Lingonberry Improves Non-Alcoholic Fatty Liver Disease by Reducing Hepatic Lipid Accumulation, Oxidative Stress and Inflammatory Response
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Model
2.2. Biochemical Assays
2.3. Measurement of mRNA Expression
2.4. Western Immunoblotting
2.5. Histological Staining
2.6. Statistical Analysis
3. Results
3.1. Effect of HFD Feeding and Lingonberry Supplementation on Body Weight and Liver Injury
3.2. Effect of HFD Feeding and Lingonberry Supplementation on Plasma and Liver Lipids
3.3. Effect of HFD Feeding and Lingonberry Supplementation on the Indicators of De Novo Lipogenesis
3.4. Effect of HFD Feeding and Lingonberry Supplementation on Liver Lipid Peroxidation and Glutathione Levels
3.5. Effect of HFD Feeding and Lingonberry Supplementation on Glutathione Synthesis
3.6. Effect of HFD Feeding and Lingonberry Supplementation on Hepatic Inflammation
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sanyal, A.J. Past, present and future perspectives in nonalcoholic fatty liver disease. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 377–386. [Google Scholar] [CrossRef]
- Loomba, R.; Sanyal, A.J. The global NAFLD epidemic. Nat. Rev. Gastroenterol. Hepatol. 2013, 10, 686–690. [Google Scholar] [CrossRef]
- Matteoni, C.A.; Younossi, Z.M.; Gramlich, T.; Boparai, N.; Liu, Y.C.; McCullough, A.J. Nonalcoholic fatty liver disease: A spectrum of clinical and pathological severity. Gastroenterology 1999, 116, 1413–1419. [Google Scholar] [CrossRef]
- Younossi, Z.M.; Koenig, A.B.; Abdelatif, D.; Fazel, Y.; Henry, L.; Wymer, M. Global epidemiology of nonalcoholic fatty liver disease-meta-analytic assessment of prevalence, incidence, and outcomes. Hepatology 2016, 64, 73–84. [Google Scholar] [CrossRef] [PubMed]
- El Hadi, H.; Vincenzo, A.D.; Vettor, R.; Rossato, M. Cardio-metabolic disorders in non-alcoholic fatty liver disease. Int. J. Mol. Sci. 2019, 20, 2215. [Google Scholar] [CrossRef] [PubMed]
- Younossi, Z.; Anstee, Q.M.; Marietti, M.; Hardy, T.; Henry, L.; Eslam, M.; George, J.; Bugianesi, E. Global burden of NAFLD and NASH: Trends, predictions, risk factors and prevention. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 11–20. [Google Scholar] [CrossRef]
- Friedman, S.L.; Neuschwander-Tetri, B.A.; Rinella, M.; Sanyal, A.J. Mechanisms of NAFLD development and therapeutic strategies. Nat. Med. 2018, 24, 908–922. [Google Scholar] [CrossRef] [PubMed]
- Tilg, H.; Adolph, T.E.; Moschen, A.R. Multiple parallel hits hypothesis in NAFLD—revisited after a decade. Hepatology 2020. [Google Scholar] [CrossRef]
- Tilg, H.; Moschen, A.R. Evolution of inflammation in nonalcoholic fatty liver disease: The multiple parallel hits hypothesis. Hepatology 2010, 52, 1836–1846. [Google Scholar] [CrossRef] [PubMed]
- Smith, G.I.; Shankaran, M.; Yoshino, M.; Schweitzer, G.G.; Chondronikola, M.; Beals, J.W.; Okunade, A.L.; Patterson, B.W.; Nyangau, E.; Field, T.; et al. Insulin resistance drives hepatic de novo lipogenesis in nonalcoholic fatty liver disease. J. Clin. Investig. 2020, 130, 1453–1460. [Google Scholar] [CrossRef] [PubMed]
- Shimomura, I.; Matsuda, M.; Hammer, R.E.; Bashmakov, Y.; Brown, M.S.; Goldstein, J.L. Decreased IRS-2 and increased SREBP-1c lead to mixed insulin resistance and sensitivity in livers of lipodystrophic and ob/ob mice. Mol. Cell 2000, 6, 77–86. [Google Scholar] [CrossRef]
- Ferre, P.; Foufelle, F. Hepatic steatosis: A role for de novo lipogenesis and the transcription factor SREBP-1c. Diabetes Obes. Metab. 2010, 12, 83–92. [Google Scholar] [CrossRef]
- Masarone, M.; Rosato, V.; Dallio, M.; Gravina, A.G.; Aglitti, A.; Loguercio, C.; Federico, A.; Persico, M. Role of oxidative stress in pathophysiology of nonalcoholic fatty liver disease. Oxid. Med. Cell Longev. 2018, 2018, 9547613. [Google Scholar] [CrossRef]
- Ucar, F.; Sezer, S.; Erdogan, S.; Akyol, S.; Armutcu, F.; Akyol, O. The relationship between oxidative stress and nonalcoholic fatty liver disease: Its effects on the development of nonalcoholic steatohepatitis. Redox Rep. 2013, 18, 127–133. [Google Scholar] [CrossRef]
- Sutti, S.; Jindal, A.; Locatelli, I.; Vacchiano, M.; Gigliotti, L.; Bozzola, C.; Albano, E. Adaptive immune responses triggered by oxidative stress contribute to hepatic inflammation in NASH. Hepatology 2014, 59, 886–897. [Google Scholar] [CrossRef]
- Lu, S.C. Regulation of glutathione synthesis. Mol. Aspects Med. 2009, 30, 42–59. [Google Scholar] [CrossRef] [PubMed]
- Forman, H.J.; Zhang, H.; Rinna, A. Glutathione: Overview of its protective roles, measurement, and biosynthesis. Mol. Aspects Med. 2009, 30, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Shang, Y.; Siow, Y.L.; Isaak, C.K. Downregulation of glutathione biosynthesis contributes to oxidative stress and liver dysfunction in acute kidney injury. Oxid. Med. Cell Longev. 2016, 2016, 9707292. [Google Scholar] [CrossRef] [PubMed]
- Shigesawa, T.; Sato, C.; Marumo, F. Significance of plasma glutathione determination in patients with alcoholic and non-alcoholic liver disease. J. Gastroenterol. Hepatol. 1992, 7, 7–11. [Google Scholar] [CrossRef] [PubMed]
- Altomare, E.; Vendemiale, G.; Albano, O. Hepatic glutathione content in patients with alcoholic and non alcoholic liver diseases. Life Sci. 1988, 43, 991–998. [Google Scholar] [CrossRef]
- Nguyen, T.; Nioi, P.; Pickett, C.B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. J. Biol. Chem. 2009, 284, 13291–13295. [Google Scholar] [CrossRef] [PubMed]
- Tonelli, C.; Chio, I.I.C.; Tuveson, D.A. Transcriptional Regulation by Nrf2. Antioxid. Redox Signal. 2018, 29, 1727–1745. [Google Scholar] [CrossRef]
- Romero-Gomez, M.; Zelber-Sagi, S.; Trenell, M. Treatment of NAFLD with diet, physical activity and exercise. J. Hepatol. 2017, 67, 829–846. [Google Scholar] [CrossRef] [PubMed]
- Zheng, W.; Wang, S.Y. Oxygen radical absorbing capacity of phenolics in blueberries, cranberries, chokeberries, and lingonberries. J. Agric. Food Chem. 2003, 51, 502–509. [Google Scholar] [CrossRef] [PubMed]
- Debnath, S.C. Genetic Diversity and Erosion in Berries. In Genetic Diversity and Erosion in Plants; Ahuja, M.R., Jain, S.M., Eds.; Springer Nature: Berlin/Heidelberg, Germany, 2016; pp. 75–129. [Google Scholar]
- Mane, C.; Loonis, M.; Juhel, C.; Dufour, C.; Malien-Aubert, C. Food grade lingonberry extract: Polyphenolic composition and in vivo protective effect against oxidative stress. J. Agric. Food Chem. 2011, 59, 3330–3339. [Google Scholar] [CrossRef]
- Leduc, C.; Coonishish, J.; Haddad, P.; Cuerrier, A. Plants used by the Cree Nation of Eeyou Istchee (Quebec, Canada) for the treatment of diabetes: A novel approach in quantitative ethnobotany. J. Ethnopharmacol. 2006, 105, 55–63. [Google Scholar] [CrossRef] [PubMed]
- Isaak, C.K.; Petkau, J.C.; Blewett, H.; O, K.; Siow, Y.L. Lingonberry anthocyanins protect cardiac cells from oxidative-stress-induced apoptosis. Can. J. Physiol. Pharmacol. 2017, 95, 904–910. [Google Scholar] [CrossRef] [PubMed]
- Madduma Hewage, S.; Prashar, S.; Debnath, S.C.; O, K.; Siow, Y.L. Inhibition of inflammatory cytokine expression prevents high-fat diet-induced kidney injury: Role of lingonberry supplementation. Front. Med. 2020, 7, 80. [Google Scholar] [CrossRef] [PubMed]
- Eid, H.M.; Ouchfoun, M.; Brault, A.; Vallerand, D.; Musallam, L.; Arnason, J.T.; Haddad, P.S. Lingonberry (Vaccinium vitis-idaea L.) exhibits antidiabetic activities in a mouse model of diet-induced obesity. Evid. Based Complement. Altern. Med. 2014, 2014, 645812. [Google Scholar] [CrossRef] [PubMed]
- Heyman, L.; Axling, U.; Blanco, N.; Sterner, O.; Holm, C.; Berger, K. Evaluation of beneficial metabolic effects of berries in high-fat fed C57BL/6J mice. J. Nutr. Metab. 2014, 2014, 403041. [Google Scholar] [CrossRef] [PubMed]
- Ryyti, R.; Hamalainen, M.; Peltola, R.; Moilanen, E. Beneficial effects of lingonberry (Vaccinium vitis-idaea L.) supplementation on metabolic and inflammatory adverse effects induced by high-fat diet in a mouse model of obesity. PLoS ONE 2020, 15, e0232605. [Google Scholar] [CrossRef] [PubMed]
- Sarna, L.K.; Wu, N.; Wang, P.; Hwang, S.Y.; Siow, Y.L.; O, K. Folic acid supplementation attenuates high fat diet induced hepatic oxidative stress via regulation of NADPH oxidase. Can. J. Physiol. Pharmacol. 2012, 90, 155–165. [Google Scholar] [CrossRef] [PubMed]
- Sid, V.; Shang, Y.; Siow, Y.L.; Hewage, S.M.; House, J.D.; O, K. Folic acid supplementation attenuates chronic hepatic inflammation in high-fat diet fed mice. Lipids 2018, 53, 709–716. [Google Scholar] [CrossRef] [PubMed]
- Folch, J.; Lees, M.; Stanley, G.S. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef]
- Chomczynski, P.; Mackey, K. Modification of the TRI reagent procedure for isolation of RNA from polysaccharide-and proteoglycan-rich sources. Short technical reports. Biotechniques 1995, 19, 942–945. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Wijerathne, C.U.B.; Madduma Hewage, S.; Siow, Y.L. Kidney ischemia-reperfusion decreases hydrogen sulfide and increases oxidative stress in the heart. Biomolecules 2020, 10, 1565. [Google Scholar] [CrossRef]
- Sid, V.; Wu, N.; Sarna, L.K.; Siow, Y.L.; House, J.D.; O, K. Folic acid supplementation during high-fat diet feeding restores AMPK activation via an AMP-LKB1-dependent mechanism. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2015, 309, R1215–R1225. [Google Scholar] [CrossRef]
- Woo, C.W.; Siow, Y.L.; Pierce, G.N.; Choy, P.C.; Minuk, G.Y.; Mymin, D.; O, K. Hyperhomocysteinemia induces hepatic cholesterol biosynthesis and lipid accumulation via activation of transcription factors. Am. J. Physiol. Endocrinol. Metab. 2005, 288, E1002–E1010. [Google Scholar] [CrossRef]
- Kim, K.H. Regulation of mammalian acetyl-coenzyme A carboxylase. Annu. Rev. Nutr. 1997, 17, 77–99. [Google Scholar] [CrossRef]
- Rui, L. Energy metabolism in the liver. Compr. Physiol. 2014, 4, 177–197. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Xu, S.; Mihaylova, M.M.; Zheng, B.; Hou, X.; Jiang, B.; Park, O.; Luo, Z.; Lefai, E.; Shyy, J.Y.; et al. AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice. Cell Metab. 2011, 13, 376–388. [Google Scholar] [CrossRef] [PubMed]
- Sumida, Y.; Niki, E.; Naito, Y.; Yoshikawa, T. Involvement of free radicals and oxidative stress in NAFLD/NASH. Free Radic. Res. 2013, 47, 869–880. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Tian, R.; She, Z.; Cai, J.; Li, H. Role of oxidative stress in the pathogenesis of nonalcoholic fatty liver disease. Free Radic. Biol. Med. 2020, 152, 116–141. [Google Scholar] [CrossRef] [PubMed]
- Bellanti, F.; Villani, R.; Facciorusso, A.; Vendemiale, G.; Serviddio, G. Lipid oxidation products in the pathogenesis of non-alcoholic steatohepatitis. Free Radic. Biol. Med. 2017, 111, 173–185. [Google Scholar] [CrossRef]
- Chan, J.Y.; Kwong, M. Impaired expression of glutathione synthetic enzyme genes in mice with targeted deletion of the Nrf2 basic-leucine zipper protein. Biochim. Biophys. Acta Gene Struct. Express. 2000, 1517, 19–26. [Google Scholar] [CrossRef]
- Isaak, C.K.; Petkau, J.C.; O, K.; Debnath, S.C.; Siow, Y.L. Manitoba lingonberry (Vaccinium vitis-idaea) bioactivities in ischemia-reperfusion Injury. J. Agric. Food Chem. 2015, 63, 5660–5669. [Google Scholar] [CrossRef]
- Speciale, A.; Anwar, S.; Canali, R.; Chirafisi, J.; Saija, A.; Virgili, F.; Cimino, F. Cyanidin-3-O-glucoside counters the response to TNF-alpha of endothelial cells by activating Nrf2 pathway. Mol. Nutr. Food Res. 2013, 57, 1979–1987. [Google Scholar] [CrossRef]
- Bashllari, R.; Molonia, M.S.; Muscarà, C.; Speciale, A.; Wilde, P.J.; Saija, A.; Cimino, F. Cyanidin-3-O-glucoside protects intestinal epithelial cells from palmitate-induced lipotoxicity. Arch. Physiol. Biochem. 2020, 6, 1–8. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) | Accession Number | Size (bp) |
---|---|---|---|---|
Gclc | GGGGTGACGAGGTGGAGTA | GTTGGGGTTTGTCCTCTCCC | NM_010295.2 | 125 |
Gclm | CGAGGAGCTTCGAGACTGTAT | ACTGCATGGGACATGGTACA | NM_008129.4 | 114 |
GS | CACTGGGTCGTACCCAAGC | ATACGTCACCACTCGCTCGT | NM_001291111.1 | 98 |
SREBP-1c | GGAGCCATGGATTGCACATT | GGCCCGGGAAGTCACTGT | XM_006532716.4 | 70 |
ACC-1 | CGGACCTTTGAAGATTTTGTGAGG | GCTTTATTCTGCTGGTGTAACTCTC | XM_036156218.1 | 223 |
IL-6 | GACTGATGCTGGTGACAACC | GCCATTGCACAACTCTTTTC | NM_001314054.1 | 170 |
MCP-1 | AGGTCCCTGTCATGCTTCTG | GCTGCTGGTGATCCTCTTGT | NM_011333.3 | 167 |
TNF-α | GTCCCCAAAGGGATGAGAAG | GCTCCTCCACTTGGTGGTTT | NM_001278601.1 | 93 |
β-Actin | GATCAAGATCATTGCTCCTCCT | AGGGTGTAAAACGCAGCTCA | XM_030254057.1 | 183 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Madduma Hewage, S.; Prashar, S.; O, K.; Siow, Y.L. Lingonberry Improves Non-Alcoholic Fatty Liver Disease by Reducing Hepatic Lipid Accumulation, Oxidative Stress and Inflammatory Response. Antioxidants 2021, 10, 565. https://doi.org/10.3390/antiox10040565
Madduma Hewage S, Prashar S, O K, Siow YL. Lingonberry Improves Non-Alcoholic Fatty Liver Disease by Reducing Hepatic Lipid Accumulation, Oxidative Stress and Inflammatory Response. Antioxidants. 2021; 10(4):565. https://doi.org/10.3390/antiox10040565
Chicago/Turabian StyleMadduma Hewage, Susara, Suvira Prashar, Karmin O, and Yaw L. Siow. 2021. "Lingonberry Improves Non-Alcoholic Fatty Liver Disease by Reducing Hepatic Lipid Accumulation, Oxidative Stress and Inflammatory Response" Antioxidants 10, no. 4: 565. https://doi.org/10.3390/antiox10040565
APA StyleMadduma Hewage, S., Prashar, S., O, K., & Siow, Y. L. (2021). Lingonberry Improves Non-Alcoholic Fatty Liver Disease by Reducing Hepatic Lipid Accumulation, Oxidative Stress and Inflammatory Response. Antioxidants, 10(4), 565. https://doi.org/10.3390/antiox10040565