Tannin Supplementation Improves Oocyte Cytoplasmic Maturation and Subsequent Embryo Development in Pigs
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. In Vitro Maturation of Porcine Oocytes
2.3. Evaluation of Cumulus Expansion Index
2.4. Assessment of Oocyte Nuclear Maturation
2.5. Detection of GSH and ROS Levels in Porcine Oocytes
2.6. Measurement of ATP Contents in Porcine Oocytes
2.7. Analysis of Protein Expression by Immunofluorescence Staining in Oocytes
2.8. Parthenogenetic Activation
2.9. In Vitro Fertilization
2.10. Somatic Cell Nuclear Transfer
2.11. Analysis of Gene Expression by Quantitative Real-Time PCR
2.12. Statistical Analysis
3. Results
3.1. TA Increased Cumulus Expansion during IVM
3.2. TA Affected Oocyte Maturation during IVM
3.3. TA Regulated Cumulus Expansion and Oocyte Development Genes Expression
3.4. TA Regulated GSH, ROS and ATP Levels in Oocytes
3.5. TA Up-Regulated Oocyte-Development-Related Markers
3.6. TA Improved Embryo Development after PA, IVF and SCNT
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jin, J.; Lee, S.; Setyawan, E.M.N.; Taweechaipaisankul, A.; Kim, G.A.; Han, H.J.; Ahn, C.; Lee, B.C. A potential role of knockout serum replacement as a porcine follicular fluid substitute for in vitro maturation: Lipid metabolism approach. J. Cell. Physiol. 2018, 233, 6984–6995. [Google Scholar] [CrossRef] [PubMed]
- Vajta, G.; Rienzi, L.; Cobo, A.; Yovich, J. Embryo culture: Can we perform better than nature? Reprod. Biomed. Online 2010, 20, 453–469. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nagesh, P.K.B.; Chowdhury, P.; Hatami, E.; Jain, S.; Dan, N.; Kashyap, V.K.; Chauhan, S.C.; Jaggi, M.; Yallapu, M.M. Tannic acid inhibits lipid metabolism and induce ROS in prostate cancer cells. Sci. Rep. 2020, 10, 980. [Google Scholar] [CrossRef] [PubMed]
- Kaczmarek, B. Tannic Acid with Antiviral and Antibacterial Activity as A Promising Component of Biomaterials—A Minireview. Materials 2020, 13, 3224. [Google Scholar] [CrossRef] [PubMed]
- Melone, F.; Saladino, R.; Lange, H.; Crestini, C. Tannin structural elucidation and quantitative 31P NMR analysis. 1. Model compounds. J. Agric. Food Chem. 2013, 61, 9307–9315. [Google Scholar] [CrossRef] [Green Version]
- Chung, K.-T.; Wong, T.Y.; Wei, C.-I.; Huang, Y.-W.; Lin, Y. Tannins and Human Health: A Review. Crit. Rev. Food Sci. Nutr. 1998, 38, 421–464. [Google Scholar] [CrossRef]
- Yuan, Y.; Li, L.; Zhao, J.; Chen, M. Effect of Tannic Acid on Nutrition and Activities of Detoxification Enzymes and Acetylcholinesterase of the Fall Webworm (Lepidoptera: Arctiidae). J. Insect Sci. 2020, 20, 8. [Google Scholar] [CrossRef]
- Khalifa, I.; Zhu, W.; Mohammed, H.H.H.; Dutta, K.; Li, C. Tannins inhibit SARS-CoV-2 through binding with catalytic dyad residues of 3CLpro: An in silico approach with 19 structural different hydrolysable tannins. J. Food Biochem. 2020, 44, e13432. [Google Scholar] [CrossRef]
- Roychoudhury, S.; Agarwal, A.; Virk, G.; Cho, C.-L. Potential role of green tea catechins in the management of oxidative stress-associated infertility. Reprod. Biomed. Online 2017, 34, 487–498. [Google Scholar] [CrossRef] [Green Version]
- Manzoor, F.; Nisa, M.U.; Hussain, H.A.; Ahmad, N.; Umbreen, H. Effect of different levels of hydrolysable tannin intake on the reproductive hormones and serum biochemical indices in healthy female rats. Sci. Rep. 2020, 10, 1–8. [Google Scholar] [CrossRef]
- Sallam, S.M.; Attia, M.F.; El-Din, A.N.N.; El-Zarkouny, S.Z.; Saber, A.M.; El-Zaiat, H.M.; Zeitoun, M.M. Involvement of Quebracho tannins in diet alters productive and reproductive efficiency of postpartum buffalo cows. Anim. Nutr. 2018, 5, 80–86. [Google Scholar] [CrossRef]
- Spinaci, M.; Muccilli, V.; Bucci, D.; Cardullo, N.; Gadani, B.; Tringali, C.; Tamanini, C.; Galeati, G. Biological effects of polyphenol-rich extract and fractions from an oenological oak-derived tannin on in vitro swine sperm capacitation and fertilizing ability. Theriogenology 2018, 108, 284–290. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Galeati, G.; Bucci, D.; Nerozzi, C.; Gadani, B.; Tamanini, C.; Mislei, B.; Spinaci, M. Improvement of in vitro fertilization by a tannin rich vegetal extract addition to frozen thawed boar sperm. Anim. Reprod. 2020, 17, e20190130. [Google Scholar] [CrossRef]
- Spinaci, M.; Bucci, D.; Muccilli, V.; Cardullo, N.; Nerozzi, C.; Galeati, G. A polyphenol-rich extract from an oenological oak-derived tannin influences in vitro maturation of porcine oocytes. Theriogenology 2019, 129, 82–89. [Google Scholar] [CrossRef]
- Tatemoto, H.; Tokeshi, I.; Nakamura, S.; Muto, N.; Nakada, T. Inhibition of boar sperm hyaluronidase activity by tannic acid reduces polyspermy during in vitro fertilization of porcine oocytes. Zygote 2006, 14, 275–285. [Google Scholar] [CrossRef]
- Lee, S.; Jin, J.-X.; Taweechaipaisankul, A.; Kim, G.A.; Ahn, C.; Lee, B.C. Melatonin influences the sonic hedgehog signaling pathway in porcine cumulus oocyte complexes. J. Pineal Res. 2017, 63, e12424. [Google Scholar] [CrossRef]
- Lourenço, S.C.; Moldão-Martins, M.; Alves, V.D. Antioxidants of Natural Plant Origins: From Sources to Food Industry Applications. Molecules 2019, 24, 4132. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, S.; Zhao, Y.; Feng, Y.; Zhang, H.; Li, L.; Shen, W.; Zhao, M.; Min, L. beta-carotene improves oocyte development and maturation under oxidative stress in vitro. Vitr. Cell. Dev. Biol.-Anim. 2019, 55, 548–558. [Google Scholar] [CrossRef] [PubMed]
- You, J.; Kim, J.; Lim, J.; Lee, E. Anthocyanin stimulates in vitro development of cloned pig embryos by increasing the intracellular glutathione level and inhibiting reactive oxygen species. Theriogenology 2010, 74, 777–785. [Google Scholar] [CrossRef]
- Kang, J.-T.; Moon, J.H.; Choi, J.-Y.; Park, S.J.; Kim, S.J.; Saadeldin, I.M.; Lee, B.C. Effect of Antioxidant Flavonoids (Quercetin and Taxifolin) on In vitro Maturation of Porcine Oocytes. Asian-Australas. J. Anim. Sci. 2016, 29, 352–358. [Google Scholar] [CrossRef] [Green Version]
- Watanabe, H.; Okawara, S.; Bhuiyan, M.; Fukui, Y. Effect of Lycopene on Cytoplasmic Maturation of Porcine OocytesIn Vitro. Reprod. Domest. Anim. 2009, 45, 838–845. [Google Scholar] [CrossRef] [PubMed]
- Atikuzzaman, M.; Koo, O.J.; Kang, J.-T.; Kwon, D.K.; Park, S.J.; Kim, S.J.; Gomez, M.N.L.; Oh, H.J.; Hong, S.G.; Jang, G.; et al. The 9-Cis Retinoic Acid Signaling Pathway and Its Regulation of Prostaglandin-Endoperoxide Synthase 2 during In Vitro Maturation of Pig Cumulus Cell-Oocyte Complexes and Effects on Parthenogenetic Embryo Production1. Biol. Reprod. 2011, 84, 1272–1281. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Von Mengden, L.; Klamt, F.; Smitz, J. Redox Biology of Human Cumulus Cells: Basic Concepts, Impact on Oocyte Quality, and Potential Clinical Use. Antioxid. Redox Signal. 2020, 32, 522–535. [Google Scholar] [CrossRef] [Green Version]
- Aardema, H.; Lolicato, F.; van de Lest, C.H.; Brouwers, J.F.; Vaandrager, A.B.; Van Tol, H.T.; Roelen, B.A.; Vos, P.L.; Helms, J.B.; Gadella, B.M. Bovine Cumulus Cells Protect Maturing Oocytes from Increased Fatty Acid Levels by Massive Intracellular Lipid Storage. Biol. Reprod. 2013, 88, 164. [Google Scholar] [CrossRef] [PubMed]
- Aardema, H.; van Tol, H.T.; Wubbolts, R.W.; Brouwers, J.F.; Gadella, B.M.; Roelen, B.A. Stearoyl-CoA desaturase activity in bovine cumulus cells protects the oocyte against saturated fatty acid stress. Biol. Reprod. 2017, 96, 982–992. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Assidi, M.; Montag, M.; Sirard, M.-A. Use of Both Cumulus Cells’ Transcriptomic Markers and Zona Pellucida Birefringence to Select Developmentally Competent Oocytes in Human Assisted Reproductive Technologies. BMC Genom. 2015, 16, S9. [Google Scholar] [CrossRef] [Green Version]
- Zhou, C.-J.; Wu, S.-N.; Shen, J.-P.; Wang, D.-H.; Kong, X.-W.; Lu, A.; Li, Y.-J.; Zhou, H.-X.; Zhao, Y.-F.; Liang, C.-G. The beneficial effects of cumulus cells and oocyte-cumulus cell gap junctions depends on oocyte maturation and fertilization methods in mice. PeerJ 2016, 4, e1761. [Google Scholar] [CrossRef]
- Zhou, H.-X.; Ma, Y.-Z.; Liu, Y.-L.; Chen, Y.; Zhou, C.-J.; Wu, S.-N.; Shen, J.-P.; Liang, C.-G. Assessment of Mouse Germinal Vesicle Stage Oocyte Quality by Evaluating the Cumulus Layer, Zona Pellucida, and Perivitelline Space. PLoS ONE 2014, 9, e105812. [Google Scholar] [CrossRef]
- Auclair, S.; Uzbekov, R.; Elis, S.; Sanchez, L.; Kireev, I.; Lardic, L.; Dalbies-Tran, R.; Uzbekova, S. Absence of cumulus cells during in vitro maturation affects lipid metabolism in bovine oocytes. Am. J. Physiol. Metab. 2013, 304, E599–E613. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, L.; Russell, P.T.; Larsen, W.J. Functional significance of cumulus expansion in the mouse: Roles for the preovulatory synthesis of hyaluronic acid within the cumulus mass. Mol. Reprod. Dev. 1993, 34, 87–93. [Google Scholar] [CrossRef]
- McKenzie, L.; Pangas, S.; Carson, S.; Kovanci, E.; Cisneros, P.; Buster, J.; Amato, P.; Matzuk, M. Human cumulus granulosa cell gene expression: A predictor of fertilization and embryo selection in women undergoing IVF. Hum. Reprod. 2004, 19, 2869–2874. [Google Scholar] [CrossRef] [Green Version]
- Sugiura, K.; Su, Y.-Q.; Eppig, J.J. Targeted suppression ofHas2mRNA in mouse cumulus cell-oocyte complexes by adenovirus-mediated short-hairpin RNA expression. Mol. Reprod. Dev. 2008, 76, 537–547. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fülöp, C.; Szántó, S.; Mukhopadhyay, D.; Bárdos, T.; Kamath, R.V.; Rugg, M.S.; Day, A.; Salustri, A.; Hascall, V.C.; Glant, T.T.; et al. Impaired cumulus mucification and female sterility in tumor necrosis factor-induced protein-6 deficient mice. Development 2003, 130, 2253–2261. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salustri, A.; Garlanda, C.; Hirsch, E.; De Acetis, M.; Maccagno, A.; Bottazzi, B.; Doni, A.; Bastone, A.; Mantovani, G.; Peccoz, P.B.; et al. PTX3 plays a key role in the organization of the cumulus oophorus extracellular matrix and in in vivo fertilization. Development 2004, 131, 1577–1586. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shi, P.; Xu, J.; Zhao, X.; Shen, P.; Wen, D.; Yu, Q.; Deng, Y.; Shi, D.; Lu, F. CK1 inhibitor affects in vitro maturation and developmental competence of bovine oocytes. Reprod. Domest. Anim. 2019, 54, 1104–1112. [Google Scholar] [CrossRef] [PubMed]
- Gilchrist, R.B.; Luciano, A.M.; Richani, D.; Zeng, H.T.; Wang, X.; De Vos, M.; Sugimura, S.; Smitz, J.; Richard, F.J.; Thompson, J.G. Oocyte maturation and quality: Role of cyclic nucleotides. Reproduction 2016, 152, R143–R157. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nebreda, A.R.; Ferby, I. Regulation of the meiotic cell cycle in oocytes. Curr. Opin. Cell Biol. 2000, 12, 666–675. [Google Scholar] [CrossRef]
- Araki, K.; Naito, K.; Haraguchi, S.; Suzuki, R.; Yokoyama, M.; Inoue, M.; Aizawa, S.; Toyoda, Y.; Sato, E. Meiotic Abnormalities of c-mos Knockout Mouse Oocytes: Activation after First Meiosis or Entrance into Third Meiotic Metaphase1. Biol. Reprod. 1996, 55, 1315–1324. [Google Scholar] [CrossRef]
- Zhao, M.-H.; Jin, Y.-X.; Lee, S.-K.; Kim, N.-H.; Cui, X.-S. Artificial control maturation of porcine oocyte by dibutyryl cyclicAMP. Anim. Cells Syst. 2014, 18, 52–58. [Google Scholar] [CrossRef]
- Zhang, D.-X.; Cui, X.-S.; Kim, N.-H. Molecular characterization and polyadenylation-regulated expression of cyclin B1 and Cdc2 in porcine oocytes and early parthenotes. Mol. Reprod. Dev. 2009, 77, 38–50. [Google Scholar] [CrossRef]
- Adriaenssens, T.; Segers, I.; Wathlet, S.; Smitz, J. The cumulus cell gene expression profile of oocytes with different nuclear maturity and potential for blastocyst formation. J. Assist. Reprod. Genet. 2010, 28, 31–40. [Google Scholar] [CrossRef] [Green Version]
- Lin, Z.-L.; Li, Y.-H.; Xu, Y.-N.; Wang, Q.-L.; Namgoong, S.; Cui, X.-S.; Kim, N.-H. Effects of Growth Differentiation Factor 9 and Bone Morphogenetic Protein 15 on the in vitro Maturation of Porcine Oocytes. Reprod. Domest. Anim. 2013, 49, 219–227. [Google Scholar] [CrossRef]
- Huang, Z.; Wells, D. The human oocyte and cumulus cells relationship: New insights from the cumulus cell transcriptome. Mol. Hum. Reprod. 2010, 16, 715–725. [Google Scholar] [CrossRef] [Green Version]
- Jin, J.X.; Lee, S.; Khoirinaya, C.; Oh, A.; Kim, G.A.; Lee, B.C. Supplementation with spermine during in vitro maturation of porcine oocytes improves early embryonic development after parthenogenetic activation and somatic cell nuclear transfer1. J. Anim. Sci. 2016, 94, 963–970. [Google Scholar] [CrossRef]
- Chi, L.; Ke, Y.; Luo, C.; Gozal, D.; Liu, R. Depletion of reduced glutathione enhances motor neuron degeneration in vitro and in vivo. Neuroscience 2007, 144, 991–1003. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fischer, L.R.; Li, Y.; Asress, S.A.; Jones, D.P.; Glass, J.D. Absence of SOD1 leads to oxidative stress in peripheral nerve and causes a progressive distal motor axonopathy. Exp. Neurol. 2011, 233, 163–171. [Google Scholar] [CrossRef] [Green Version]
- Tafuri, F.; Ronchi, D.; Magri, F.; Comi, G.P.; Corti, S. SOD1 misplacing and mitochondrial dysfunction in amyotrophic lateral sclerosis pathogenesis. Front. Cell. Neurosci. 2015, 9, 336. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, X.; Hu, H.; Luo, J.; Deng, H.; Yu, P.; Zhang, Z.; Zhang, G.; Shan, L.; Wang, Y. A Novel Danshensu-Tetramethylpyrazine Conjugate DT-010 Provides Cardioprotection through the PGC-1alpha/Nrf2/HO-1 Pathway. Biol. Pharm. Bull. 2017, 40, 1490–1498. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zou, Y.; Wang, J.; Peng, J.; Wei, H. Oregano Essential Oil Induces SOD1 and GSH Expression through Nrf2 Activation and Alleviates Hydrogen Peroxide-Induced Oxidative Damage in IPEC-J2 Cells. Oxidative Med. Cell. Longev. 2016, 2016, 1–13. [Google Scholar] [CrossRef]
- Kim, E.; Ridlo, M.; Lee, B.; Kim, G. Melatonin-Nrf2 Signaling Activates Peroxisomal Activities in Porcine Cumulus Cell-Oocyte Complexes. Antioxidants 2020, 9, 1080. [Google Scholar] [CrossRef]
- You, Y.; Hou, Y.; Zhai, X.; Li, Z.; Li, L.; Zhao, Y.; Zhao, J. Protective effects of PGC-1α via the mitochondrial pathway in rat brains after intracerebral hemorrhage. Brain Res. 2016, 1646, 34–43. [Google Scholar] [CrossRef]
- Mohd, S.; Heena, T.; Suhel, P. Tannic Acid Provides Neuroprotective Effects Against Traumatic Brain Injury through the PGC-1alpha/Nrf2/HO-1 Pathway. Mol. Neurobiol. 2020, 57, 2870–2885. [Google Scholar]
- Yamada, M.; Isaji, Y. Structural and functional changes linked to, and factors promoting, cytoplasmic maturation in mammalian oocytes. Reprod. Med. Biol. 2011, 10, 69–79. [Google Scholar] [CrossRef] [PubMed]
- Yokoo, M.; Kimura, N.; Sato, E. Induction of Oocyte Maturation by Hyaluronan-CD44 Interaction in Pigs. J. Reprod. Dev. 2010, 56, 15–19. [Google Scholar] [CrossRef] [Green Version]
- Zhuo, L.; Yoneda, M.; Zhao, M.; Yingsung, W.; Yoshida, N.; Kitagawa, Y.; Kawamura, K.; Suzuki, T.; Kimata, K. Defect in SHAP-Hyaluronan Complex Causes Severe Female Infertility. J. Biol. Chem. 2001, 276, 7693–7696. [Google Scholar] [CrossRef] [Green Version]
- Varani, S.; Elvin, J.A.; Yan, C.; DeMayo, J.; DeMayo, F.J.; Horton, H.F.; Byrne, M.C.; Matzuk, M.M. Knockout of pentraxin 3, a downstream target of growth differentiation factor-9, causes female subfertility. Mol. Endocrinol. 2002, 16, 1154–1167. [Google Scholar] [CrossRef]
- Yokoo, M.; Sato, E. Physiological function of hyaluronan in mammalian oocyte maturation. Reprod. Med. Biol. 2011, 10, 221–229. [Google Scholar] [CrossRef] [PubMed]
Genes | Primer Sequences (5′–3′) | Product Size (bp) | Accession No. |
---|---|---|---|
GAPDH | F: GTCGGTTGTGGATCTGACCT | 207 | NM_001206359 |
R: TTGACGAAGTGGTCGTTGAG | |||
RN18S | F: TCCAATGGATCCTCGCGGAA | 149 | NR_046261.1 |
R: GGCTACCACATCCAAGGAAG | |||
PTGS1 | F: AACACGGCACACGACTACA | 121 | XM_001926129 |
R: CTGCTTCTTCCCTTTGGTCC | |||
PTGS2 | F: ACAGGGCCATGGGGTGGACT | 194 | NM_214321 |
R: CCACGGCAAAGCGGAGGTGT | |||
PTX-3 | F: GGCCAGGGATGAATTTTAC | 185 | NM_001244783 |
R: GCTATCCTCTCCAACAAGTGA | |||
TNFAIP6 | F: AGAAGCGAAAGATGGGATGCT | 106 | NM_001159607 |
R: CATTTGGGAAGCCTGGAGATT | |||
HAS2 | F: AGTTTATGGGCAGCCAATGTAGTT | 101 | AB050389 |
R: GCACTTGGACCGAGCTGTGT | |||
BMP15 | F: CCTCCATCCTTTCCAAGTCA | 112 | NM_001005155 |
R: GTGTAGTACCCGAGGGCAGA | |||
GDF9 | F: CAGTCAGCTGAAGTGGGACA | 135 | AY626786 |
R: TGGATGATGTTCTGCACCAT | |||
C-MOS | F: GGGAGCAACTGAACTTGGAG | 115 | NM_001113219 |
R: AGAATGTTCGCTGGCTTCAG | |||
CDC2 | F: GGGCACTCCCAATAATGAAGT | 260 | AB045783 |
R: GTTCTTGATACAACGTGTGGGAA | |||
CYCLINB1 | F: CAACTGGTTGGTGTCACTGC | 126 | L48205 |
R: TTCCATCTGCCTGATTTGGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yin, Z.; Sun, J.-T.; Cui, H.-D.; Jiang, C.-Q.; Zhang, Y.-T.; Lee, S.; Liu, Z.-H.; Jin, J.-X. Tannin Supplementation Improves Oocyte Cytoplasmic Maturation and Subsequent Embryo Development in Pigs. Antioxidants 2021, 10, 1594. https://doi.org/10.3390/antiox10101594
Yin Z, Sun J-T, Cui H-D, Jiang C-Q, Zhang Y-T, Lee S, Liu Z-H, Jin J-X. Tannin Supplementation Improves Oocyte Cytoplasmic Maturation and Subsequent Embryo Development in Pigs. Antioxidants. 2021; 10(10):1594. https://doi.org/10.3390/antiox10101594
Chicago/Turabian StyleYin, Zhi, Jing-Tao Sun, Hong-Di Cui, Chao-Qian Jiang, Yu-Ting Zhang, Sanghoon Lee, Zhong-Hua Liu, and Jun-Xue Jin. 2021. "Tannin Supplementation Improves Oocyte Cytoplasmic Maturation and Subsequent Embryo Development in Pigs" Antioxidants 10, no. 10: 1594. https://doi.org/10.3390/antiox10101594
APA StyleYin, Z., Sun, J.-T., Cui, H.-D., Jiang, C.-Q., Zhang, Y.-T., Lee, S., Liu, Z.-H., & Jin, J.-X. (2021). Tannin Supplementation Improves Oocyte Cytoplasmic Maturation and Subsequent Embryo Development in Pigs. Antioxidants, 10(10), 1594. https://doi.org/10.3390/antiox10101594