Maternal Resveratrol Supplementation Attenuates Prenatal Stress Impacts on Anxiety- and Depressive-like Behaviors by Regulating Bdnf Transcripts Expression in the Brains of Adult Male Offspring Rats
Abstract
1. Introduction
2. Materials and Methods
2.1. Drugs
2.2. Animals
2.3. Experimental Groups
2.4. Model of Restraint of Movement
2.5. Open Field Test
2.6. Elevate Plus Maze
2.7. Forced Swimming Test
2.8. Tissue Preparation
2.9. RNA Isolation
2.10. Real-Time Quantitative PCR
2.11. Statistical Analyses
3. Results
3.1. Litter Size and Body Weight of Pups
3.2. Open Field Activity
3.3. Elevated Plus Maze
3.4. Forced Swimming Test
3.5. Gene Expression of Bdnf
3.6. Molecular and Behavioral Correlations
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Barker, D.J. A new model for the origins of chronic disease. Med. Health Care Philos. 2001, 4, 31–35. [Google Scholar] [CrossRef] [PubMed]
- Baker, S.L.; Mileva, G.; Huta, V.; Bielajew, C. In utero programming alters adult response to chronic mild stress: Part 3 of a longitudinal study. Brain Res. 2014, 1588, 175–189. [Google Scholar] [CrossRef] [PubMed]
- Van den Bergh, B.R.H.; van den Heuvel, M.I.; Lahti, M.; Braeken, M.; de Rooij, S.R.; Entringer, S.; Hoyer, D.; Roseboom, T.; Räikkönen, K.; King, S.; et al. Prenatal developmental origins of behavior and mental health: The influence of maternal stress in pregnancy. Neurosci. Biobehav. Rev. 2020, 117, 26–64. [Google Scholar] [CrossRef]
- Krontira, A.C.; Cruceanu, C.; Binder, E.B. Glucocorticoids as Mediators of Adverse Outcomes of Prenatal Stress. Trends Neurosci. 2020, 43, 394–405. [Google Scholar] [CrossRef] [PubMed]
- Haq, S.U.; Bhat, U.A.; Kumar, A. Prenatal stress effects on offspring brain and behavior: Mediators, alterations and dysregulated epigenetic mechanisms. J. Biosci. 2021, 46, 34. [Google Scholar] [CrossRef]
- Han, V.X.; Patel, S.; Jones, H.F.; Dale, R.C. Maternal immune activation and neuroinflammation in human neurodevelopmental disorders. Nat. Rev. Neurol. 2021, 17, 564–579. [Google Scholar] [CrossRef] [PubMed]
- Nazzari, S.; Frigerio, A. The programming role of maternal antenatal inflammation on infants’ early neurodevelopment: A review of human studies: Special Section on “Translational and Neuroscience Studies in Affective Disorders” Section Editor, Maria Nobile MD, PhD. J. Affect Disord. 2020, 263, 739–746. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.R.; Bale, T.L.; Epperson, C.N. Prenatal programming of mental illness: Current understanding of relationship and mechanisms. Curr. Psychiatry Rep. 2015, 17, 5. [Google Scholar] [CrossRef] [PubMed]
- Badihian, N.; Daniali, S.S.; Kelishadi, R. Transcriptional and epigenetic changes of brain derived neurotrophic factor following prenatal stress: A systematic review of animal studies. Neurosci. Biobehav. Rev. 2020, 117, 211–231. [Google Scholar] [CrossRef] [PubMed]
- Kowiański, P.; Lietzau, G.; Czuba, E.; Waśkow, M.; Steliga, A.; Moryś, J. BDNF: A Key Factor with Multipotent Impact on Brain Signaling and Synaptic Plasticity. Cell Mol. Neurobiol. 2018, 38, 579–593. [Google Scholar] [CrossRef]
- Miao, Z.; Wang, Y.; Sun, Z. The Relationships Between Stress, Mental Disorders, and Epigenetic Regulation of BDNF. Int. J. Mol. Sci. 2020, 21, 1375. [Google Scholar] [CrossRef]
- Balaratnasingam, S.; Janca, A. Brain Derived Neurotrophic Factor: A novel neurotrophin involved in psychiatric and neurological disorders. Pharmacol. Ther. 2012, 134, 116–124. [Google Scholar] [CrossRef]
- Miranda, M.; Morici, J.F.; Zanoni, M.B.; Bekinschtein, P. Brain-Derived Neurotrophic Factor: A Key Molecule for Memory in the Healthy and the Pathological Brain. Front. Cell Neurosci. 2019, 13, 363. [Google Scholar] [CrossRef]
- Farhan, M.; Rizvi, A. The Pharmacological Properties of Red Grape Polyphenol Resveratrol: Clinical Trials and Obstacles in Drug Development. Nutrients 2023, 15, 4486. [Google Scholar] [CrossRef] [PubMed]
- Faisal, Z.; Mazhar, A.; Batool, S.A.; Akram, N.; Hassan, M.; Khan, M.U.; Afzaal, M.; Hassan, U.U.; Shah, Y.A.; Desta, D.T. Exploring the multimodal health-promoting properties of resveratrol: A comprehensive review. Food Sci. Nutr. 2024, 12, 2240–2258. [Google Scholar] [CrossRef] [PubMed]
- Moore, A.; Beidler, J.; Hong, M.Y. Resveratrol and Depression in Animal Models: A Systematic Review of the Biological Mechanisms. Molecules 2018, 23, 2197. [Google Scholar] [CrossRef]
- Shayganfard, M. Molecular and biological functions of resveratrol in psychiatric disorders: A review of recent evidence. Cell Biosci. 2020, 10, 128. [Google Scholar] [CrossRef]
- Wei, R.M.; Zhang, Y.M.; Feng, Y.Z.; Zhang, K.X.; Zhang, J.Y.; Chen, J.; Luo, B.L.; Li, X.Y.; Chen, G.H. Resveratrol ameliorates maternal separation-induced anxiety- and depression-like behaviors and reduces Sirt1-NF-kB signaling-mediated neuroinflammation. Front Behav. Neurosci. 2023, 17, 1172091. [Google Scholar] [CrossRef] [PubMed]
- Reagan-Shaw, S.; Nihal, M.; Ahmad, N. Dose translation from animal to human studies revisited. FASEB J. 2008, 22, 659–661. [Google Scholar] [CrossRef] [PubMed]
- Brown, K.; Theofanous, D.; Britton, R.G.; Aburido, G.; Pepper, C.; Sri Undru, S.; Howells, L. Resveratrol for the Management of Human Health: How Far Have We Come? A Systematic Review of Resveratrol Clinical Trials to Highlight Gaps and Opportunities. IJMS 2024, 25, 747. [Google Scholar] [CrossRef] [PubMed]
- Weinstock, M. Prenatal stressors in rodents: Effects on behavior. Neurobiol. Stress. 2016, 6, 3–13. [Google Scholar] [CrossRef]
- Frasch, M.G.; Baier, C.J.; Antonelli, M.C.; Metz, G.A.S. Perinatal Psychoneuroimmunology: Protocols for the Study of Prenatal Stress and Its Effects on Fetal and Postnatal Brain Development. Methods Mol. Biol. 2018, 1781, 353–376. [Google Scholar] [CrossRef]
- Benmhammed, H.; El Hayek, S.; Berkik, I.; Elmostafi, H.; Bousalham, R.; Mesfioui, A.; Ouichou, A.; El Hessni, A. Animal Models of Early-Life Adversity. Methods Mol. Biol. 2019, 2011, 143–161. [Google Scholar] [CrossRef]
- Festing, M.F. Design and statistical methods in studies using animal models of development. ILAR J. 2006, 47, 5–14. [Google Scholar] [CrossRef]
- Holson, R.R.; Pearce, B. Principles and pitfalls in the analysis of prenatal treatment effects in multiparous species. Neurotoxicol Teratol. 1992, 14, 221–228. [Google Scholar] [CrossRef] [PubMed]
- Molina, P.; Andero, R.; Armario, A. Restraint or immobilization: A comparison of methodologies for restricting free movement in rodents and their potential impact on physiology and behavior. Neurosci. Biobehav. Rev. 2023, 151, 105224. [Google Scholar] [CrossRef] [PubMed]
- Weinstock, M. Alterations induced by gestational stress in brain morphology and behaviour of the offspring. Prog. Neurobiol. 2001, 65, 427–451. [Google Scholar] [CrossRef]
- Seibenhener, M.L.; Wooten, M.C. Use of the Open Field Maze to measure locomotor and anxiety-like behavior in mice. J. Vis. Exp. 2015, 96, e52434. [Google Scholar] [CrossRef]
- Kraeuter, A.K.; Guest, P.C.; Sarnyai, Z. The Open Field Test for Measuring Locomotor Activity and Anxiety-Like Behavior. Methods Mol. Biol. 2019, 1916, 99–103. [Google Scholar] [CrossRef]
- Pellow, S.; Chopin, P.; File, S.E.; Briley, M. Validation of open: Closed arm entries in an elevated plus-maze as a measure of anxiety in the rat. J. Neurosci. Methods 1985, 14, 149–167. [Google Scholar] [CrossRef]
- Porsolt, R.D.; Le Pichon, M.; Jalfre, M. Depression: A new animal model sensitive to antidepressant treatments. Nature 1977, 266, 730–732. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Barker, D.J. The developmental origins of chronic adult disease. Acta Paediatr. Suppl. 2004, 93, 26–33. [Google Scholar] [CrossRef] [PubMed]
- Barker, D.J.; Osmond, C.; Rodin, I.; Fall, C.H.; Winter, P.D. Low weight gain in infancy and suicide in adult life. BMJ 1995, 311, 1203. [Google Scholar] [CrossRef] [PubMed]
- Maccari, S.; Morley-Fletcher, S. Effects of prenatal restraint stress on the hypothalamus-pituitary-adrenal axis and related behavioural and neurobiological alterations. Psychoneuroendocrinology 2007, 32 (Suppl. S1), S10–S15. [Google Scholar] [CrossRef]
- Baker, S.; Chebli, M.; Rees, S.; Lemarec, N.; Godbout, R.; Bielajew, C. Effects of gestational stress: 1. Evaluation of maternal and juvenile offspring behavior. Brain Res. 2008, 1213, 98–110. [Google Scholar] [CrossRef] [PubMed]
- Baker, S.; Rees, S.; Chebli, M.; Lemarec, N.; Godbout, R.; Huta, V.; Bielajew, C. Effects of gestational stress: 2. Evaluation of male and female adult offspring. Brain Res. 2009, 1302, 194–204. [Google Scholar] [CrossRef] [PubMed]
- Nicolaides, N.C.; Kanaka-Gantenbein, C.; Pervanidou, P. Developmental Neuroendocrinology of Early-Life Stress: Impact on Child Development and Behavior. Curr. Neuropharmacol. 2024, 22, 461–474. [Google Scholar] [CrossRef] [PubMed]
- Anifantaki, F.; Pervanidou, P.; Lambrinoudaki, I.; Panoulis, K.; Vlahos, N.; Eleftheriades, M. Maternal Prenatal Stress, Thyroid Function and Neurodevelopment of the Offspring: A Mini Review of the Literature. Front. Neurosci. 2021, 15, 692446. [Google Scholar] [CrossRef] [PubMed]
- Baier, C.J.; Katunar, M.R.; Adrover, E.; Pallarés, M.E.; Antonelli, M.C. Gestational restraint stress and the developing dopaminergic system: An overview. Neurotox. Res. 2012, 22, 16–32. [Google Scholar] [CrossRef] [PubMed]
- Sun, H.; Guan, L.; Zhu, Z.; Li, H. Reduced levels of NR1 and NR2A with depression-like behavior in different brain regions in prenatally stressed juvenile offspring. PLoS ONE 2013, 8, e81775. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Ma, Y.; Chen, J.; Yao, D.; Feng, C.; Dong, Y.; Ren, Y.; Ma, H.; Wang, Z.; Li, G.; et al. Effects of RhoA on depression-like behavior in prenatally stressed offspring rats. Behav. Brain Res. 2022, 432, 113973. [Google Scholar] [CrossRef]
- Zohar, I.; Shoham, S.; Weinstock, M. Perinatal citalopram does not prevent the effect of prenatal stress on anxiety, depressive-like behaviour and serotonergic transmission in adult rat offspring. Eur. J. Neurosci. 2016, 43, 590–600. [Google Scholar] [CrossRef] [PubMed]
- Oosterhof, C.A.; El Mansari, M.; Merali, Z.; Blier, P. Altered monoamine system activities after prenatal and adult stress: A role for stress resilience? Brain Res. 2016, 1642, 409–418. [Google Scholar] [CrossRef]
- Roshan-Milani, S.; Seyyedabadi, B.; Saboory, E.; Parsamanesh, N.; Mehranfard, N. Prenatal stress and increased susceptibility to anxiety-like behaviors: Role of neuroinflammation and balance between GABAergic and glutamatergic transmission. Stress 2021, 24, 481–495. [Google Scholar] [CrossRef] [PubMed]
- Colucci-D’Amato, L.; Speranza, L.; Volpicelli, F. Neurotrophic Factor BDNF, Physiological Functions and Therapeutic Potential in Depression, Neurodegeneration and Brain Cancer. Int. J. Mol. Sci. 2020, 21, 7777. [Google Scholar] [CrossRef]
- Aid, T.; Kazantseva, A.; Piirsoo, M.; Palm, K.; Timmusk, T. Mouse and rat BDNF gene structure and expression revisited. J. Neurosci. Res. 2007, 85, 525–535. [Google Scholar] [CrossRef] [PubMed]
- Begni, V.; Riva, M.A.; Cattaneo, A. Cellular and molecular mechanisms of the brain-derived neurotrophic factor in physiological and pathological conditions. Clin. Sci. 2017, 131, 123–138. [Google Scholar] [CrossRef]
- You, H.; Lu, B. Diverse Functions of Multiple Bdnf Transcripts Driven by Distinct Bdnf Promoters. Biomolecules 2023, 13, 655. [Google Scholar] [CrossRef] [PubMed]
- Russo-Neustadt, A.A.; Beard, R.C.; Huang, Y.M.; Cotman, C.W. Physical activity and antidepressant treatment potentiate the expression of specific brain-derived neurotrophic factor transcripts in the rat hippocampus. Neuroscience 2000, 101, 305–312. [Google Scholar] [CrossRef] [PubMed]
- Dias, B.G.; Banerjee, S.B.; Duman, R.S.; Vaidya, V.A. Differential regulation of brain derived neurotrophic factor transcripts by antidepressant treatments in the adult rat brain. Neuropharmacology 2003, 45, 553–563. [Google Scholar] [CrossRef] [PubMed]
- Pathak, H.; Borchert, A.; Garaali, S.; Burkert, A.; Frieling, H. BDNF exon IV promoter methylation and antidepressant action: A complex interplay. Clin. Epigenetics 2022, 14, 187. [Google Scholar] [CrossRef] [PubMed]
- Sakata, K.; Jin, L.; Jha, S. Lack of promoter IV-driven BDNF transcription results in depression-like behavior. Genes Brain Behav. 2010, 9, 712–721. [Google Scholar] [CrossRef]
- Abdelkhalek, K.; Rhein, M.; Deest, M.; Buchholz, V.; Bleich, S.; Lichtinghagen, R.; Vyssoki, B.; Frieling, H.; Muschler, M.; Proskynitopoulos, P.J.; et al. Dysregulated Methylation Patterns in Exon IV of the Brain-Derived Neurotrophic Factor (BDNF) Gene in Nicotine Dependence and Changes in BDNF Plasma Levels During Smoking Cessation. Front. Psychiatry 2022, 13, 897801. [Google Scholar] [CrossRef] [PubMed]
- Sakata, K.; Martinowich, K.; Woo, N.H.; Schloesser, R.J.; Jimenez, D.V.; Ji, Y.; Shen, L.; Lu, B. Role of activity-dependent BDNFexpression in hippocampal-prefrontal cortical regulation of behavioral perseverance. Proc. Natl. Acad. Sci. USA 2013, 110, 15103–15108. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Li, S.; Zhang, T.; Yang, F.; Lu, B. Corticosterone antagonist or TrkB agonist attenuates schizophrenia-like behavior in a mouse model combining Bdnf-e6 deficiency and developmental stress. iScience 2022, 25, 104609. [Google Scholar] [CrossRef] [PubMed]
- Sakata, K.; Woo, N.H.; Martinowich, K.; Greene, J.S.; Schloesser, R.J.; Shen, L.; Lu, B. Critical role of promoter IV-driven BDNF transcription in GABAergic transmission and synaptic plasticity in the prefrontal cortex. Proc. Natl. Acad. Sci. USA 2009, 106, 5942–5947. [Google Scholar] [CrossRef] [PubMed]
- Naert, G.; Ixart, G.; Maurice, T.; Tapia-Arancibia, L.; Givalois, L. Brain-derived neurotrophic factor and hypothalamic-pituitary-adrenal axis adaptation processes in a depressive-like state induced by chronic restraint stress. Mol. Cell Neurosci. 2011, 46, 55–66. [Google Scholar] [CrossRef]
- Boulle, F.; Pawluski, J.L.; Homberg, J.R.; Machiels, B.; Kroeze, Y.; Kumar, N.; Steinbusch, H.W.M.; Kenis, G.; van den Hove, D.L.A. Developmental fluoxetine exposure increases behavioral despair and alters epigenetic regulation of the hippocampal BDNF gene in adult female offspring. Horm. Behav. 2016, 80, 47–57. [Google Scholar] [CrossRef]
- Tomiga, Y.; Sakai, K.; Ra, S.G.; Kusano, M.; Ito, A.; Uehara, Y.; Takahashi, H.; Kawanaka, K.; Soejima, H.; Higaki, Y. Short-term running exercise alters DNA methylation patterns in neuronal nitric oxide synthase and brain-derived neurotrophic factor genes in the mouse hippocampus and reduces anxiety-like behaviors. FASEB J. 2021, 35, e21767. [Google Scholar] [CrossRef]
- Tseilikman, V.E.; Tseilikman, O.B.; Yegorov, O.N.; Brichagina, A.A.; Karpenko, M.N.; Tseilikman, D.V.; Shatilov, V.A.; Zhukov, M.S.; Novak, J. Resveratrol: A Multifaceted Guardian against Anxiety and Stress Disorders-An Overview of Experimental Evidence. Nutrients 2024, 16, 2856. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Ma, Y.; Zhang, R.; Zhong, H.; Wang, L.; Zhao, J.; Yang, L.; Fan, X. Resveratrol ameliorates estrogen deficiency-induced depression- and anxiety-like behaviors and hippocampal inflammation in mice. Psychopharmacology 2019, 236, 1385–1399. [Google Scholar] [CrossRef]
- Gu, Z.; Chu, L.; Han, Y. Therapeutic effect of resveratrol on mice with depression. Exp. Ther. Med. 2019, 17, 3061–3064. [Google Scholar] [CrossRef]
- Rahvar, M.; Nikseresht, M.; Shafiee, S.M.; Naghibalhossaini, F.; Rasti, M.; Panjehshahin, M.R.; Owji, A.A. Effect of oral resveratrol on the BDNF gene expression in the hippocampus of the rat brain. Neurochem. Res. 2011, 36, 761–765. [Google Scholar] [CrossRef] [PubMed]
- Shojaei, S.; Panjehshahin, M.R.; Shafiee, S.M.; Khoshdel, Z.; Borji, M.; Ghasempour, G.; Owji, A.A. Differential Effects of Resveratrol on the Expression of Brain-Derived Neurotrophic Factor Transcripts and Protein in the Hippocampus of Rat Brain. Iran J. Med. Sci. 2017, 42, 32–39. [Google Scholar] [PubMed]
- Armario, A. The forced swim test: Historical, conceptual and methodological considerations and its relationship with individual behavioral traits. Neurosci. Biobehav. Rev. 2021, 128, 74–86. [Google Scholar] [CrossRef]
Gene Name | Primer Forward (5′ to 3′) | Primer Reverse (5′ to 3′) |
---|---|---|
Bdnf exon IV | TGGTGGCCGATATGTACTCC | ACTGAAGGCGTGCGAGTATT |
Bdnf exon VI | TTGTTGTCACGCTCCTGGTC | GATGAGACCGGGTTCCCTCA |
Bdnf exon IX | TTCCTCCAGCAGAAAGAGCA | TCCCTGGCTGACACTTTTGA |
Gapdh | GGATGCAGGGATGATGTTC | TGCACCACCAACTGCTTAG |
Groups of Dams | Litter Size (Mean ± SEM) | No. of Pups Born | No. of Males and Females | Body Weight of Pups (g) | Changes i1n Body Weight (g) |
---|---|---|---|---|---|
CTL-VEH | 12.00 ± 0.16 | 11 to 13 | M = 4.66 ± 0.40 F = 7.33 ± 0.12 | PND1 = 7.00 ± 0.09 PND21= 48.50 ± 1.17 | 41.00 ± 1.20 |
CTL-RESV | 10.33 ± 1.85 | 9 to 12 | M = 4.66 ± 0.40 F = 5.66 ± 0.74 | PND1 = 6.70 ± 0.11 PND21 = 47.40 ± 0.66 | 40.60 ± 0.67 |
PS-VEH | 10.66 ± 0.10 | 10 to 11 | M = 5.33 ± 0.14 F = 5.33 ± 0.14 | PND1 = 6.60 ± 0.09 PND21 = 34.00 ± 0.57 | 27.50 ± 0.58 * |
PS-RESV | 12.66 ± 2.05 | 12 to 13 | M = 4.33 ± 0.43 F = 8.33 ± 0.41 | PND1 = 7.08 ± 0.13 PND21 = 51.20 ± 0.94 | 44.30 ± 0.90 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vera-Juárez, G.; Vázquez-Martínez, E.R.; Gómez-Pliego, R.; López-Martínez, M.; Espinosa-Raya, J. Maternal Resveratrol Supplementation Attenuates Prenatal Stress Impacts on Anxiety- and Depressive-like Behaviors by Regulating Bdnf Transcripts Expression in the Brains of Adult Male Offspring Rats. Brain Sci. 2025, 15, 210. https://doi.org/10.3390/brainsci15020210
Vera-Juárez G, Vázquez-Martínez ER, Gómez-Pliego R, López-Martínez M, Espinosa-Raya J. Maternal Resveratrol Supplementation Attenuates Prenatal Stress Impacts on Anxiety- and Depressive-like Behaviors by Regulating Bdnf Transcripts Expression in the Brains of Adult Male Offspring Rats. Brain Sciences. 2025; 15(2):210. https://doi.org/10.3390/brainsci15020210
Chicago/Turabian StyleVera-Juárez, Gerardo, Edgar Ricardo Vázquez-Martínez, Raquel Gómez-Pliego, Margarita López-Martínez, and Judith Espinosa-Raya. 2025. "Maternal Resveratrol Supplementation Attenuates Prenatal Stress Impacts on Anxiety- and Depressive-like Behaviors by Regulating Bdnf Transcripts Expression in the Brains of Adult Male Offspring Rats" Brain Sciences 15, no. 2: 210. https://doi.org/10.3390/brainsci15020210
APA StyleVera-Juárez, G., Vázquez-Martínez, E. R., Gómez-Pliego, R., López-Martínez, M., & Espinosa-Raya, J. (2025). Maternal Resveratrol Supplementation Attenuates Prenatal Stress Impacts on Anxiety- and Depressive-like Behaviors by Regulating Bdnf Transcripts Expression in the Brains of Adult Male Offspring Rats. Brain Sciences, 15(2), 210. https://doi.org/10.3390/brainsci15020210