Sustained Maternal Smoking Triggers Endothelial-Mediated Oxidative Stress in the Umbilical Cord Vessels, Resulting in Vascular Dysfunction
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Tissue Preparation and Transmission Electron Microscopy
2.3. Viability and Apoptosis Detection Assay
2.4. Ex Vivo Reactivity Test on Isolated UC Vessels
2.5. RNA Extraction, Reverse Transcription and Real-Time Quantitative PCR (qPCR)
- 18S rRNA:
- forward (5’–3’): GAAACGGCTACCACATCCAAGG
- reverse (5’–3’): CCGCTCCCAAGATCCAACTACG
- heat shock protein 90 (hsp90):
- forward (5’–3’): CCGTTTCTGAGAAGCAGGGCA
- reverse (5’–3’): CCTTGGCTCTGTCTGAAGGC
2.6. Immunolabeling and In Situ Detection of Superoxide Anion on UC Cryosections
2.7. Imaging and Image Analysis
2.8. Total NO2 and NO3 (tNOx) Measurement with Griess Reaction
2.9. Statistical Analysis and Graphic Representation
3. Results
3.1. Morphological Changes in the Endothelial Layer of the UC Vessels Indicate Loss of Function and Cell Death
3.2. Endothelial Dysfunction of the UC Vessels Accompanied by Membrane and Protein Damage
3.3. NOS3-Dependent NO Production Is Altered under Severe Oxidative Stress Condition
3.4. Xanthine Oxidoreductase Potentially Contributes to NOS3-Independent NO Production in Case of Endothelial Dysfunction
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Feltes, B.C.; de Faria Poloni, J.; Notari, D.L.; Bonatto, D. Toxicological Effects of the Different Substances in Tobacco Smoke on Human Embryonic Development by a Systems Chemo-Biology Approach. PLoS ONE 2013, 8, e61743. [Google Scholar] [CrossRef]
- Ambrose, J.A.; Barua, R.S. The Pathophysiology of Cigarette Smoking and Cardiovascular Disease: An Update. J. Am. Coll. Cardiol. 2004, 43, 1731–1737. [Google Scholar] [CrossRef] [PubMed]
- Csordas, A.; Kreutmayer, S.; Ploner, C.; Braun, P.R.; Karlas, A.; Backovic, A.; Wick, G.; Bernhard, D. Cigarette Smoke Extract Induces Prolonged Endoplasmic Reticulum Stress and Autophagic Cell Death in Human Umbilical Vein Endothelial Cells. Cardiovasc. Res. 2011, 92, 141–148. [Google Scholar] [CrossRef] [PubMed]
- Naeye, R.L. Functionally Important Disorders of the Placenta, Umbilical Cord, and Fetal Membranes. Hum. Pathol. 1987, 18, 680–691. [Google Scholar] [CrossRef]
- Nasiell, J.; Papadogiannakis, N.; Löf, E.; Elofsson, F.; Hallberg, B. Hypoxic Ischemic Encephalopathy in Newborns Linked to Placental and Umbilical Cord Abnormalities. J. Matern. Fetal Neonatal Med. 2016, 29, 721–726. [Google Scholar] [CrossRef] [PubMed]
- Sobrevia, L. Placental Metabolism and Disease. Placenta 2018, 70, 60–62. [Google Scholar] [CrossRef]
- Marty, M.; Kerndt, C.C.; Lui, F. Embryology, Fetal Circulation. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2020. [Google Scholar]
- Fox, S.B.; Khong, T.Y. Lack of Innervation of Human Umbilical Cord. An Immunohistological and Histochemical Study. Placenta 1990, 11, 59–62. [Google Scholar] [CrossRef]
- Spurway, J.; Logan, P.; Pak, S. The Development, Structure and Blood Flow within the Umbilical Cord with Particular Reference to the Venous System. Australas J. Ultrasound Med. 2012, 15, 97–102. [Google Scholar] [CrossRef]
- Kliche, K.; Jeggle, P.; Pavenstädt, H.; Oberleithner, H. Role of Cellular Mechanics in the Function and Life Span of Vascular Endothelium. Pflug. Arch. 2011, 462, 209–217. [Google Scholar] [CrossRef]
- Shaul, P.W. Regulation of Endothelial Nitric Oxide Synthase: Location, Location, Location. Annu. Rev. Physiol. 2002, 64, 749–774. [Google Scholar] [CrossRef]
- Förstermann, U.; Sessa, W.C. Nitric Oxide Synthases: Regulation and Function. Eur. Heart J. 2012, 33, 829–837. [Google Scholar] [CrossRef]
- Durante, W.; Johnson, F.K.; Johnson, R.A. Arginase: A Critical Regulator of Nitric Oxide Synthesis and Vascular Function. Clin. Exp. Pharmacol. Physiol. 2007, 34, 906–911. [Google Scholar] [CrossRef] [PubMed]
- Zhu, C.; Yu, Y.; Montani, J.-P.; Ming, X.-F.; Yang, Z. Arginase-I Enhances Vascular Endothelial Inflammation and Senescence through ENOS-Uncoupling. BMC Res. Notes 2017, 10, 82. [Google Scholar] [CrossRef]
- Dimmeler, S.; Fleming, I.; Fisslthaler, B.; Hermann, C.; Busse, R.; Zeiher, A.M. Activation of Nitric Oxide Synthase in Endothelial Cells by Akt-Dependent Phosphorylation. Nature 1999, 399, 601–605. [Google Scholar] [CrossRef]
- Dugmonits, K.N.; Chakraborty, P.; Hollandi, R.; Zahorán, S.; Pankotai-Bodó, G.; Horváth, P.; Orvos, H.; Hermesz, E. Maternal Smoking Highly Affects the Function, Membrane Integrity, and Rheological Properties in Fetal Red Blood Cells. Oxid. Med. Cell. Longev. 2019, 2019, 1509798. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Z.; Mahdi, A.; Tratsiakovich, Y.; Zahorán, S.; Kövamees, O.; Nordin, F.; Uribe Gonzalez, A.E.; Alvarsson, M.; Östenson, C.-G.; Andersson, D.C.; et al. Erythrocytes from Patients with Type 2 Diabetes Induce Endothelial Dysfunction Via Arginase I. J. Am. Coll. Cardiol. 2018, 72, 769–780. [Google Scholar] [CrossRef]
- Balogh, G.; Chakraborty, P.; Dugmonits, K.N.; Péter, M.; Végh, A.G.; Vígh, L.; Hermesz, E. Sustained Maternal Smoking-Associated Changes in the Physico-Chemical Properties of Fetal RBC Membranes Might Serve as Early Markers for Vascular Comorbidities. Biochim. Biophys. Acta Mol. Cell. Biol. Lipids 2020, 1865, 158615. [Google Scholar] [CrossRef]
- Chakraborty, P.; Dugmonits, K.N.; Végh, A.G.; Hollandi, R.; Horváth, P.; Maléth, J.; Hegyi, P.; Németh, G.; Hermesz, E. Failure in the Compensatory Mechanism in Red Blood Cells Due to Sustained Smoking during Pregnancy. Chem. Biol. Interact. 2019, 313, 108821. [Google Scholar] [CrossRef] [PubMed]
- Farah, C.; Michel, L.Y.M.; Balligand, J.-L. Nitric Oxide Signalling in Cardiovascular Health and Disease. Nat. Rev. Cardiol. 2018, 15, 292–316. [Google Scholar] [CrossRef]
- Zhang, Z.; Naughton, D.; Winyard, P.G.; Benjamin, N.; Blake, D.R.; Symons, M.C. Generation of Nitric Oxide by a Nitrite Reductase Activity of Xanthine Oxidase: A Potential Pathway for Nitric Oxide Formation in the Absence of Nitric Oxide Synthase Activity. Biochem. Biophys. Res. Commun. 1998, 249, 767–772. [Google Scholar] [CrossRef] [PubMed]
- Jansson, E.A.; Huang, L.; Malkey, R.; Govoni, M.; Nihlén, C.; Olsson, A.; Stensdotter, M.; Petersson, J.; Holm, L.; Weitzberg, E.; et al. A Mammalian Functional Nitrate Reductase That Regulates Nitrite and Nitric Oxide Homeostasis. Nat. Chem. Biol. 2008, 4, 411–417. [Google Scholar] [CrossRef] [PubMed]
- Lundberg, J.O.; Weitzberg, E. NO Generation from Nitrite and Its Role in Vascular Control. Arterioscler. Thromb. Vasc. Biol. 2005, 25, 915–922. [Google Scholar] [CrossRef] [PubMed]
- Peleli, M.; Zollbrecht, C.; Montenegro, M.F.; Hezel, M.; Zhong, J.; Persson, E.G.; Holmdahl, R.; Weitzberg, E.; Lundberg, J.O.; Carlström, M. Enhanced XOR Activity in ENOS-Deficient Mice: Effects on the Nitrate-Nitrite-NO Pathway and ROS Homeostasis. Free Radic. Biol. Med. 2016, 99, 472–484. [Google Scholar] [CrossRef]
- Hingorani, R.; Deng, J.; Elia, J.; McIntyre, C.; Mittar, D. Detection of Apoptosis Using the BD Annexin V FITC Assay on the BD FACSVerseTM System; BD Biosciences: San Jose, CA, USA, 2011; pp. 1–12. [Google Scholar]
- Reiss, Y.; Engelhardt, B. FACS Analysis of Endothelial Cells. In Methods in Endothelial Cell Biology; Augustin, H.G., Ed.; Springer Lab Manuals; Springer: Berlin/Heidelberg, Germany, 2004; pp. 157–165. ISBN 978-3-642-18725-4. [Google Scholar]
- Lian, S.; Xia, Y.; Khoi, P.N.; Ung, T.T.; Yoon, H.J.; Kim, N.H.; Kim, K.K.; Jung, Y.D. Cadmium Induces Matrix Metalloproteinase-9 Expression via ROS-Dependent EGFR, NF-KB, and AP-1 Pathways in Human Endothelial Cells. Toxicology 2015, 338, 104–116. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Martin, W.; McAllister, K.H.; Paisley, K. NANC Neurotransmission in the Bovine Retractor Penis Muscle Is Blocked by Superoxide Anion Following Inhibition of Superoxide Dismutase with Diethyldithiocarbamate. Neuropharmacology 1994, 33, 1293–1301. [Google Scholar] [CrossRef]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An Open-Source Platform for Biological-Image Analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef]
- Schmidt, H. Determination of Nitrite and Nitrate by the Griess Reaction. In Methods in Nitric Oxide Research; Feelisch, M., Stamler, J.S., Eds.; Wiley: New York, NY, USA, 1996; pp. 491–497. [Google Scholar]
- Lowry, O.H.; Rosebrough, N.J.; Farr, A.L.; Randall, R.J. Protein Measurement with the Folin Phenol Reagent. J. Biol. Chem. 1951, 193, 265–275. [Google Scholar] [CrossRef]
- Yanbaeva, D.G.; Dentener, M.A.; Creutzberg, E.C.; Wesseling, G.; Wouters, E.F.M. Systemic Effects of Smoking. Chest 2007, 131, 1557–1566. [Google Scholar] [CrossRef]
- Barua, R.S.; Ambrose, J.A.; Eales-Reynolds, L.-J.; DeVoe, M.C.; Zervas, J.G.; Saha, D.C. Heavy and Light Cigarette Smokers Have Similar Dysfunction of Endothelial Vasoregulatory Activity: An in Vivo and in Vitro Correlation. J. Am. Coll. Cardiol. 2002, 39, 1758–1763. [Google Scholar] [CrossRef]
- Price, J.F.; Mowbray, P.I.; Lee, A.J.; Rumley, A.; Lowe, G.D.; Fowkes, F.G. Relationship between Smoking and Cardiovascular Risk Factors in the Development of Peripheral Arterial Disease and Coronary Artery Disease: Edinburgh Artery Study. Eur. Heart J. 1999, 20, 344–353. [Google Scholar] [CrossRef]
- Rua, E.D.; Porto, M.L.; Ramos, J.P.L.; Nogueira, B.V.; Meyrelles, S.S.; Vasquez, E.C.; Pereira, T.C. Effects of Tobacco Smoking during Pregnancy on Oxidative Stress in the Umbilical Cord and Mononuclear Blood Cells of Neonates. J. Biomed. Sci. 2014, 21, 105. [Google Scholar] [CrossRef]
- Blake, K.V.; Gurrin, L.C.; Evans, S.F.; Beilin, L.J.; Landau, L.I.; Stanley, F.J.; Newnham, J.P. Maternal Cigarette Smoking during Pregnancy, Low Birth Weight and Subsequent Blood Pressure in Early Childhood. Early Hum. Dev. 2000, 57, 137–147. [Google Scholar] [CrossRef]
- Correa, A.; Levis, D.M.; Tinker, S.C.; Cragan, J.D. Maternal Cigarette Smoking and Congenital Heart Defects. J. Pediatr. 2015, 166, 801–804. [Google Scholar] [CrossRef]
- Lawrence, J.; Xiao, D.; Xue, Q.; Rejali, M.; Yang, S.; Zhang, L. Prenatal Nicotine Exposure Increases Heart Susceptibility to Ischemia/Reperfusion Injury in Adult Offspring. J. Pharmacol. Exp. Ther. 2008, 324, 331–341. [Google Scholar] [CrossRef]
- Ramadoss, J.; Pastore, M.B.; Magness, R.R. Endothelial Caveolar Subcellular Domain Regulation of Endothelial Nitric Oxide Synthase. Clin. Exp. Pharmacol. Physiol. 2013, 40, 753–764. [Google Scholar] [CrossRef]
- Wilcox, J.N.; Subramanian, R.R.; Sundell, C.L.; Tracey, W.R.; Pollock, J.S.; Harrison, D.G.; Marsden, P.A. Expression of Multiple Isoforms of Nitric Oxide Synthase in Normal and Atherosclerotic Vessels. Arterioscler. Thromb. Vasc. Biol. 1997, 17, 2479–2488. [Google Scholar] [CrossRef]
- Geng, Y.J.; Wu, Q.; Muszynski, M.; Hansson, G.K.; Libby, P. Apoptosis of Vascular Smooth Muscle Cells Induced by In Vitro Stimulation with Interferon-Gamma, Tumor Necrosis Factor-Alpha, and Interleukin-1 Beta. Arterioscler. Thromb. Vasc. Biol. 1996, 16, 19–27. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Chapman, G.B.; Peyton, K.J.; Schafer, A.I.; Durante, W. Carbon Monoxide Inhibits Apoptosis in Vascular Smooth Muscle Cells. Cardiovasc. Res. 2002, 55, 396–405. [Google Scholar] [CrossRef]
- Pfeiffer, S.; Gorren, A.C.; Schmidt, K.; Werner, E.R.; Hansert, B.; Bohle, D.S.; Mayer, B. Metabolic Fate of Peroxynitrite in Aqueous Solution. Reaction with Nitric Oxide and PH-Dependent Decomposition to Nitrite and Oxygen in a 2:1 Stoichiometry. J. Biol. Chem. 1997, 272, 3465–3470. [Google Scholar] [CrossRef] [PubMed]
- Ignarro, L.J.; Buga, G.M.; Wei, L.H.; Bauer, P.M.; Wu, G.; del Soldato, P. Role of the Arginine-Nitric Oxide Pathway in the Regulation of Vascular Smooth Muscle Cell Proliferation. Proc. Natl. Acad. Sci. USA 2001, 98, 4202–4208. [Google Scholar] [CrossRef] [PubMed]
- Romero, M.J.; Iddings, J.A.; Platt, D.H.; Ali, M.I.; Cederbaum, S.D.; Stepp, D.W.; Caldwell, R.B.; Caldwell, R.W. Diabetes-Induced Vascular Dysfunction Involves Arginase I. Am. J. Physiol. Heart Circ. Physiol. 2012, 302, H159–H166. [Google Scholar] [CrossRef] [PubMed]
- Pernow, J.; Jung, C. The Emerging Role of Arginase in Endothelial Dysfunction in Diabetes. Curr. Vasc. Pharmacol. 2016, 14, 155–162. [Google Scholar] [CrossRef] [PubMed]




Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zahorán, S.; Szántó, P.R.; Bódi, N.; Bagyánszki, M.; Maléth, J.; Hegyi, P.; Sári, T.; Hermesz, E. Sustained Maternal Smoking Triggers Endothelial-Mediated Oxidative Stress in the Umbilical Cord Vessels, Resulting in Vascular Dysfunction. Antioxidants 2021, 10, 583. https://doi.org/10.3390/antiox10040583
Zahorán S, Szántó PR, Bódi N, Bagyánszki M, Maléth J, Hegyi P, Sári T, Hermesz E. Sustained Maternal Smoking Triggers Endothelial-Mediated Oxidative Stress in the Umbilical Cord Vessels, Resulting in Vascular Dysfunction. Antioxidants. 2021; 10(4):583. https://doi.org/10.3390/antiox10040583
Chicago/Turabian StyleZahorán, Szabolcs, Péter R. Szántó, Nikolett Bódi, Mária Bagyánszki, József Maléth, Péter Hegyi, Tamás Sári, and Edit Hermesz. 2021. "Sustained Maternal Smoking Triggers Endothelial-Mediated Oxidative Stress in the Umbilical Cord Vessels, Resulting in Vascular Dysfunction" Antioxidants 10, no. 4: 583. https://doi.org/10.3390/antiox10040583
APA StyleZahorán, S., Szántó, P. R., Bódi, N., Bagyánszki, M., Maléth, J., Hegyi, P., Sári, T., & Hermesz, E. (2021). Sustained Maternal Smoking Triggers Endothelial-Mediated Oxidative Stress in the Umbilical Cord Vessels, Resulting in Vascular Dysfunction. Antioxidants, 10(4), 583. https://doi.org/10.3390/antiox10040583

