Next Article in Journal
Conditions for Guaranteeing Non-Overshooting Control of Nonlinear Systems with Full-State Constraints
Previous Article in Journal
Impact of Patient Size and Positioning on Radiation Dose in Multiphase Liver CT Examinations
Previous Article in Special Issue
Developments, Applications, and Innovations in Agricultural Sciences and Biotechnologies
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Applied Sciences
Volume 15
Issue 11
10.3390/app15115818
applsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Brief Report

An Efficient Rice Virus-Induced Gene Silencing System Mediated by Wheat Dwarf Virus

by
Yaqian Zhang
1,
Xiaowan Zhang
1,
Lu Yu
1,
Yijie Yan
1,
Senzhen Zhu
1,
Wanting Huang
1,
Xian Zhang
1,2,*,
Cong Dang
1,2,* and
Dawei Xue
1,2,*
1
College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou 311121, China
2
Zhejiang Provincial Key Laboratory for Genetic Improvement and Quality Control of Medicinal Plants, Hangzhou Normal University, Hangzhou 311121, China
*
Authors to whom correspondence should be addressed.
Appl. Sci. 2025, 15(11), 5818; https://doi.org/10.3390/app15115818
Submission received: 5 March 2025 / Revised: 6 May 2025 / Accepted: 19 May 2025 / Published: 22 May 2025
(This article belongs to the Special Issue Advanced Plant Biotechnology in Sustainable Agriculture—2nd Edition)
Browse Figures
Versions Notes

Abstract

:
The virus-induced gene silencing (VIGS) technique can effectively inhibit systemic viral infection by down-regulating plant endogenous gene expression, and it has become an important tool to study plant gene function. However, few studies have reported that wheat dwarf virus (WDV), which enables high-throughput gene silencing, could be used in a rice VIGS system. In this study, a VIGS vector system was constructed based on WDV, and successfully silenced the Phytoene desaturase gene and the rice blast resistance gene Pi21 in rice. Pi21-silenced plants showed significantly increased resistance to rice blast, significantly reduced lesion area, and did not show high disease symptoms (grade 8–9). In addition, the WDV vector has the advantages of rapid infection, high proliferation, and an unconformity genome, and has little influence on rice growth and development. This study validates the effectiveness of the WDV-VIGS system in rice gene function studies and provides a new gene silencing tool for blast resistance breeding.

1. Introduction

Virus-induced gene silencing (VIGS) is a powerful technique that can down-regulating endogenous genes in plants, enabling rapid functional genomics studies. Its efficiency is determined by several key parameters, including infection efficiency, silencing efficacy, host range, speed of phenotypic expression, impact on plant growth, and ease of delivery [1]. Based on this approach, researchers can modify a plant’s viral vector to achieve specific gene silencing [2,3]. This technology does not require stable transformation and large mutant populations, and it is becoming an important tool to identify the heredity and function of plant genes [4]. Until now, there have been various plant viral vectors that have been developed, and an increasing number of plant species have been successfully utilized for gene function analysis using VIGS. Tobravirus capsici (tobacco rattle virus, TRV), as one of the most well-established VIGS vectors, has been widely used in various solanaceous species, such as tomatoes, peppers, and tobacco [5]. Its widespread application in these plants could be attributed to its high silencing efficiency and technical feasibility [6,7]. Comovirus siliquae (bean pod mottle virus, BPMV) has been adapted as a VIGS vector in legumes, allowing for gene function studies in beans and other economically important legume species [8]. Hordeivirus hordei (barley stripe mosaic virus, BSMV) has been used as a VIGS vector in monocot plants, particularly in maize, by targeting the endogenous host Phytoene desaturase (PDS) gene [9]. Rice (Oryza sativa), a critical staple crop feeding over half the global population, faces severe threats from Magnaporthe oryzae, the causative agent of rice blast disease. This pathogen accounts for annual yield losses of 10–30%, underscoring the urgency to identify resistance genes [10]. However, since rice blast resistance typically weakens within 3–5 years, the continuous updating of disease-resistant gene combinations is required to achieve sustainable rice production. VIGS enables rapid functional gene characterization, but most VIGS vectors preferentially infect dicotyledonous plants, with many viruses demonstrating low infection efficiency in monocotyledons. Another hurdle is the lack of a universal approach that can be applied to all plants. For example, we face hurdles around the incompatibility of VIGS vectors with the host and the inability to use VIGS for plant species which are not easily transformable [11]. Current reports indicate that only four RNA viruses and two DNA viruses have been successfully utilized as vectors for VIGS in monocot species, including BSMV-based in barley and wheat [12,13]; Bromovirus BMV in rice and barley [14]; Potexvirus bambusae and its satellite RNA in Brachypodium distachyon [15]; Tungrovirus oryzae (rice tungro bacilliform virus, RTBV) in rice [16,17]; and Mastrevirus hordei (wheat dwarf virus, WDV) in wheat and rice [18].
WDV, a member of the genus Mastrevirus (family Geminiviridae), is a pathogen affecting cereal crops that is transmitted by the leafhopper Psammotettix alienus [19]. WDV consists of the following: Rep (LIR and SIR for replication), CP/V1 (silencing effector), and V2 (movement protein). For VIGS vectors, Rep is preserved for replication, while V2 is modified or deleted to insert target genes [20]. Recent studies have demonstrated WDV’s potential as a VIGS vector in wheat and barley, achieving high-throughput silencing with minimal off-target effects. However, its application in rice remains underexplored, with only one report suggesting compatibility—a gap our study addresses [21]. Here, we optimize WDV-mediated VIGS in rice using two targets: PDS, a visual marker for silencing efficiency, and Pi21, a key blast resistance gene. We hypothesized that our VIGS protocol will efficiently silence endogenous genes in rice. Specifically, we predict that targeting PDS will result in visible photobleaching and that targeting the blast resistance gene Pi21 will increase susceptibility to Magnaporthe oryzae. By establishing WDV’s efficacy in rice, we expand the VIGS toolkit for monocot functional genomics and enable the rapid validation of disease-related genes.

2. Materials and Methods

2.1. Experimental Materials

Zhonghua11 (ZH11) served as both the experimental material for rice blast infection and the source of gene cloning. The VIGS vector, based on pCambia1300 and containing the WDV genome (pCambia1300-WDV), was used in this system. pCambia1300 and Agrobacterium tumefaciens strain GV3101 was used as the viral infection mediator.

2.2. Construction of the Vector

The WDV sequence was amplified using PCR, and the movement protein regions that did not affect virus infection were removed, according to the built WDV-Gate [21]. Restriction enzyme sites were inserted into the SIR and V1 regions to provide restriction enzyme sites for the insertion of the target gene fragment. The WDV genome is inserted into a plasmid containing the Ubiquitin promoter using the primers WF/WR, resulting in what is termed the WDV-VIGS system [22]. Subsequently, the target gene sequence is cloned into the SpeI and StuI restriction sites using the primers WDV-F/R. Since the StuI cutting site is a blunt end, only T4 ligase is required for the ligation of the reverse gene silencing sequence. OsPi21i (60bp) and OsPDSi (60bp) fragments were PCR-amplified from rice cDNA and subsequently integrated into the WDV-VIGS vector via homologous recombination. The vector designed with OsPDSi as the target genes are shown in (Figure 1a); other vector models are shown in (Figure S1). After it was successfully constructed and confirmed by electrophoresis (Figure 1b) and sequencing verification, the recombinant plasmid was transferred into Agrobacterium GV3101. WDV-Rep-F/R was used to detect the expression of OsPDS and OsPi21 after WDV infection (Figure 1c). All of the designed primer sequences used in this study are listed in Table 1.

2.3. WDV Infection Method

Rice seeds were soaked in 75% alcohol for 30 s, washed with clean water 3 times, transferred to a hydroponic box, cultured at 28 °C, light/darkness: 16 h/8 h. Agrobacterium containing target gene silencing vector was cultured in LB medium at 28 °C overnight to obtain the established bacterial solution (OD600 = 0.6–1.0). Then, two WDV infection methods, including friction inoculation and vacuum infiltration, were conducted in this study. For the friction inoculation method, when the rice grows to two or three leaf stages, the finger is dipped in quartz sand and then the rice leaves are gently abraded to form wounds. The bacterial solution was taken and evenly applied to the rice leaves. After incubation in the dark for 1 day at 28 °C, the plants were cultured again at 28° C under a light/dark cycle of 16 h/8 h. As for the vacuum infiltration method, the seeds germinated for 2–3 days were immersed in a given bacterial solution; after vacuum infiltration for 5 min, place the seeds into the bacterial suspension, vacuum to −0.08 MPa, maintain the vacuum for 10 min, then return to atmospheric pressure. Soak for 2 h, then transfer to a hydroponic box for normal culture at 28 °C, light/darkness: 16 h/8 h.

2.4. Infection of Magnaporthe Oryzae

The rice blast strain RB2 was provided by Jiehua Qiu from China National Rice Research Institute. Inoculation of the rice blast was performed via spraying application, with an equal volume of conidia suspension (1 × 106/mL) uniformly sprayed on both wild-type and silenced rice seedlings at the four-leaf stage, respectively. Then, these seedings were transferred to the incubator for darkness at 25 °C for 2 days, after which they were incubated under a 16/8 h light/dark photoperiod at 25 °C for 5 days. Phenotypic observations were carried out according to the international standard of Paddy Rice Pestilence [23]. The relative lesion areas were measured after 7 days inoculation using Image-Pro Plus software [24].
All the treated rice leaves were sampled at 0 h, 24 h, 48 h, and 72 h after spraying, and stored in a refrigerator at −80 °C for later use. The total RNA of rice leaf was extracted with TRIzol Reagent according to the manufacturer’s instructions. The first-strand cDNA was synthesized from 1 µg of total RNA using Hifair® II 1st Strand cDNA Synthesis Kit (Nigbo, China). The qRT-PCR primers for OsPi21 were referenced from Fukuoka’s work [25], and the primers for OsPDS were designed using SnapGene Viewer 5.2.4 software. The rice Ubiquitin gene (OsUBQ5, Loc_Os03g13170) was used as internal reference for qPCR. The detection of rice blast fungus biomass is based on real-time fluorescent quantitative qPCR detection of M. oryzae DNA [26]. The reaction procedure was as follows: pre-denaturation at 95 °C for 10 s, denaturation at 95 °C for 5 s, extension at 60 °C for 30 s, and 40 cycles.

2.5. Data Analysis

Using ZH 11 as the control and OsUBQ5 as the reference gene, data are presented as mean ± SD. Statistical significance was analyzed by Student’s test and ANOVA. Data were processed using IBM SPSS Statistics 20 for statistical analysis and GraphPad Prism 8.0 for graphing. Asterisks denote significant differences based on Student’s test (* p < 0.05, ** p < 0.01, *** p < 0.001), while different lowercase letters indicate the ANOVA results (p < 0.05).

3. Results

3.1. Detection and Phenotype Identification of Transgenic Rice Plants Transformed Using the VIGS Gene Silencing System

The constructed WDV-VIGS vector map is shown in (Figure 1a). The vector was constructed by deleting the V2 movement protein that does not affect viral replication and using the maize Ubiquitin (Ubi) promoter for construct expression. The OsPDSi fragment was inserted after the viral SIR region to generate the pCambia1300-WDV-OsPDSi gene silencing vector. Using the same method, the target gene sequence of Pi21 was inserted into the WDV-VIGS vector, with the electrophoresis results shown in lanes 1 and 2 of (Figure 1b). Tests were also conducted with both forward and reverse sequences inserted simultaneously in lanes 3 and 4, (Figure 1b), but neither the sequencing nor the experiments yielded conclusive results. Rice was infiltrated with Agrobacterium carrying the pCambia1300-WDV-OsPDSi construct, and two infection methods were conducted: friction inoculation and vacuum immersion inoculation. As shown in (Figure 1c), 14 days after Agrobacterium inoculation, the leaves of rice plants were albino, indicating that WDV could be used as a VIGS experimental vector for rice. In the experiment, the positive infection rate of friction inoculation was 44%, as shown in (Figure 1e), while the infection rate of vacuum immersion inoculation was as high as 80%; nine inoculated plants were randomly selected for WDV detection, seven of which were positive (Figure 1f). Therefore, the method of vacuum infiltration was used to infect rice in the follow-up experiment.

3.2. Silence OsPi21 by the WDV-VIGS System to Enhances Rice Blast Resistance

It was reported that the wild type Pi21 slowed down the defense response of rice, while the plants carrying the resistant pi21 allele of the natural mutant race enhanced the resistance response to rice blast. The difference between the two alleles was that there were 21 bp and 48 bp deletions in the pi21, respectively [25,27]. Seven days after inoculation with rice blast disease, some OsPi21i rice leaves had fusiform lesions with brown edges, were gray-white in the middle, and had yellow halos on the periphery, while the leaves of the control group had more lesions, which were irregular and large, with dark brown edges (Figure 2b,c).
Meanwhile, the relative OsPi21 gene expression level and fungal biomass was significantly reduced in OsPi21i rice (Figure 2d,e). Using the different disease grades of rice leaf phenotypes as a reference, the gene-silenced rice with pCambia1300-WDV-OsPi21i mainly exhibits leaf blast symptoms at levels 4–5 (Figure 2f), while the wild-type rice primarily shows leaf blast symptoms at levels 8–9. Based on the overall count of plants with varying degrees of disease, the OsPi21i rice shows significantly milder leaf blast symptoms compared to the wild-type rice. These results indicate that the OsPi21 gene could also be silenced by the WDV-VIGS system. And this system was recommended to be an effective tool to study the gene function in rice biology. However, the genetic effects of OsPi21 silencing using VIGS technology in the progeny lines, specifically whether the low expression level of OsPi21 can be maintained and the blast resistance can be sustained, need further experimental study.

4. Discussion

The RTBV vector could be successfully introduced into rice via Agrobacterium-mediated transformation, effectively suppressing the PDS gene in the treated rice leaves [16]. In each case, real-time PCR-based assessments indicated an approximately 40–80% reductionin the accumulation of PDS transcripts. However, quartz sand treatment of leaves are required in the RTBV friction inoculation method, where the force must be controlled to avoid leaf damage [17]. In contrast, in this WDV-mediated VIGS system, transformation can be achieved by vacuum-soaking the germinated seeds in Agrobacterium suspension, effectively addressing the drawback of the long growth cycle of rice. The VIGS vector constructed using pCambia1300-ubi and WDV has strong infectivity, good repeatability, and few adverse reactions. After Agrobacterium treatment with rice seeds infiltrated with Agrobacterium carrying the WDV-OsPDSi construct, a larger area of albino symptoms appears on the new leaves within 2–3 weeks, indicating a better silencing effect. Moreover, the vacuum-soaking method is simple to operate and does not require complex manipulation skills [28,29]. This suggests that the WDV vector is more reliable in practical applications, providing consistent silencing effects. Moreover, in this experiment, the V2 movement protein gene of the WDV was deleted, thus the viral vector has less impact on the growth and development of rice, compared to RTBV, which may cause pathogenic effects on rice or affect its growth and development.
The WDV vector exhibits am optimal silencing effect when the OsPDS/OsPi21 target gene fragment is 60 bp, indicating its better silencing efficiency relative to RTBV, which may require longer gene fragments to achieve effective gene silencing. Most target gene fragments inserted in reverse into the recombinant vector yield better silencing effects than those inserted in the same direction [30]. Early studies in BSMV-mediated VIGS systems demonstrate that inserting hairpin structures can enhance the silencing phenotype or down-regulate the expression of the target gene [31]. However, recent studies in the VIGS system mediated by BSMV and BMV vectors found that these short reverse repeated sequences are very unstable and that their silencing effectiveness is not as good as that of the fragments inserted in the same direction, suggesting that research on the silencing system in poaceous plants is needed to determine the universal effectiveness of reverse repeated sequences [12]. In this experiment, we adopted a strategy of inserting both forward and reverse sequences to construct the VIGS vector. Unfortunately, the sequencing results failed to obtain the expected sequence information, which may be due to the formation of hairpin structures during the sequencing of constructs containing simultaneously inserted forward and reverse sequences. Moreover, the experimental phenomena observations showed no significant difference from the single-direction insertion vector, which may imply that, in this experimental system, the direction of the inserted fragment has no significant effect on silencing efficiency or that the potential advantage of reverse insertion was not demonstrated under the conditions of this experiment.
The key in VIGS technology is the selection and construction of viral vectors. Although there are many plant viruses, such as RNA viruses, DNA viruses, and satellite viruses, have been adapted as VIGS vectors, these three types of vectors have their own characteristics and application scope [32,33]. The host range infected by different types of vectors is limited, leading to great differences in the efficiency of gene silencing. The silencing efficiency of VIGS is also affected by the interaction between the host plant and the virus, as well as environmental factors [34]. As a member of the Geminiviridae family, WDV possesses a single-stranded DNA genome that efficiently transfects host cells via Agrobacterium-mediated vacuum infiltration. It relies on the viral replication protein (Rep) for rolling-circle replication, enabling transient high-level expression of the target gene fragment. The vector design can activate the host RNA interference (RNAi) pathway, leading to the specific silencing of the target gene. Unlike retroviruses such as RTBV, WDV does not integrate into the host genome, thereby avoiding risks associated with long-term genetic modifications and reducing growth abnormalities caused by insertional mutations [35,36]. In this study, rice and its susceptibility OsPi21 gene were selected to evaluate the WDV vector system. To verify the feasibility of the WDV vector, firstly, pCambia1300-WDV-OsPDSi was used as a positive control; the results show that the leaves of rice plants treated with VIGS were obviously albino, and the expression of OsPDS in rice was significantly down-regulated compared to the control group, which preliminarily determined the effectiveness of the vector. Then, the virus vector was used to construct pCambia1300-WDV-OsPi21i to silence rice OsPi21, which further proved the feasibility of the tool vector constructed based on WDV. And further studies indicate that it will provide a new gene silencing tool vector for the study of rice blast resistant varieties. A previous study reported that, due to the lack of proofreading mechanisms and many replication cycles, the payload genes in the WDV vector may rapidly accumulate point mutations, leading to the inactivation of these non-essential insertions [37,38]. This involves recombination events in the viral vector that may lead to the production of new functional viral genomes and cause the spread of unwanted pathogens [39]. While, in this study, it was found that the WDV fragment itself had no significant effect on the growth ability of rice, and there were few severe streak symptoms in wheat [40], and because Geminiviridae has the characteristics of rapid infection, proliferation, transcription, and expression without integration into the plant genome, WDV-mediated VIGS typically causes milder symptoms with minimal impact on host growth and development, while its high silencing efficiency is confirmed through phenotypic and physiological comparisons with control groups. However, like other VIGS approaches, potential limitations should be acknowledged, including the transient nature of the silencing, possible variability in efficiency between individual plants or under different conditions, and the theoretical potential for off-target effects that warrant careful sequence selection. Despite these considerations, it has become a highly efficient plant expression vector with broad prospects for development.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/app15115818/s1, Figure S1: WDV-VIGS vector models.

Author Contributions

Conceived and designed the experiments: Y.Z., X.Z. (Xiaowan Zhang), X.Z. (Xian Zhang) and D.X. Performed the cloning experiments: Y.Z., X.Z. (Xiaowan Zhang) and L.Y. Performed the rice transformation: Y.Z., L.Y. and Y.Y. Performed the phenotyping: Y.Z., X.Z. (Xiaowan Zhang), L.Y. and Y.Y. Performed the DNA extraction and genotyping analysis: Y.Z., X.Z. (Xiaowan Zhang), L.Y., S.Z. and W.H. Drafted the manuscript: Y.Z., L.Y., X.Z. (Xian Zhang) and C.D. Edited the manuscript: Y.Z., L.Y., C.D., X.Z. (Xian Zhang) and D.X. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Natural Science Foundation of Zhejiang province in China (LQ24C140003, LY20C140003) and Hangzhou Normal University Graduate Research Innovation Promotion Project, and the APC was funded by Hangzhou Normal University.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are only available upon request from the corresponding author due to privacy considerations.

Acknowledgments

Special thanks to the Jiehua Qiu of China Rice Research Institute for the gift of rice blast fungus RB2.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Zulfiqar, S.; Farooq, M.A.; Zhao, T.; Wang, P.; Tabusam, J.; Wang, Y.; Xuan, S.; Zhao, J.; Chen, X.; Shen, S.; et al. Virus-Induced Gene Silencing (VIGS): A Powerful Tool for Crop Improvement and Its Advancement towards Epigenetics. Int. J. Mol. Sci. 2023, 24, 5608. [Google Scholar] [CrossRef] [PubMed]
  2. Lange, M.; Yellina, A.L.; Orashakova, S.; Becker, A. Virus-Induced Gene Silencing (VIGS) in Plants: An Overview of Target Species and the Virus-Derived Vector Systems. Methods Mol. Biol. 2013, 975, 1–14. [Google Scholar] [CrossRef] [PubMed]
  3. Jagram, N.; Dasgupta, I. Principles and Practice of Virus Induced Gene Silencing for Functional Genomics in Plants. Virus Genes 2023, 59, 173–187. [Google Scholar] [CrossRef]
  4. Rössner, C.; Lotz, D.; Becker, A. VIGS Goes Viral: How VIGS Transforms Our Understanding of Plant Science. Annu. Rev. Plant Biol. 2022, 73, 703–728. [Google Scholar] [CrossRef]
  5. Wege, S.; Scholz, A.; Gleissberg, S.; Becker, A. Highly Efficient Virus-Induced Gene Silencing (VIGS) in California Poppy (Eschscholzia californica): An Evaluation of VIGS as a Strategy to Obtain Functional Data from Non-Model Plants. Ann. Bot. 2007, 100, 641–649. [Google Scholar] [CrossRef]
  6. Abt, I.; Souquet, M.; Angot, G.; Mabon, R.; Dallot, S.; Thébaud, G.; Jacquot, E. Functional Transcomplementation between Wheat Dwarf Virus Strains in Wheat and Barley. Viruses 2019, 12, 34. [Google Scholar] [CrossRef]
  7. Rahman, J.; Baldwin, I.T.; Gase, K. California TRV-Based VIGS Vectors Mediate Gene Silencing at Elevated Temperatures but with Greater Growth Stunting. BMC Plant Biol. 2021, 21, 553. [Google Scholar] [CrossRef]
  8. McCaghey, M.; Shao, D.; Kurcezewski, J.; Lindstrom, A.; Ranjan, A.; Whitham, S.A.; Conley, S.P.; Williams, B.; Smith, D.L.; Kabbage, M. Host-Induced Gene Silencing of a Sclerotinia sclerotiorum oxaloacetate acetylhydrolase Using Bean Pod Mottle Virus as a Vehicle Reduces Disease on Soybean. Front. Plant Sci. 2021, 12, 677631. [Google Scholar] [CrossRef]
  9. Li, T.; Hu, J.; Sun, Y.; Li, B.; Zhang, D.; Li, W.; Liu, J.; Li, D.; Gao, C.; Zhang, Y.; et al. Highly Efficient Heritable Genome Editing in Wheat Using an RNA Virus and Bypassing Tissue Culture. Mol. Plant 2021, 14, 1787–1798. [Google Scholar] [CrossRef]
  10. Miah, G.; Rafii, M.Y.; Ismail, M.R.; Puteh, A.B.; Rahim, H.A.; Asfaliza, R.; Latif, M.A. Blast Resistance in Rice: A Review of Conventional Breeding to Molecular Approaches. Mol. Biol. Rep. 2013, 40, 2369–2388. [Google Scholar] [CrossRef]
  11. Pandey, P.; Senthil-Kumar, M.; Mysore, K.S. Advances in Plant Gene Silencing Methods. Methods Mol. Biol. 2015, 1287, 3–23. [Google Scholar] [CrossRef] [PubMed]
  12. Pacak, A.; Geisler, K.; Jørgensen, B.; Barciszewska-Pacak, M.; Nilsson, L.; Nielsen, T.H.; Johansen, E.; Grønlund, M.; Jakobsen, I.; Albrechtsen, M. Investigations of Barley Stripe Mosaic Virus as a Gene Silencing Vector in Barley Roots and in Brachypodium distachyon and Oat. Plant Methods 2010, 6, 26. [Google Scholar] [CrossRef]
  13. Bennypaul, H.S.; Mutti, J.S.; Rustgi, S.; Kumar, N.; Okubara, P.A.; Gill, K.S. Virus-Induced Gene Silencing (VIGS) of Genes Expressed in Root, Leaf, and Meiotic Tissues of Wheat. Funct. Integr. Genom. 2012, 12, 143–156. [Google Scholar] [CrossRef]
  14. Ding, X.S.; Schneider, W.L.; Chaluvadi, S.R.; Mian, M.A.R.; Nelson, R.S. Characterization of a Brome mosaic virus Strain and Its Use as a Vector for Gene Silencing in Monocotyledonous Hosts. Mol. Plant-Microbe Interact. 2006, 19, 1229–1239. [Google Scholar] [CrossRef]
  15. Liou, M.-R.; Huang, Y.-W.; Hu, C.-C.; Lin, N.-S.; Hsu, Y.-H. A Dual Gene-Silencing Vector System for Monocot and Dicot Plants. Plant Biotechnol. J. 2014, 12, 330–343. [Google Scholar] [CrossRef]
  16. Purkayastha, A.; Mathur, S.; Verma, V.; Sharma, S.; Dasgupta, I. Virus-Induced Gene Silencing in Rice Using a Vector Derived from a DNA Virus. Planta 2010, 232, 1531–1540. [Google Scholar] [CrossRef]
  17. Kumar, G.; Kumari, K.; Dasgupta, I. RTBV-Based VIGS Vector for Functional Genomics in Rice: Methodology, Advances, Challenges, and Future Implications. Methods Mol. Biol. 2022, 2408, 117–131. [Google Scholar] [CrossRef]
  18. Cejnar, P.; Ohnoutkova, L.; Ripl, J.; Kundu, J.K. Wheat dwarf virus Infectious Clones Allow to Infect Wheat and Triticum monococcum Plants. Plant Prot. Sci. 2019, 55, 81–89. [Google Scholar] [CrossRef]
  19. Baltes, N.J.; Gil-Humanes, J.; Cermak, T.; Atkins, P.A.; Voytas, D.F. DNA Replicons for Plant Genome Engineering. Plant Cell 2014, 26, 151–163. [Google Scholar] [CrossRef]
  20. Wei, S.; Liu, L.; Chen, G.; Yang, H.; Huang, L.; Gong, G.; Luo, P.; Zhang, M. Molecular Evolution and Phylogeographic Analysis of Wheat Dwarf Virus. Front. Microbiol. 2024, 15, 1314526. [Google Scholar] [CrossRef]
  21. Tian, Y.; Zhong, D.; Li, X.; Shen, R.; Han, H.; Dai, Y.; Yao, Q.; Zhang, X.; Deng, Q.; Cao, X.; et al. High-Throughput Genome Editing in Rice with a Virus-Based Surrogate System. J. Integr. Plant Biol. 2023, 65, 646–655. [Google Scholar] [CrossRef] [PubMed]
  22. Cejnar, P.; Ohnoutkova, L.; Ripl, J.; Vlcko, T.; Kundu, J.K. Two Mutations in the Truncated Rep Gene RBR Domain Delayed the Wheat dwarf virus Infection in Transgenic Barley Plants. J. Integr. Agric. 2018, 17, 2492–2500. [Google Scholar] [CrossRef]
  23. Ashkani, S.; Rafii, M.Y.; Shabanimofrad, M.; Miah, G.; Sahebi, M.; Azizi, P.; Tanweer, F.A.; Akhtar, M.S.; Nasehi, A. Molecular Breeding Strategy and Challenges Towards Improvement of Blast Disease Resistance in Rice Crop. Front. Plant Sci. 2015, 6, 886. [Google Scholar] [CrossRef] [PubMed]
  24. Qiu, J.; Xie, J.; Chen, Y.; Shen, Z.; Shi, H.; Naqvi, N.I.; Qian, Q.; Liang, Y.; Kou, Y. Warm Temperature Compromises JA-Regulated Basal Resistance to Enhance Magnaporthe oryzae Infection in Rice. Mol. Plant 2022, 15, 723–739. [Google Scholar] [CrossRef]
  25. Fukuoka, S.; Saka, N.; Koga, H.; Ono, K.; Shimizu, T.; Ebana, K.; Hayashi, N.; Takahashi, A.; Hirochika, H.; Okuno, K.; et al. Loss of Function of a Proline-Containing Protein Confers Durable Disease Resistance in Rice. Science 2009, 325, 998–1001. [Google Scholar] [CrossRef]
  26. Liu, M.; Wang, F.; He, B.; Hu, J.; Dai, Y.; Chen, W.; Yi, M.; Zhang, H.; Ye, Y.; Cui, Z.; et al. Targeting Magnaporthe oryzae Effector MoErs1 and Host Papain-like Protease OsRD21 Interaction to Combat Rice Blast. Nat. Plants 2024, 10, 618–632. [Google Scholar] [CrossRef]
  27. Fukuoka, S.; Okuno, K. QTL Analysis and Mapping of Pi21, a Recessive Gene for Field Resistance to Rice Blast in Japanese Upland Rice. Theor. Appl. Genet. 2001, 103, 185–190. [Google Scholar] [CrossRef]
  28. Pandey, P.; Mysore, K.S.; Senthil-Kumar, M. Recent Advances in Plant Gene Silencing Methods. Methods Mol. Biol. 2022, 2408, 1–22. [Google Scholar] [CrossRef]
  29. Dommes, A.B.; Gross, T.; Herbert, D.B.; Kivivirta, K.I.; Becker, A. Virus-Induced Gene Silencing: Empowering Genetics in Non-Model Organisms. J. Exp. Bot. 2019, 70, 757–770. [Google Scholar] [CrossRef]
  30. Bruun-Rasmussen, M.; Madsen, C.T.; Jessing, S.; Albrechtsen, M. Stability of Barley Stripe Mosaic Virus-Induced Gene Silencing in Barley. Mol. Plant-Microbe Interact. 2007, 20, 1323–1331. [Google Scholar] [CrossRef]
  31. Lacomme, C.; Hrubikova, K.; Hein, I. Enhancement of Virus-Induced Gene Silencing through Viral-Based Production of Inverted-Repeats. Plant J. Cell Mol. Biol. 2003, 34, 543–553. [Google Scholar] [CrossRef]
  32. Zaidi, S.S.-E.-A.; Vasudevan, K.; Lentz, E.M.; Vanderschuren, H. Virus-Induced Gene Silencing (VIGS) in Cassava Using Geminivirus Agroclones. Methods Mol. Biol. 2020, 2172, 51–64. [Google Scholar] [CrossRef]
  33. Zhou, T.; Dong, L.; Jiang, T.; Fan, Z. Silencing Specific Genes in Plants Using Virus-Induced Gene Silencing (VIGS) Vectors. Methods Mol. Biol. 2022, 2400, 149–161. [Google Scholar] [CrossRef]
  34. Liu, N.; Xie, K.; Jia, Q.; Zhao, J.; Chen, T.; Li, H.; Wei, X.; Diao, X.; Hong, Y.; Liu, Y. Foxtail Mosaic Virus-Induced Gene Silencing in Monocot Plants. Plant Physiol. 2016, 171, 1801–1807. [Google Scholar] [CrossRef]
  35. Gil-Humanes, J.; Wang, Y.; Liang, Z.; Shan, Q.; Ozuna, C.V.; Sánchez-León, S.; Baltes, N.J.; Starker, C.; Barro, F.; Gao, C.; et al. High-Efficiency Gene Targeting in Hexaploid Wheat Using DNA Replicons and CRISPR/Cas9. Plant J. Cell Mol. Biol. 2017, 89, 1251–1262. [Google Scholar] [CrossRef]
  36. Wang, M.; Lu, Y.; Botella, J.R.; Mao, Y.; Hua, K.; Zhu, J.-K. Gene Targeting by Homology-Directed Repair in Rice Using a Geminivirus-Based CRISPR/Cas9 System. Mol. Plant 2017, 10, 1007–1010. [Google Scholar] [CrossRef]
  37. Huang, S.; Jia, A.; Song, W.; Hessler, G.; Meng, Y.; Sun, Y.; Xu, L.; Laessle, H.; Jirschitzka, J.; Ma, S.; et al. Identification and Receptor Mechanism of TIR-Catalyzed Small Molecules in Plant Immunity. Plant Sci. 2022, 377, eabq3297. [Google Scholar] [CrossRef]
  38. Köklü, G.; Ramsell, J.N.E.; Kvarnheden, A. The Complete Genome Sequence for a Turkish Isolate of Wheat dwarf virus (WDV) from Barley Confirms the Presence of Two Distinct WDV Strains. Virus Genes 2007, 34, 359–366. [Google Scholar] [CrossRef]
  39. Kant, R.; Dasgupta, I. Phenotyping of VIGS-Mediated Gene Silencing in Rice Using a Vector Derived from a DNA Virus. Plant Cell Rep. 2017, 36, 1159–1170. [Google Scholar] [CrossRef]
  40. Ahlquist, P. Parallels among Positive-Strand RNA Viruses, Reverse-Transcribing Viruses and Double-Stranded RNA Viruses. Nat. Rev. Microbiol. 2006, 4, 371–382. [Google Scholar] [CrossRef]
Applsci 15 05818 g001
Figure 1. WDV-VIGS vector model, and tracking the presence of WDV in VIGS-infected ZH11. (a) VIGS vector model with OsPDSi as an example. (b) The target fragment was successfully inserted into the VIGS vector, as confirmed by gel electrophoresis analysis. Line1: pCambia1300-WDV-OsPDSi (unidirectional), 2: pCambia1300-WDV-OsPi21i (unidirectional), 3: pCambia1300-WDV-OsPDSi (bidirectional), 4: pCambia1300-WDV-OsPi21i (bidirectional), 5: pCambia1300-WDV, 6: negative control. (c) Identification of rice successfully infected by pCambia1300-WDV, pCambia1300-WDV-OsPDSi, and pCambia1300-WDV-OsPi21i. Lines 1–2: pCambia1300-WDV, 3–4: pCambia1300-WDV-OsPDSi, 5–6: pCambia1300-WDV-OsPi21i. (d) Phenotypic of wild-type and VIGS-treated rice plants 14 days after Agrobacterium tumefaciens inoculation. Scale Bar = 5 cm. (e) The infection rate of friction inoculation. Nine inoculated plants were randomly selected for WDV detection. (f) The infection rate of vacuum infiltration.
Figure 1. WDV-VIGS vector model, and tracking the presence of WDV in VIGS-infected ZH11. (a) VIGS vector model with OsPDSi as an example. (b) The target fragment was successfully inserted into the VIGS vector, as confirmed by gel electrophoresis analysis. Line1: pCambia1300-WDV-OsPDSi (unidirectional), 2: pCambia1300-WDV-OsPi21i (unidirectional), 3: pCambia1300-WDV-OsPDSi (bidirectional), 4: pCambia1300-WDV-OsPi21i (bidirectional), 5: pCambia1300-WDV, 6: negative control. (c) Identification of rice successfully infected by pCambia1300-WDV, pCambia1300-WDV-OsPDSi, and pCambia1300-WDV-OsPi21i. Lines 1–2: pCambia1300-WDV, 3–4: pCambia1300-WDV-OsPDSi, 5–6: pCambia1300-WDV-OsPi21i. (d) Phenotypic of wild-type and VIGS-treated rice plants 14 days after Agrobacterium tumefaciens inoculation. Scale Bar = 5 cm. (e) The infection rate of friction inoculation. Nine inoculated plants were randomly selected for WDV detection. (f) The infection rate of vacuum infiltration.
Applsci 15 05818 g001
Applsci 15 05818 g002
Figure 2. Magnaporthe oryzae inoculation and infection of WDV-VIGS in ZH11 rice, followed by phenotypic scoring and quantitative detection. (a) Rice leaves after the OsPDS gene and OsPi21 were silenced by WDV-VIGS; each group has two replicates. (b) Comparison of the lesion size of rice inoculated with Magnaporthe oryzae in vitro. Rice leaves with gene silencing are inoculated with the rice blast fungus RB2. After seven days, the phenotypes were photographed; each group has two replicates. (c) Phenotypes corresponding to leaf blast grading criteria for rice blast. The numbers 1–9 represent the disease grades. (d) The relative gene expression level after gene silencing. The significance of the difference was determined using ANOVA. “*” represents significant differences (p < 0.05). (e) Comparison of fungal biomass after gene silencing. The significance of the difference was determined using ANOVA followed by Tukey’s HSD test for multiple comparisons (p < 0.05), and different lowercase letters indicates significant difference between the two groups. (f) Percentage of wild-type rice and Pi21 silent rice leaf blast levels.
Figure 2. Magnaporthe oryzae inoculation and infection of WDV-VIGS in ZH11 rice, followed by phenotypic scoring and quantitative detection. (a) Rice leaves after the OsPDS gene and OsPi21 were silenced by WDV-VIGS; each group has two replicates. (b) Comparison of the lesion size of rice inoculated with Magnaporthe oryzae in vitro. Rice leaves with gene silencing are inoculated with the rice blast fungus RB2. After seven days, the phenotypes were photographed; each group has two replicates. (c) Phenotypes corresponding to leaf blast grading criteria for rice blast. The numbers 1–9 represent the disease grades. (d) The relative gene expression level after gene silencing. The significance of the difference was determined using ANOVA. “*” represents significant differences (p < 0.05). (e) Comparison of fungal biomass after gene silencing. The significance of the difference was determined using ANOVA followed by Tukey’s HSD test for multiple comparisons (p < 0.05), and different lowercase letters indicates significant difference between the two groups. (f) Percentage of wild-type rice and Pi21 silent rice leaf blast levels.
Applsci 15 05818 g002
Table 1. Primer sequences used in this study.
Table 1. Primer sequences used in this study.
Primers NamePrimers Sequence
WFTGGTGTTACTTCTGCAGGAGCTCGGCAGTGACTCCGTCTCTG
WRCCTCGCCCTTGCTCACCATGGATCCCAGCTATGACCATGATTACG
WDV-FTCAACTACTCGTTCGCCTCC
WDV-RGCTTGGCTTGCTTACACTCTG
WDV-OsPDSi-FCGACACGCGTACTAGTAGTGAAATC
WDV-OsPDSi-RCCTAGAGCACCGAGCCTCCGAC
WDV-OsPi21i-FCGCGACGCGTACTAGTATGGGTATATTG
WDV-OsPi21i-RCCTCCTGATCTTGGCATC
WDV-Rep-FTACGCCTTGGATTCAC
WDV-Rep-RTACGACCTGGAGTTG
qOsPi21-FGGTATATTGGTCATCTTGG
qOsPi21-RATCACCCTGTTGTTCTTC
qOsPDS-FTGCCTGTCATCTATGAAC
qOsPDS-RCCTAGAGCACCGAGCCTCCGAC
UBQ5-FAGACCTACACCAAGCCCAAGAAGAT
UBQ5-RCCAGCACCGCACTCAGCATTAG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, Y.; Zhang, X.; Yu, L.; Yan, Y.; Zhu, S.; Huang, W.; Zhang, X.; Dang, C.; Xue, D. An Efficient Rice Virus-Induced Gene Silencing System Mediated by Wheat Dwarf Virus. Appl. Sci. 2025, 15, 5818. https://doi.org/10.3390/app15115818

AMA Style

Zhang Y, Zhang X, Yu L, Yan Y, Zhu S, Huang W, Zhang X, Dang C, Xue D. An Efficient Rice Virus-Induced Gene Silencing System Mediated by Wheat Dwarf Virus. Applied Sciences. 2025; 15(11):5818. https://doi.org/10.3390/app15115818

Chicago/Turabian Style

Zhang, Yaqian, Xiaowan Zhang, Lu Yu, Yijie Yan, Senzhen Zhu, Wanting Huang, Xian Zhang, Cong Dang, and Dawei Xue. 2025. "An Efficient Rice Virus-Induced Gene Silencing System Mediated by Wheat Dwarf Virus" Applied Sciences 15, no. 11: 5818. https://doi.org/10.3390/app15115818

APA Style

Zhang, Y., Zhang, X., Yu, L., Yan, Y., Zhu, S., Huang, W., Zhang, X., Dang, C., & Xue, D. (2025). An Efficient Rice Virus-Induced Gene Silencing System Mediated by Wheat Dwarf Virus. Applied Sciences, 15(11), 5818. https://doi.org/10.3390/app15115818

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop