu, Y.; et al. miR-485 suppresses inflammation and proliferation of mesangial cells in an in vitro model of diabetic nephropathy by targeting NOX5. Biochem. Biophys. Res. Commun. 2020, 521, 984–990. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Li, Y.; Zheng, S. Inhibition of NADPH Oxidase 5 (NOX5) Suppresses High Glucose-Induced Oxidative Stress, Inflammation and Extracellular Matrix Accumulation in Human Glomerular Mesangial Cells. Med. Sci. Monit. 2020, 26, e919399. [Google Scholar] [CrossRef] [PubMed]
- Dho, S.H.; Kim, J.Y.; Kwon, E.-S.; Lim, J.C.; Park, S.S.; Kwon, K.-S. NOX5-L can stimulate proliferation and apoptosis depending on its levels and cellular context, determining cancer cell susceptibility to cisplatin. Oncotarget 2015, 6, 39235–39246. [Google Scholar] [CrossRef] [PubMed]
- Kent, L.N.; Leone, G. The broken cycle: E2F dysfunction in cancer. Nat. Rev. Cancer 2019, 19, 326–338. [Google Scholar] [CrossRef] [PubMed]
- García, J.G.; Ansorena, E.; Milagro, F.I.; Zalba, G.; de Miguel, C. Endothelial Nox5 Expression Modulates Glucose Uptake and Lipid Accumulation in Mice Fed a High-Fat Diet and 3T3-L1 Adipocytes Treated with Glucose and Palmitic Acid. Int. J. Mol. Sci. 2021, 22, 2729. [Google Scholar] [CrossRef]
- García, J.G.; de Miguel, C.; Milagro, F.I.; Zalba, G.; Ansorena, E. Endothelial NOX5 Expression Modulates Thermogenesis and Lipolysis in Mice Fed with a High-Fat Diet and 3T3-L1 Adipocytes through an Interleukin-6 Dependent Mechanism. Antioxidants 2021, 11, 30. [Google Scholar] [CrossRef]
- Ren, X.; Ren, L.; Wei, Q.; Shao, H.; Chen, L.; Liu, N. Advanced glycation end-products decreases expression of endothelial nitric oxide synthase through oxidative stress in human coronary artery endothelial cells. Cardiovasc. Diabetol. 2017, 16, 52. [Google Scholar] [CrossRef]
- Quagliaro, L.; Piconi, L.; Assaloni, R.; Martinelli, L.; Motz, E.; Ceriello, A. Intermittent High Glucose Enhances Apoptosis Related to Oxidative Stress in Human Umbilical Vein Endothelial Cells: The role of protein kinase C and NAD(P)H-oxidase activation. Diabetes 2003, 52, 2795–2804. [Google Scholar] [CrossRef]
- Jha, J.C.; Dai, A.; Garzarella, J.; Charlton, A.; Urner, S.; Østergaard, J.A.; Okabe, J.; Holterman, C.E.; Skene, A.; Power, D.A.; et al. Independent of Renox, NOX5 Promotes Renal Inflammation and Fibrosis in Diabetes by Activating ROS-Sensitive Pathways. Diabetes 2022, 71, 1282–1298. [Google Scholar] [CrossRef]
- Zhou, L.; Liu, Y.; Wang, Z.; Liu, D.; Xie, B.; Zhang, Y.; Yuan, M.; Tse, G.; Li, G.; Xu, G.; et al. Activation of NADPH oxidase mediates mitochondrial oxidative stress and atrial remodeling in diabetic rabbits. Life Sci. 2021, 272, 119240. [Google Scholar] [CrossRef] [PubMed]
- Zinkevich, N.S.; Fancher, I.S.; Gutterman, D.D.; Phillips, S.A. Roles of NADPH oxidase and mitochondria in flow-induced vasodilation of human adipose arterioles: ROS-induced ROS release in coronary artery disease. Microcirculation 2017, 24, e12380. [Google Scholar] [CrossRef] [PubMed]
- Gole, H.K.A.; Tharp, D.L.; Bowles, D.K. Upregulation of Intermediate-Conductance Ca2+-Activated K+ Channels (KCNN4) in Porcine Coronary Smooth Muscle Requires NADPH Oxidase 5 (NOX5). PLoS ONE 2014, 9, e105337. [Google Scholar] [CrossRef]
- Camargo, L.L.; Montezano, A.C.; Hussain, M.; Wang, Y.; Zou, Z.; Rios, F.J.; Neves, K.B.; Alves-Lopez, R.; Awan, F.R.; Guzik, T.J.; et al. Central role of c-Src in NOX5- mediated redox signalling in vascular smooth muscle cells in human hypertension. Cardiovasc. Res. 2022, 118, 1359–1373. [Google Scholar] [CrossRef] [PubMed]
- Miyano, K.; Okamoto, S.; Yamauchi, A.; Kawai, C.; Kajikawa, M.; Kiyohara, T.; Tamura, M.; Taura, M.; Kuribayashi, F. The NADPH oxidase NOX4 promotes the directed migration of endothelial cells by stabilizing vascular endothelial growth factor receptor 2 protein. J. Biol. Chem. 2020, 295, 11877–11890. [Google Scholar] [CrossRef]
- Wientjes, F.B.; Reeves, E.P.; Soskic, V.; Furthmayr, H.; Segal, A.W. The NADPH Oxidase Components p47phox and p40phox Bind to Moesin through Their PX Domain. Biochem. Biophys. Res. Commun. 2001, 289, 382–388. [Google Scholar] [CrossRef]
- Ghouleh, I.A.; Meijles, D.N.; Mutchler, S.; Zhang, Q.; Sahoo, S.; Gorelova, A.; Amaral, J.H.; Rodríguez, A.I.; Mamonova, T.; Song, G.J.; et al. Binding of EBP50 to Nox organizing subunit p47 phox is pivotal to cellular reactive species generation and altered vascular phenotype. Proc. Natl. Acad. Sci. USA 2016, 113, E5308–E5317. [Google Scholar] [CrossRef]
- Zhang, Y.-X.; Xu, J.-T.; You, X.-C.; Wang, C.; Zhou, K.-W.; Li, P.; Sun, P.; Wang, L.; Wang, T.-H. Inhibitory Effects of Hydrogen on Proliferation and Migration of Vascular Smooth Muscle Cells via Down-Regulation of Mitogen/Activated Protein Kinase and Ezrin/Radixin/Moesin Signaling Pathways. Chin. J. Physiol. 2016, 59, 46–55. [Google Scholar] [CrossRef]
- Paone, S.; Baxter, A.A.; Hulett, M.D.; Poon, I.K.H. Endothelial cell apoptosis and the role of endothelial cell-derived extracellular vesicles in the progression of atherosclerosis. Cell Mol. Life Sci. 2019, 76, 1093–1106. [Google Scholar] [CrossRef]
- Li, Z.; Li, Q.; Wang, L.; Li, C.; Xu, M.; Duan, Y.; Ma, L.; Li, T.; Chen, Q.; Wang, Y.; et al. Targeting mitochondria-inflammation circle by renal denervation reduces atheroprone endothelial phenotypes and atherosclerosis. Redox Biol. 2021, 47, 102156. [Google Scholar] [CrossRef] [PubMed]
- He, Z.; Ning, N.; Zhou, Q.; Khoshnam, S.E.; Farzaneh, M. Mitochondria as a therapeutic target for ischemic stroke. Free Radic. Biol. Med. 2020, 146, 45–58. [Google Scholar] [CrossRef] [PubMed]
- Monfoulet, L.-E.; Mercier, S.; Bayle, D.; Tamaian, R.; Barber-Chamoux, N.; Morand, C.; Milenkovic, D. Curcumin modulates endothelial permeability and monocyte transendothelial migration by affecting endothelial cell dynamics. Free Radic. Biol. Med. 2017, 13, 2042. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, K.; Takagi, Y.; Ando, K.; Fukuhara, S. Rap1 Small GTPase Regulates Vascular Endothelial-Cadherin-Mediated Endothelial Cell–Cell Junctions and Vascular Permeability. Biol. Pharm. Bull. 2021, 44, 1371–1379. [Google Scholar] [CrossRef]
- Newe, A.; Rzeniewicz, K.; König, M.; Schroer, C.F.E.; Joachim, J.; Rey-Gallardo, A.; Marrink, S.J.; Deka, J.; Parsons, M.; Ivetic, A. Serine Phosphorylation of L-Selectin Regulates ERM Binding, Clustering, and Monocyte Protrusion in Transendothelial Migration. Front. Immunol. 2019, 10, 02227. [Google Scholar] [CrossRef] [PubMed]
- Rey-Gallardo, A.; Tomlins, H.; Joachim, J.; Rahman, I.; Kitscha, P.; Frudd, K.; Parsons, M.; Ivetic, A. Sequential binding of Ezrin and Moesin to L-selectin regulates monocyte protrusive behaviour during transendothelial migration. J. Cell Sci. 2018, 131, jcs215541. [Google Scholar] [CrossRef] [PubMed]












| Gene | Accession nº | Primer | Sequence (5′-3′) |
|---|---|---|---|
| NOX1 | NM_007052.5 | Forward | CTACCTCCCACCCCAAGTCT |
| Reverse | TGACTGCTCAAACCTGACGA | ||
| NOX2 | NM_000433.4 | Forward | CTGTGAATGAGGGGCTCTCC |
| Reverse | GCAATGGTGTGAATCGCAGA | ||
| NOX4 | NM_016931.5 | Forward | CTGTATTTTCTCAGGCGTGCAT |
| Reverse | CCTCATCTCGGTATCTTGCTGC | ||
| NOX5 | NM_024505.4 | Forward | TAAGAGGCTGTCGAGGAGTGT |
| Reverse | CCAAAAGTATCTCAGAGCCCTTG | ||
| SOD1 | NM_000454.5 | Forward | GAAGAGAGGCATGTTGGAGAC |
| Reverse | GAATGTTTATTGGGCGATCC | ||
| SOD2 | NM_000636.4 | Forward | GTTGGCCAAGGGAGATGTT |
| Reverse | TCAAAGGAACCAAAGTCACG | ||
| Catalase | NM_001752.4 | Forward | CTCCACTGTTGCTGGAGAATC |
| Reverse | AGAAGTCCCAGACCATGTCC | ||
| EZR | NM_003379.5 | Forward | CTGGAGCGGCAACAGCTG |
| Reverse | CTGTCTCTCCAGCTCCTCCT | ||
| MSN | NM_002444.3 | Forward | CGCAGAGAGTCCTGGAACA |
| Reverse | TTCACTCCAGGGGGAAGCCTA | ||
| RDX | NM_001260492.2 | Forward | CGCTCTCCGGAAAGTGATAACA |
| Reverse | AGACCTCACGCAAACCAACT | ||
| E-selectin | NM_000450.2 | Forward | CTGCTTCCCAAAACGGAAAGT |
| Reverse | GCTTCCGTGGAGGTGTTGTA | ||
| GAPDH | NM_001289726.1 | Forward | ATGACAACTTTGTCAAGCTCATTT |
| Reverse | GGTCCACCACCCTGTTGCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Marqués, J.; Fernández-Irigoyen, J.; Ainzúa, E.; Martínez-Azcona, M.; Cortés, A.; Roncal, C.; Orbe, J.; Santamaría, E.; Zalba, G. NADPH Oxidase 5 (NOX5) Overexpression Promotes Endothelial Dysfunction via Cell Apoptosis, Migration, and Metabolic Alterations in Human Brain Microvascular Endothelial Cells (hCMEC/D3). Antioxidants 2022, 11, 2147. https://doi.org/10.3390/antiox11112147
Marqués J, Fernández-Irigoyen J, Ainzúa E, Martínez-Azcona M, Cortés A, Roncal C, Orbe J, Santamaría E, Zalba G. NADPH Oxidase 5 (NOX5) Overexpression Promotes Endothelial Dysfunction via Cell Apoptosis, Migration, and Metabolic Alterations in Human Brain Microvascular Endothelial Cells (hCMEC/D3). Antioxidants. 2022; 11(11):2147. https://doi.org/10.3390/antiox11112147
Chicago/Turabian StyleMarqués, Javier, Joaquín Fernández-Irigoyen, Elena Ainzúa, María Martínez-Azcona, Adriana Cortés, Carmen Roncal, Josune Orbe, Enrique Santamaría, and Guillermo Zalba. 2022. "NADPH Oxidase 5 (NOX5) Overexpression Promotes Endothelial Dysfunction via Cell Apoptosis, Migration, and Metabolic Alterations in Human Brain Microvascular Endothelial Cells (hCMEC/D3)" Antioxidants 11, no. 11: 2147. https://doi.org/10.3390/antiox11112147
APA StyleMarqués, J., Fernández-Irigoyen, J., Ainzúa, E., Martínez-Azcona, M., Cortés, A., Roncal, C., Orbe, J., Santamaría, E., & Zalba, G. (2022). NADPH Oxidase 5 (NOX5) Overexpression Promotes Endothelial Dysfunction via Cell Apoptosis, Migration, and Metabolic Alterations in Human Brain Microvascular Endothelial Cells (hCMEC/D3). Antioxidants, 11(11), 2147. https://doi.org/10.3390/antiox11112147

