Next Article in Journal
Attention-Based Light Weight Deep Learning Models for Early Potato Disease Detection
Next Article in Special Issue
Hematopoietic Stem Cells of Bone Marrow and Their Total RNA in Rat Liver Regeneration
Previous Article in Journal
Yield Behaviour of Welded I-Shaped Steel Cross-Sections
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Applied Sciences
Volume 14
Issue 17
10.3390/app14178036
applsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Mesenchymal Stromal/Stem Cells Isolated by Explant Culture Method from Wharton’s Jelly and Subamnion Possess Similar Biological Characteristics

by
Snejana Kestendjieva
1,
Mihail Chervenkov
2,3,*,
Tsvetelina Oreshkova
1,
Milena Mourdjeva
1 and
Elena Stoyanova
1
1
Department of Molecular Immunology, Institute of Biology and Immunology of Reproduction, Bulgarian Academy of Sciences, 1113 Sofia, Bulgaria
2
Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Sciences, 1113 Sofia, Bulgaria
3
Faculty of Veterinary Medicine, University of Forestry, 1756 Sofia, Bulgaria
*
Author to whom correspondence should be addressed.
Appl. Sci. 2024, 14(17), 8036; https://doi.org/10.3390/app14178036
Submission received: 15 July 2024 / Revised: 12 August 2024 / Accepted: 6 September 2024 / Published: 8 September 2024
(This article belongs to the Special Issue Cell Biology: Latest Advances and Prospects)
Browse Figures
Versions Notes

Abstract

:
Human umbilical cord (UC) is an attractive source of mesenchymal stromal/stem cells (MSCs) for tissue engineering and regenerative medicine due to its easy availability, non-invasive procedure of collection, and no ethical concerns. The aim of this study was to isolate MSCs from the Wharton’s jelly (WJ) and subamnion (SA) from the same umbilical cord by an optimized explant method, and to compare the morphology, proliferation, and stemness properties of the MSCs from both sources. Cells from the WJ and SA of six umbilical cords were characterized by flow cytometry, differentiation capacity and proliferation assays, immunofluorescence staining, and RT-PCR. The optimized explant method was successfully used to isolate WJ-MSCs and SA-MSCs. The MSCs from both sources showed similar patterns of growth kinetics, adipogenic and osteogenic potential, and the expression of pluripotency markers (OCT4, SOX2, NANOG, and SSEA-4). The current findings support the usage of the optimized explant method to generate a relatively homogenous population of MSCs from Wharton’s jelly and subamnion, which can facilitate the reproducibility of the results from experimental and practical applications of the obtained cells.

1. Introduction

Mesenchymal stromal/stem cells (MSCs) represent clinically valuable cell populations capable of self-renewal, multipotent differentiation, immunomodulation, and great potential in tissue repair and regeneration [1]. The progress in tissue engineering and regenerative medicine has created a vast demand for the production of MSCs. This fact requires on one hand the identification of stem cell sources that promise higher yields, and on the other the development of a better protocol for the isolation, expansion, and quantification of MSCs.
Birth-associated organs such as the umbilical cord (UC) and placenta are of great interest to stem cell researchers as an alternative to adult MSCs [2,3]. These extraembryonic organs are routinely discarded following the delivery of a baby and can be obtained easily in large quantities without ethical implications [4]. Several studies have reported that MSCs isolated from the UC exhibit similar immunophenotypic characteristics to MSCs from bone marrow (known as a “gold standard” for MSCs) and adipose tissue [4,5] and greater proliferative, differentiation, immunosuppressive, and regenerative potential [6,7,8]. Hence, the UC has become one of the most popular birth-associated sources of MSCs, being developed for both pre-clinical and clinical trials such as graft-versus-host disease [9], premature ovarian failure [10], osteoarthritis [11,12], psoriasis [13], and diabetes mellitus [14].
Among the other abilities of the MSCs derived from Wharton’s jelly (WJ) and the subamnion (SA), like great proliferation and various cell types differentiation capacity, these MSCs can also modulate the immune response and possesses low tumorigenicity. The aforementioned qualities make them suitable for the treatment of various pathologies in the bones, muscles, nerve system, reproductive system, and internal parenchymal organs, as well as diabetes, cancer, and infectious diseases [15,16,17]. The unique features of the WJ-MSCs and SA-MSCs allow them to be used for allogeneic and xenogeneic transplantation, thanks to their lower immunogenicity [18,19,20,21].
Nonetheless, WJ-MSCs and SA-MSCs release extracellular vesicles like exosomes and microvesicles which contain various biologically active substances and can be modulated by stimuli added to the culture environment of the stem cells, which makes it even more suitable for treatment of certain medical conditions [15,22].
Anatomically, the umbilical cord is composed of an amniotic epithelium covering the surface of the UC, followed by the subamnion that surrounds a central core of mucoid connective tissue (“Wharton’s jelly”) containing three vessels—a vein and two arteries [23,24]. MSC populations with varied stemness characteristics have been isolated from various compartments of the UC such as the amnion (amnionic epithelial membrane), subamnion region (cord lining membrane), Wharton’s jelly, and perivascular areas [25,26,27]. The potential for proliferation, the differentiation capacity, and the expression of MSC-specific profile and pluripotency-associated genes (OCT4, SOX2, NANOG, and SSEA-4) have been examined extensively in UC-MSCs. Evidence suggests that the culture conditions and isolation technique have an impact on both the cell yield and the biological properties of MSCs [28,29]. Moreover, the absence of standardization in UC-MSC isolation and growth affects the reproducibility and comparability of outcomes in the studies [30].
Umbilical cord cells are obtained by three ways—enzyme digestion, explant tissue approach, and combinations of these two techniques [28,31,32]. In the enzymatic methods, the numbers and types of proteolytic enzymes used may lead to the damage of the cell membranes and the loss of ability to adhere or to proliferate, and may also alter MSC properties by the degradation of surface receptors [28,33]. By contrast, the explant methods employ the property of MSCs to migrate out of the tissue and to adhere to the plastic surface, avoiding cell damage [34]. Furthermore, the untouched extracellular matrix is active during the period of primary culture providing crucial signals important for migrating MSCs [35]. A comparison of explant culture and enzymatic digestion methods showed that the explant method is the most effective with a higher yield and purer cell populations [29,36].
Within this context, this study was designed to use an optimized explant method to obtain MSCs from Wharton’s jelly and the subamnion and to compare their biological characteristics.

2. Materials and Methods

2.1. Isolation of MSCs from Human UC

Human umbilical cords (n = 6) were obtained from the University Hospital of Obstetrics and Gynecology “Maichin Dom”. All samples were transported to the laboratory in sterile phosphate-buffered saline (PBS) (Sigma-Aldrich, Saint Louis, MO, USA) within 3 h after birth, and the process was initiated within 4 h of delivery. The umbilical cord was repeatedly washed in PBS to remove blood cells. Then, it was cut into ~2 cm pieces that were placed on a Petri dish and cut longitudinally to reveal the umbilical arteries and vein. The blood vessels were removed, and the Wharton’s jelly and subamnion were carefully separated. Wharton’s jelly absorbed DMEM (containing phenol red) and it can be easily distinguished from the enveloping membrane of the umbilical cord. The loose tissue of Wharton’s jelly was carefully removed from the denser subamnion using a scalpel, as described by Jeschke et al. (2011) [23]. Wharton’s jelly was divided into segments (10 mm2) that were placed in 6-well plates. The pieces of outer membrane were laid with a subamnion facing the bottom of the dish (6-well plate). Approximately 6–7 WJ and SA pieces from 2 cm of the UC were dissected. The pieces were allowed to adhere to the plastic for five minutes at room temperature before the culture medium was added. The level of culture medium was kept at or below the height of the tissue parts in order to avoid detachment from the dish. Complete culture medium—Dulbecco’s modified Eagle’s medium (DMEM, Low glucose, PAN-Biotech, Aidenbach, Germany) supplemented with 10% FBS (Sigma-Aldrich, Saint Louis, MO, USA), 2 mM L-glutamine, 1% MEM Non-essential Amino Acid Solution (Sigma-Aldrich, Saint Louis, MO, USA), and 1% Penicillin/Steptomycin/Amphotericin B Mix (PAN-Biotech, Aidenbach, Germany) were used. Subsequently, the dishes were placed in a humidified atmosphere with 5% CO2 at 37 °C. After 2 days of incubation, the culture medium was changed, and we observed the formation of cell outgrowths from the explant. Then, the medium was changed twice a week.
Additionally, a histological slide was prepared by taking a sample from a transversal cut through the umbilical cord and subsequently fixation with 10% buffered formalin followed by paraffin wax embedding. The histological slides were prepared stained with the hematoxylin–eosin staining method, as described elsewhere [37].

2.2. Cell Viability: MTT Assay

The cell viability was determined by an MTT colorimetric assay. MSCs were seeded in 96-well plates at a density of 5 × 103 cells/well. The culture medium was replaced every 48 h. Cell viability was measured every 24 h up to day 7, the culture medium was removed, and 100 µL of 0.5 mg/mL 3-[4,5-dimethylthiazol-2-yl]-2,5- diphenyl-tetrazolium bromide (MTT) (Sigma-Aldrich, Saint Louis, MO, USA, Sigma) in complete culture medium was added. Cells were incubated with MTT at 37 °C for 4 h. During the incubation period, MTT was reduced to purple insoluble formazan precipitates by the activity of mitochondrial dehydrogenases in viable cells. Then, the medium was removed, and formazan crystals in the wells were dissolved in 100 μL of dimethyl sulfoxide (DMSO, Sigma Aldrich, Saint Louis, MO, USA). The optical density was measured at 544 nm with a 96-well microplate reader (FLUOstar Optima, BMG Labtech, Offenburg, Germany) using DMSO as a blank control.
The population doubling time (PDT) was calculated using the following equation:
PDT = duration (hours) × log(2)/log(FinalConcentration) − log(InitalConcentration).

2.3. Flow Cytometry Immunophenotyping

MSCs at passages 3–5 (80–90% confluence) were detached from the culture dish by 0.25% trypsin–EDTA (Sigma-Aldrich, Saint Louis, MO, USA), washed twice in PBS, and suspended in a concentration ~ 2 × 105 cells/test. The harvested cells were stained with 0.1 µg of CD29-PE, CD34-FITC, CD45-FITC, CD73-PE, CD90-FITC, HLA-DR-FITC, and HLA-ABC-FITC anti-human monoclonal antibodies purchased from BD Biosciences (San Jose, CA, USA). Negative control staining was performed by staining the cells with an identical concentration of FITC- and PE-conjugated mouse IgG isotype antibodies (BD Biosciences, San Jose, CA, USA). After 30 min of incubation at 4°C temperature in the dark, stained cells were washed twice in PBS, resuspended in 300 µL PBS, and acquired on an FACS Calibur flow cytometer (BD Biosciences, San Jose, CA, USA). Data analyses were performed using CellQuest Pro software version 5.1 (BD Biosciences, San Jose, CA, USA).

2.4. Cell Differentiation

Adipogenic and osteogenic differentiations were described previously [38]. After three weeks of treatment with a change of medium twice a week, the cells were fixed in 4% PFA (Sigma-Aldrich, Saint Louis, MO, USA) for 20 min and stained by Oil Red O for adipogenic differentiation and by von Kossa for osteogenic differentiation.

2.5. Immunofluorescence Assays

Cells were seeded on coverslips, incubated overnight to adhere, and fixed in 4% PFA at room temperature for 20 min. Then, MSCs were blocked with 1% bovine serum albumin (Sigma-Aldrich, Saint Louis, MO, USA) and permeabilized in 0.1% Triton X-100 (Merck, Darmstadt, Germany) in PBS at RT for 1 h. The cells were stained with anti-human antibodies: monoclonal mouse anti-OCT-4 (1:50), polyclonal goat anti-NANOG (1:20), monoclonal mouse anti-SOX2 (1:50), monoclonal mouse anti SSEA-4 (1:50) purchased from R&D Systems (Minneapolis, MN, USA), monoclonal mouse anti-α-actinin (1:500, abcam, Cambridge, UK), and monoclonal mouse anti-Vimentin (1:500 eBioscience, Thermo Fisher Scientific, Waltham, MA, USA). After overnight incubation with primary antibodies at 4°C, the cells were washed with PBS and then incubated with anti-mouse Alexa Fluor 488 and anti-goat Alexa Fluor 594 conjugated antibodies (1:100; Thermo Fisher Scientific, Invitrogen, Waltham, MA, USA) at RT for 1 h. Following washing with PBS, MSCs were stained with l μg/mL Hoechst 33,258 (Sigma-Aldrich, Saint Louis, MO, USA) at room temperature for 5 min. Finally, the cells were washed twice with PBS, and then mounted on slides by Fluoromount-G (SouthernBiotech, Birmingham, AL, USA). Images were taken using a Leica TCS SPE confocal microscope (Leica Microsystems, Wetzlar, Germany).

2.6. RNA Extraction and RT-PCR Analyses

Total RNA was extracted from MSCs utilizing TRI Reagent (Sigma-Aldrich, Saint Louis, MO, USA), according to the instructions of the manufacturer. RNA quality and purity were evaluated by a BioSpectrophotometer (Eppendorf, Hamburg, Germany) (A260/A280 1.8–2 was considered suitable for further analysis). RNA was then reversely transcribed into cDNA using a RevertAid First Stand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). PCR was performed in a Stratagene Mx3005P real-time thermocycler (Thermo Fisher Scientific, Waltham, MA, USA) using the gene-specific primers shown in Table 1. Relative gene expression was determined by the normalization of the fluorescence intensity to b-actin gene expression using the Pfaffl method [39].

2.7. Statistics

All value measurements were presented as mean ± standard deviation values. A statistical comparison was performed using independent-samples t-test. All experiments were performed in triplicate. A value of p < 0.05 was considered to be statistically significant.

3. Results

3.1. Identification of Umbilical Cord-Derived Cells

Cells were effectively isolated by the above-described explant method from the WJ and SA (Figure 1A). Approximately 48 to 72 h after starting the cultures, the first migratory cells were observed (Figure 1B). The cells grew out of explant pieces and displayed a fibroblast-like and spindle-shaped morphology. A small amount of large polygonal, flattened cells were observed as well. All cells were firmly attached to the culture plastic, proliferated, and reached over 40% confluence after an average of 8–10 days (n = 6). Then, the explants were transferred to new wells and culture for another 10 days. The cells formed a dense monolayer around 16–18 days. The number of WJ-MSCs was 5–6 × 104 cells/cm2, while 3–4 × 104 cells/cm2 were obtained for SA-MSCs (passage 0).
An analysis of the MSC morphology in culture (length and width) revealed significant differences in length between WJ-MSCs and SA-MSCs (Figure 2). In comparison to SA-MSCs (mean/median 129/128 µm), WJ-MSCs (mean/median 149/154 µm) were longer (p < 0.05). There was no significant difference in the width of WJ-MSCs (mean/median 34/25 µm) and SA-MSCs (mean/median 41/35 µm). WJ-MSCs showed a higher polarity index (mean/median 5,7/6,6), as there were more elongated cells (p < 0.005). The lower polarity index of SA-MSCs (mean/median 3,9/3,5) indicates a more rounded cell shape.
To overcome variations in cells caused by the difference in the passage number, all experiments were conducted on cells at passage 3, except some flow cytometric analyses that were performed up to the 5th passage. During the cultivation period between the cells obtained from the WJ and SA, no significant morphological differences were observed.
The cells isolated from the WJ and SA were harvested and subjected to immunophenotyping. They were > 95% positive for the thymocyte differentiation antigen-1 CD90, the ecto-5′-nucleotidase CD73, b1-integrin CD29, and Class I histocompatibility protein HLA-ABC. A flow cytometric analysis was negative for the primitive hematopoietic progenitor and endothelial cell marker CD34, the pan-leukocyte marker CD45, and class II histocompatibility molecule HLA-DR (Figure 3).
To examine the differentiation potential of the WJ- and SA-derived cells, osteogenic and adipogenic differentiations were used. The adipogenic differentiation, which was evaluated by the accumulation of cytoplasmic vacuoles, and osteogenic differentiation, verified by deposition of calcium and von Kossa staining, were evident in both cell types (Figure 4).
The immunofluorescent staining showed a clear cytoplasmic expression of Vimentin (a major component of the cytoskeleton) and α-actinin (a cytoskeletal actin-binding protein) in both WJ-MSCs and SA-MSCs (Figure 5).
The reported differentiation capacity and the expression of the surface markers and plastic adherence properties were under the minimal phenotypic criteria for MSCs defined by the International Society of Cellular Therapy (ISCT) [40].

3.2. Growth Characteristics

The growth characteristics of MSCs are essential for providing the required quantity of cells for clinical use. Consequently, a comparison of the growth of WJ-MSCs and SA-MSCs was performed. The results showed no significant difference in the proliferation profiles (Figure 6A). Based on the calculation, the PDT of the WJ-MSCs was 29.19 ± 7.7 h, and that of the SA-MSCs was 31.96 ± 6.4 h (Figure 6B).

3.3. Expression of Pluripotency-Associated Genes

The OCT4A (octamer-biding transcription factor 4A), NANOG, and SOX2 (Sex determining region Y-box 2) were found to be present in the nuclei of both cell types. Additionally, a cytoplasmic expression of NANOG was observed. The surface protein SSEA4 (stage-specific embryonic antigen-4) was detected in MSCs from the SA and WJ (Figure 7). Comparing the levels for mRNA of OCT4A, OCT4B, OCT4B1, NANOG, and SOX2 in both WJ-MSCs and SA-MSCs, no statistically significant differences were found (Figure 8).

4. Discussion

Our goal was to obtain a higher initial number of cells with homogenized characteristics using the explant method. For this purpose, we extracted cells from the two UC tissues that contain the most MSCs: Wharton’s jelly and subamnion. To increase the amount of isolated cells, we removed the tissue fragments on day 10 and transferred them to new dishes. A comparison between the method that we used and other explant methods is given in Table 2.
In Table 2, we can see a comparison between the method that we used and other similar methods for isolation of MSCs from UC tissues. There is great variation between the size of the explants in the different studies and the number of explants per culture dish/well. As for the discarding of the explant from initial isolation site, the earliest mentioned period was 8 days (13), and our results were second best with 10 days. Another interesting parameter is the initial cell number per cm/cm2 of WJ, where we obtained better results in comparison to the other papers which used the same way of expression of the cell number. As for the confluence and population doubling time, our results were comparable with those of the other authors, with very few accomplishing better times. There are however several points that needs to be taken in account. First of all, not all the authors provided all the necessary data, which would have allowed us to perform a full and detailed comparison of the used methods. This is well presented in Table 2, where we can clearly see that the authors often do not present data on the initial cells number, cell doubling time, etc. Secondly, we isolated cells not only from the WJ but also from the SA, which was not performed in the other studies. The SA results that we obtained for initial cell number and growing time were very good as well. The lower number of obtained cells from the SA in comparison with the WJ could be attributed to the fact that the initial amount of cells in the WJ is higher than that in SA, as has already been proven [25,26]. In addition, in our study, the explants were used again in order to isolate more cells, which eventually led to the faster accumulation of a larger number of MSCs, which was not the case with the rest of the studies. In another paper, Otte et al. (2013) also used the explant method for obtaining MSCs [50]. However, they used the entire umbilical cord tissue, without the distinction of the region of origin, and due to the different approach in the sampling and processing of the cell isolation and transferring of the explants, it was impossible to draw a proper comparison between their method and the one we used.
This study also pays heed to the biological characteristics of MSC populations derived from Wharton’s jelly and the subamnion region by the explant method. The explant method seems to be less stressful for the cells compared to the enzyme digestion method [51]. Moreover, it leads to the isolation of more homogeneous cell populations with higher proliferation rates [33]. The presence of the tissue pieces facilitates the transfer of cells from in vivo to in vitro conditions [35]. Furthermore, the tissue pieces provide a microenvironment important for keeping MSCs in a stem cell-like state during long-term in vitro culturing [50].
In the scientific literature, there are various modifications of the explant method that include long-term explant cultures [42]. In our study, after a culture period of 8–10 days, the cells reached a confluence of around 50%. At this stage, the pieces of the specimens were transferred to new dishes and allowed more cells to migrate. This optimization makes it possible to obtain more cells per low passage. The cells from the same passage were put together and examined. In this way, we received enough cells from the Wharton’s jelly and subamnion to perform all experiments on cells between the third and fifth passage. The selection of explant sizes and period of outgrowth from explants was based on the available scientific literature on the topic.
The cells isolated from the WJ and SA of the UC by the explant method displayed a similar fibroblast-like morphology, with no significant difference related to their origin. The populations of epithelial-like cells reported in the culture obtained from the subamnion region by Kita et al. were not detected [25]. Semenova et al. reported significant differences in the percentages of CD73-, CD105-, and D90-positive cells from the WJ and umbilical cord membrane (contain epithelial and mesenchymal layer) [44]. At early passage (passages 3–5), we found no significant differences between the common MSC signature markers (CD29, CD73, CD90, CD105, and HLA-DR) in the cells from the WJ and SA, which is consistent with the report of Subramanian et al. [26]. MSCs from the UC and SA demonstrated osteogenic and adipogenic potential, which is in consensus with previous studies on the topic [36,44,52].
MSC-based therapies require the production of large cell doses (0.5–12 × 106 cells/kg body weight) to support the application of MSCs in cell-based therapy and clinical trials [53,54]. Also, allogeneic MSC doses might go up to 1 × 108 cells/kg [54]. Hence, the proliferation ability, as an indicator of the MSC potential to be repetitively expanded, should be considered as an essential characteristic for the assessment of MSCs. Our analysis revealed that MSCs derived from the WJ and SA, using the explant method described above, had the same proliferative capacity and displayed a relatively short population doubling time of 29.19 ± 7.7 h for WJ-MSCs and 31.96 ± 6.4 h for SA-MSCs. According to published data, the population doubling time of the UC-MSCs obtained by the explant method was found to vary among different groups, ranging from 26 h to 60 h in early passage cells [36,55,56].
To better characterize WJ-MSCs and SA-MSCs, we paid attention to the expression of pluripotency-associated genes, oct4, nanog, and sox2. These gene code transcription factors are generally considered important for the efficient maintenance of the fine balance between self-renewal and differentiation in human embryonic stem cells [57]. OCT4, SOX2, and NANOG are typically part of core reprogramming cocktails that can induce pluripotent properties in somatic cells [58,59]. The transcription factor OCT4 was shown to maintain the pluripotency of mouse and human embryonic stem cells [60]. In stem cell research, it is common for authors to use the OCT4 gene as a reference to OCT4A. The gene coding for OCT4A also generates OCT4B and OCT4B1 [61]. Although there has been extensive research on the function of OCT4A in maintaining pluripotency in stem cells, the function of OCT4B protein isoforms remains unclear. In the literature, data for the expression OCT4, SOX2, NANOG, and SSEA-4 in MSCs derived from the UC are controversial. At the protein level, we detected OCT4, SOX2, and NANOG in WJ-MSCs and SA-MSCs, similarly to a previous report by Bharti et al. [48]. Salehinejad et al. indicated a slight expression of OCT4 (11.31 ± 1.77) in WJ-MSCs isolated by the explant method [33]. We also confirmed the SSEA-4-positive cell population in SA-MSCs [25] and WJ-MSCs [62].
At the mRNA level, several studies reported the expression of OCT4, SOX2, and NANOG in MSCs isolated from the entire UC or WJ by the explant method [48,51]. Also, the expression for OCT4 and NANOG in WJ-MSCs obtained by enzyme digestion has been reported [63,64]. Kita et al. displayed the presence of OCT-3/4 and NANOG and a lack of SOX2 in MSCs derived from subamniotic human umbilical cord lining membrane by explant cultures [25]. On the other hand, Deuse et al. reported that umbilical cord lining MSCs are negative for OCT4 and SOX2 [65]. The comparison of MSCs isolated from various compartments of the human umbilical cord displayed a significantly lower expression of OCT4A, OCT4B, NANOG, and SOX2 genes in cells from the SA and amnion compared to cells from WJ [26]. Apart from that, OCT4A and OCT4B genes were significantly less expressed in cells from the UC compared to WJ [26]. By contrast, we identified similar levels of mRNA for OCT4A, OCT4B, NANOG, and SOX2 in both SA-MSCs and WJ-MSCs.
The applied explant method appears to predominantly enrich WJ-MSCs and SA-MSCs, which possess no difference in growth kinetics, MSC characteristics, and the expression of pluripotency markers (OCT4, NANOG, SOX2, and SSEA-4).

5. Conclusions

The optimization of the explant method that we applied was achieved by using 10 mm2 samples from either the WJ or SA and discarding the explants 10 days later. The discarded explants were re-used for the isolation of more MSCs by repeating the procedure. This methodology led to the obtaining of an initial cell number of 5–6 × 104 cells/cm2 from the WJ and 3–4 × 104 cells/cm2 from the SA. A confluence of 80–90% was reached on days 16–18 for the cells from both origins. The culture medium used was Dulbecco’s modified Eagle’s medium supplemented with 10% FBS, without the addition of growth factors, which makes it one of the more affordable options on the market. The isolated cells from the Wharton’s jelly and subamnion had the typical characteristics of mesenchymal stromal/stem cells, which was proven by several different approaches. The conducted tests show that by using this optimization, it is possible to obtain relatively homogenous populations of MSCs, which will be useful both for experimental and practical applications.

Author Contributions

Conceptualization, all authors; methodology, all authors; validation, E.S. and M.C.; formal analysis, E.S.; investigation, S.K. and T.O.; data curation, E.S. writing—original draft preparation, E.S and M.C. writing—review and editing, all authors; visualization, all authors. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Bulgarian National Science Fund, Ministry of Education and Science, Bulgaria, Grant number DM01/3.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and the protocol was approved by the Ethics Committee of the University Hospital of Obstetrics and Gynecology “Maichin Dom”, (DN 25-05-69, 6 November 2018).

Informed Consent Statement

Umbilical cords were obtained from healthy full-term newborns after receiving informed consent from their mothers.

Data Availability Statement

The data supporting the reported results can be made available upon request to the authors.

Acknowledgments

We want to express our gratitude to Lyubomir Djerov and Assen Nikolov from the University Hospital of Obstetrics and Gynecology “Maichin Dom”, Sofia, Bulgaria, who helped us with obtaining the biological specimens.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Ayala-Cuellar, A.P.; Kang, J.H.; Jeung, E.B.; Choi, K.C. Roles of Mesenchymal Stem Cells in Tissue Regeneration and Immunomodulation. Biomol. Ther. 2019, 27, 25–33. [Google Scholar] [CrossRef] [PubMed]
  2. Can, A.; Karahuseyinoglu, S. Concise review: Human umbilical cord stroma with regard to the source of fetus-derived stem cells. Stem Cells 2007, 25, 2886–2895. [Google Scholar] [CrossRef] [PubMed]
  3. Han, Y.; Li, X.; Zhang, Y. Mesenchymal Stem Cells for Regenerative Medicine. Cells 2019, 8, 886. [Google Scholar] [CrossRef] [PubMed]
  4. Hass, R.; Kasper, C.; Bohm, S.; Jacobs, R. Different populations and sources of human mesenchymal stem cells (MSC): A comparison of adult and neonatal tissue-derived MSC. Cell Commun. Signal. CCS 2011, 9, 12. [Google Scholar] [CrossRef] [PubMed]
  5. Choudhery, M.S.; Badowski, M.; Muise, A.; Harris, D.T. Comparison of human mesenchymal stem cells derived from adipose and cord tissue. Cytotherapy 2013, 15, 330–343. [Google Scholar] [CrossRef]
  6. Drela, K.; Lech, W.; Figiel-Dabrowska, A.; Zychowicz, M.; Mikula, M.; Sarnowska, A.; Domanska-Janik, K. Enhanced neuro-therapeutic potential of Wharton’s Jelly-derived mesenchymal stem cells in comparison with bone marrow mesenchymal stem cells culture. Cytotherapy 2016, 18, 497–509. [Google Scholar] [CrossRef]
  7. Baksh, D.; Yao, R.; Tuan, R.S. Comparison of proliferative and multilineage differentiation potential of human mesenchymal stem cells derived from umbilical cord and bone marrow. Stem Cells 2007, 25, 1384–1392. [Google Scholar] [CrossRef]
  8. Hamidian Jahromi, S.; Li, Y.; Davies, J.E. Effect of Tumor Necrosis Factor Alpha Dose and Exposure Time on Tumor Necrosis Factor-Induced Gene-6 Activation by Neonatal and Adult Mesenchymal Stromal Cells. Stem Cells Dev. 2018, 27, 44–54. [Google Scholar] [CrossRef]
  9. Nagamura-Inoue, T.; Kato, S.; Najima, Y.; Isobe, M.; Doki, N.; Yamamoto, H.; Uchida, N.; Takahashi, A.; Hori, A.; Nojima, M.; et al. Immunological influence of serum-free manufactured umbilical cord-derived mesenchymal stromal cells for steroid-resistant acute graft-versus-host disease. Int. J. Hematol. 2022, 116, 754–769. [Google Scholar] [CrossRef]
  10. Umer, A.; Khan, N.; Greene, D.L.; Habiba, U.E.; Shamim, S.; Khayam, A.U. The Therapeutic Potential of Human Umbilical Cord Derived Mesenchymal Stem Cells for the Treatment of Premature Ovarian Failure. Stem Cell Rev. Rep. 2023, 19, 651–666. [Google Scholar] [CrossRef]
  11. Gherghel, R.; Macovei, L.A.; Burlui, M.-A.; Cardoneanu, A.; Rezus, I.-I.; Mihai, I.R.; Rezus, E. Osteoarthritis—The Role of Mesenchymal Stem Cells in Cartilage Regeneration. Appl. Sci. 2023, 13, 10617. [Google Scholar] [CrossRef]
  12. Zhang, Y.; Zhuang, H.; Ren, X.; Jiang, F.; Zhou, P. Therapeutic effects of different intervention forms of human umbilical cord mesenchymal stem cells in the treatment of osteoarthritis. Front. Cell Dev. Biol. 2023, 11, 1246504. [Google Scholar] [CrossRef] [PubMed]
  13. Cheng, L.; Wang, S.; Peng, C. Human umbilical cord mesenchymal stem cells for psoriasis: A phase 1/2a, single-arm study. Signal Transduct. Target. Ther. 2022, 7, 263. [Google Scholar] [CrossRef]
  14. Li, L.; Li, J.; Guan, H.; Oishi, H.; Takahashi, S.; Zhang, C. Human umbilical cord mesenchymal stem cells in diabetes mellitus and its complications: Applications and research advances. Int. J. Med. Sci. 2023, 20, 1492–1507. [Google Scholar] [CrossRef]
  15. Patel, A.A.; Mohamed, A.H.; Rizaev, J.; Mallick, A.K.; Qasim, M.T.; Abdulmonem, W.A.; Jamal, A.; Hattiwale, H.M.; Kamal, M.A.; Ahmad, F. Application of mesenchymal stem cells derived from the umbilical cord or Wharton’s jelly and their extracellular vesicles in the treatment of various diseases. Tissue Cell 2024, 89, 102415. [Google Scholar] [CrossRef]
  16. Yudintceva, N.; Mikhailova, N. Mesenchymal Stem Cells and MSCs-Derived Extracellular Vesicles in Infectious Diseases: From Basic Research to Clinical Practice. Bioengineering 2022, 9, 662. [Google Scholar] [CrossRef] [PubMed]
  17. Zhao, Y.; Ma, J.; Yi, P.; Wu, J.; Zhao, F.; Tu, W.; Liu, W.; Li, T.; Deng, Y.; Hao, J.; et al. Human umbilical cord mesenchymal stem cells restore the ovarian metabolome and rescue premature ovarian insufficiency in mice. Stem Cell Res. Ther. 2020, 11, 466. [Google Scholar] [CrossRef]
  18. Li, J.; Zhou, Z.; Wen, J.; Jiang, F.; Xia, Y. Human Amniotic Mesenchymal Stem Cells Promote Endogenous Bone Regeneration. Front. Endocrinol. 2020, 11, 543623. [Google Scholar] [CrossRef] [PubMed]
  19. Wang, H.; Mao, X.; Zhong, Y.; Zhao, X.; Li, C.; Jiang, J.; Hong, Z.; Wang, N.; Wang, F. Human amniotic mesenchymal stem cells inhibit immune rejection injury from allogeneic mouse heart transplantation: A preliminary study on the microRNA expression. Transpl. Immunol. 2024, 84, 102022. [Google Scholar] [CrossRef]
  20. Stefańska, K.; Ożegowska, K.; Hutchings, G.; Popis, M.; Moncrieff, L.; Dompe, C.; Janowicz, K.; Pieńkowski, W.; Gutaj, P.; Shibli, J.A. Human Wharton’s Jelly-Cellular Specificity, Stemness Potency, Animal Models, and Current Application in Human Clinical Trials. J. Clin. Med. 2020, 9, 1102. [Google Scholar] [CrossRef]
  21. Huang, P.Y.; Shih, Y.H.; Tseng, Y.J.; Ko, T.L.; Fu, Y.S.; Lin, Y.Y. Xenograft of human umbilical mesenchymal stem cells from Wharton’s jelly as a potential therapy for rat pilocarpine-induced epilepsy. Brain Behav. Immun. 2016, 54, 45–58. [Google Scholar] [CrossRef]
  22. Ferreira, J.R.; Teixeira, G.Q.; Santos, S.G.; Barbosa, M.A.; Almeida-Porada, G.; Gonçalves, R.M. Mesenchymal Stromal Cell Secretome: Influencing Therapeutic Potential by Cellular Pre-conditioning. Front. Immunol. 2018, 9, 2837. [Google Scholar] [CrossRef] [PubMed]
  23. Jeschke, M. Umbilical Cord Lining Membrane and Wharton’s Jelly-Derived Mesenchymal Stem Cells: The Similarities and Differences. Open Tissue Eng. Regen. Med. J. 2011, 4, 21–27. [Google Scholar] [CrossRef]
  24. Vieira Paladino, F.; de Moraes Rodrigues, J. The Immunomodulatory Potential of Wharton’s Jelly Mesenchymal Stem/Stromal Cells. Stem Cells Int. 2019, 2019, 3548917. [Google Scholar] [CrossRef]
  25. Kita, K.; Gauglitz, G.G.; Phan, T.T.; Herndon, D.N.; Jeschke, M.G. Isolation and characterization of mesenchymal stem cells from the sub-amniotic human umbilical cord lining membrane. Stem Cells Dev. 2010, 19, 491–502. [Google Scholar] [CrossRef]
  26. Subramanian, A.; Fong, C.Y.; Biswas, A.; Bongso, A. Comparative Characterization of Cells from the Various Compartments of the Human Umbilical Cord Shows that the Wharton’s Jelly Compartment Provides the Best Source of Clinically Utilizable Mesenchymal Stem Cells. PLoS ONE 2015, 10, e0127992. [Google Scholar] [CrossRef]
  27. Alatyyat, S.M.; Alasmari, H.M.; Aleid, O.A.; Abdel-Maksoud, M.S.; Elsherbiny, N. Umbilical cord stem cells: Background, processing and applications. Tissue Cell 2020, 65, 101351. [Google Scholar] [CrossRef] [PubMed]
  28. Tong, C.K.; Vellasamy, S.; Tan, B.C.; Abdullah, M.; Vidyadaran, S.; Seow, H.F.; Ramasamy, R. Generation of mesenchymal stem cell from human umbilical cord tissue using a combination enzymatic and mechanical disassociation method. Cell Biol. Int. 2011, 35, 221–226. [Google Scholar] [CrossRef]
  29. Hua, J.; Gong, J.; Meng, H.; Xu, B.; Yao, L.; Qian, M.; He, Z.; Zou, S.; Zhou, B.; Song, Z. Comparison of different methods for the isolation of mesenchymal stem cells from umbilical cord matrix: Proliferation and multilineage differentiation as compared to mesenchymal stem cells from umbilical cord blood and bone marrow. Cell Biol. Int. 2013, 38, 198–210. [Google Scholar] [CrossRef]
  30. Mushahary, D.; Spittler, A.; Kasper, C.; Weber, V.; Charwat, V. Isolation, cultivation, and characterization of human mesenchymal stem cells. Cytometry. Part A J. Int. Soc. Anal. Cytol. 2018, 93, 19–31. [Google Scholar] [CrossRef]
  31. Teoh, P.L.; Mohd Akhir, H.; Abdul Ajak, W.; Hiew, V.V. Human Mesenchymal Stromal Cells Derived from Perinatal Tissues: Sources, Characteristics and Isolation Methods. Malays. J. Med. Sci. MJMS 2023, 30, 55–68. [Google Scholar] [CrossRef]
  32. Zheng, S.; Gao, Y.; Chen, K.; Liu, Y.; Xia, N.; Fang, F. A Robust and Highly Efficient Approach for Isolation of Mesenchymal Stem Cells From Wharton’s Jelly for Tissue Repair. Cell Transpl. 2022, 31, 9636897221084354. [Google Scholar] [CrossRef]
  33. Salehinejad, P.; Alitheen, N.B.; Ali, A.M.; Omar, A.R.; Mohit, M.; Janzamin, E.; Samani, F.S.; Torshizi, Z.; Nematollahi-Mahani, S.N. Comparison of different methods for the isolation of mesenchymal stem cells from human umbilical cord Wharton’s jelly. Vitr. Cell. Dev. Biol. Anim. 2012, 48, 75–83. [Google Scholar] [CrossRef]
  34. Freshney, R. Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications, 6th ed.; John Wiley & Sons: Hoboken, NJ, USA, 2010; Volume 346, p. 796. [Google Scholar]
  35. Hendijani, F. Explant culture: An advantageous method for isolation of mesenchymal stem cells from human tissues. Cell Prolif. 2017, 50, e12334. [Google Scholar] [CrossRef]
  36. Skiles, M.L.; Marzan, A.J.; Brown, K.S.; Shamonki, J.M. Comparison of umbilical cord tissue-derived mesenchymal stromal cells isolated from cryopreserved material and extracted by explantation and digestion methods utilizing a split manufacturing model. Cytotherapy 2020, 22, 581–591. [Google Scholar] [CrossRef]
  37. Bancroft, J.D.; Layton, C. The Hematoxylin and Eosin. In Theory & Practice of Histological Techniques, 7th ed.; Suvarna, S.K., Layton, C., Bancroft, J.D., Eds.; Churchill Livingstone of El Sevier: Philadelphia, PA, USA, 2013; Volume 10–11, pp. 172–214. [Google Scholar] [CrossRef]
  38. Kestendjieva, S.; Kyurkchiev, D.; Tsvetkova, G.; Mehandjiev, T.; Dimitrov, A.; Nikolov, A.; Kyurkchiev, S. Characterization of mesenchymal stem cells isolated from the human umbilical cord. Cell Biol. Int. 2008, 32, 724–732. [Google Scholar] [CrossRef] [PubMed]
  39. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
  40. Jez, M.; Ambady, S.; Kashpur, O.; Grella, A.; Malcuit, C.; Vilner, L.; Rozman, P.; Dominko, T. Expression and differentiation between OCT4A and its Pseudogenes in human ESCs and differentiated adult somatic cells. PLoS ONE 2014, 9, e89546. [Google Scholar] [CrossRef]
  41. Todtenhaupt, P.; Franken, L.A.; Groene, S.G.; van Hoolwerff, M.; van der Meeren, L.E.; van Klink, J.M.M.; Roest, A.A.W.; de Bruin, C.; Ramos, Y.F.M.; Haak, M.C.; et al. A robust and standardized method to isolate and expand mesenchymal stromal cells from human umbilical cord. Cytotherapy 2023, 25, 1057–1068. [Google Scholar] [CrossRef] [PubMed]
  42. Hendijani, F.; Sadeghi-Aliabadi, H.; Haghjooy Javanmard, S. Comparison of human mesenchymal stem cells isolated by explant culture method from entire umbilical cord and Wharton’s jelly matrix. Cell Tissue Bank. 2014, 15, 555–565. [Google Scholar] [CrossRef]
  43. Doan, C.C.; Le, T.L.; Hoang, N.S.; Doan, N.T.; Le, V.D.; Do, M.S. Differentiation of umbilical cord lining membrane-derived mesenchymal stem cells into endothelial-like cells. Iran. Biomed. J. 2014, 18, 67–75. [Google Scholar] [CrossRef]
  44. Semenova, E.; Grudniak, M.P.; Machaj, E.K.; Bocian, K.; Chroscinska-Krawczyk, M.; Trochonowicz, M.; Stepaniec, I.M.; Murzyn, M.; Zagorska, K.E.; Boruczkowski, D.; et al. Mesenchymal Stromal Cells from Different Parts of Umbilical Cord: Approach to Comparison & Characteristics. Stem Cell Rev. Rep. 2021, 17, 1780–1795. [Google Scholar] [CrossRef] [PubMed]
  45. He, H.; Nagamura-Inoue, T.; Tsunoda, H.; Yuzawa, M.; Yamamoto, Y.; Yorozu, P.; Agata, H.; Tojo, A. Stage-specific embryonic antigen 4 in Wharton’s jelly-derived mesenchymal stem cells is not a marker for proliferation and multipotency. Tissue Eng. Part A 2014, 20, 1314–1324. [Google Scholar] [CrossRef]
  46. Mori, Y.; Ohshimo, J.; Shimazu, T.; He, H.; Takahashi, A.; Yamamoto, Y.; Tsunoda, H.; Tojo, A.; Nagamura-Inoue, T. Improved explant method to isolate umbilical cord-derived mesenchymal stem cells and their immunosuppressive properties. Tissue Eng. Part C Methods 2015, 21, 367–372. [Google Scholar] [CrossRef] [PubMed]
  47. Hassan, G.; Kasem, I.; Soukkarieh, C.; Aljamali, M. A Simple Method to Isolate and Expand Human Umbilical Cord Derived Mesenchymal Stem Cells: Using Explant Method and Umbilical Cord Blood Serum. Int. J. Stem Cells 2017, 10, 184–192. [Google Scholar] [CrossRef] [PubMed]
  48. Bharti, D.; Shivakumar, S.B.; Park, J.K.; Ullah, I.; Subbarao, R.B.; Park, J.S.; Lee, S.L.; Park, B.W.; Rho, G.J. Comparative analysis of human Wharton’s jelly mesenchymal stem cells derived from different parts of the same umbilical cord. Cell Tissue Res. 2018, 372, 51–65. [Google Scholar] [CrossRef] [PubMed]
  49. Lee, A.Y.; Jang, K.H.; Jo, C.H. Minimal Cube Explant Provides Optimal Isolation Condition of Mesenchymal Stem Cells from Umbilical Cord. Tissue Eng. Regen. Med. 2022, 19, 793–807. [Google Scholar] [CrossRef]
  50. Otte, A.; Bucan, V.; Reimers, K.; Hass, R. Mesenchymal stem cells maintain long-term in vitro stemness during explant culture. Tissue Eng. Part C Methods 2013, 19, 937–948. [Google Scholar] [CrossRef]
  51. Yoon, J.H.; Roh, E.Y.; Shin, S.; Jung, N.H.; Song, E.Y.; Chang, J.Y.; Kim, B.J.; Jeon, H.W. Comparison of explant-derived and enzymatic digestion-derived MSCs and the growth factors from Wharton’s jelly. BioMed Res. Int. 2013, 2013, 428726. [Google Scholar] [CrossRef]
  52. Araújo, A.B.; Salton, G.D.; Furlan, J.M.; Schneider, N.; Angeli, M.H.; Laureano, Á.M.; Silla, L.; Passos, E.P.; Paz, A.H. Comparison of human mesenchymal stromal cells from four neonatal tissues: Amniotic membrane, chorionic membrane, placental decidua and umbilical cord. Cytotherapy 2017, 19, 577–585. [Google Scholar] [CrossRef]
  53. Wang, S.; Qu, X.; Zhao, R.C. Clinical applications of mesenchymal stem cells. J. Hematol. Oncol. 2012, 5, 19. [Google Scholar] [CrossRef]
  54. Jovic, D.; Yu, Y.; Wang, D.; Wang, K.; Li, H.; Xu, F.; Liu, C.; Liu, J.; Luo, Y. A Brief Overview of Global Trends in MSC-Based Cell Therapy. Stem Cell Rev. Rep. 2022, 18, 1525–1545. [Google Scholar] [CrossRef] [PubMed]
  55. Wu, M.; Zhang, R.; Zou, Q.; Chen, Y.; Zhou, M.; Li, X.; Ran, R.; Chen, Q. Comparison of the Biological Characteristics of Mesenchymal Stem Cells Derived from the Human Placenta and Umbilical Cord. Sci. Rep. 2018, 8, 5014. [Google Scholar] [CrossRef] [PubMed]
  56. Dulugiac, M.; Moldovan, L.; Zarnescu, O. Comparative studies of mesenchymal stem cells derived from different cord tissue compartments-The influence of cryopreservation and growth media. Placenta 2015, 36, 1192–1203. [Google Scholar] [CrossRef]
  57. Boyer, L.A.; Lee, T.I.; Cole, M.F.; Johnstone, S.E.; Levine, S.S.; Zucker, J.P.; Guenther, M.G.; Kumar, R.M.; Murray, H.L.; Jenner, R.G.; et al. Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 2005, 122, 947–956. [Google Scholar] [CrossRef] [PubMed]
  58. Yu, J.; Vodyanik, M.A.; Smuga-Otto, K.; Antosiewicz-Bourget, J.; Frane, J.L.; Tian, S.; Nie, J.; Jonsdottir, G.A.; Ruotti, V.; Stewart, R.; et al. Induced pluripotent stem cell lines derived from human somatic cells. Science 2007, 318, 1917–1920. [Google Scholar] [CrossRef]
  59. Stoyanova, E.; Oreshkova, T.; Mourdjeva, M. Generation of human induced pluripotent stem cells from adipose-derived stromal/stem cells isolated from a 75-year-old patient. Arch. Biol. Sci. 2017, 69, 715–721. [Google Scholar] [CrossRef]
  60. Kellner, S.; Kikyo, N. Transcriptional regulation of the Oct4 gene, a master gene for pluripotency. Histol. Histopathol. 2010, 25, 405–412. [Google Scholar] [CrossRef]
  61. Mehravar, M.; Ghaemimanesh, F.; Poursani, E.M. An Overview on the Complexity of OCT4: At the Level of DNA, RNA and Protein. Stem Cell Rev. Rep. 2021, 17, 1121–1136. [Google Scholar] [CrossRef]
  62. He, H.; Nagamura-Inoue, T.; Yuzawa, M.; Yamamoto, Y.; Tsunoda, H.; Tojo, A. Comparative Analysis of SSEA4+ and SSEA4− Mesenchymal Stem Cells Derived From Wharton’s Jelly of Umbilical Cord. Blood 2012, 120, 4735. [Google Scholar] [CrossRef]
  63. Weiss, M.L.; Medicetty, S.; Bledsoe, A.R.; Rachakatla, R.S.; Choi, M.; Merchav, S.; Luo, Y.; Rao, M.S.; Velagaleti, G.; Troyer, D. Human umbilical cord matrix stem cells: Preliminary characterization and effect of transplantation in a rodent model of Parkinson’s disease. Stem Cells 2006, 24, 781–792. [Google Scholar] [CrossRef] [PubMed]
  64. Huang, P.; Qin, X.; Fan, C.; Wang, M.; Chen, F.; Liao, M.; Zhong, H.; Wang, H.; Ma, L. Comparison of Biological Characteristics of Human Umbilical Cord Wharton’s Jelly-Derived Mesenchymal Stem Cells from Extremely Preterm and Term Infants. Tissue Eng. Regen. Med. 2023, 20, 725–737. [Google Scholar] [CrossRef] [PubMed]
  65. Deuse, T.; Stubbendorff, M.; Tang-Quan, K.; Phillips, N.; Kay, M.A.; Eiermann, T.; Phan, T.T.; Volk, H.D.; Reichenspurner, H.; Robbins, R.C.; et al. Immunogenicity and immunomodulatory properties of umbilical cord lining mesenchymal stem cells. Cell Transplant. 2011, 20, 655–667. [Google Scholar] [CrossRef] [PubMed]
Applsci 14 08036 g001
Figure 1. An overview of the isolation of WJ-MSCs and SA-MSCs. (A) Histology of human umbilical cord. (B) Morphology of cells derived from tissue explant technique. Primary explant cultures from human WJ and SA explants at early stage outgrowth at 2 and 8 days after explantation. Cell reached over 80% confluence after 16 days in culture. Scale bar = 200 μm.
Figure 1. An overview of the isolation of WJ-MSCs and SA-MSCs. (A) Histology of human umbilical cord. (B) Morphology of cells derived from tissue explant technique. Primary explant cultures from human WJ and SA explants at early stage outgrowth at 2 and 8 days after explantation. Cell reached over 80% confluence after 16 days in culture. Scale bar = 200 μm.
Applsci 14 08036 g001
Applsci 14 08036 g002
Figure 2. The morphological characteristics of SA-MSCs (n = 220) and WJ-MSCs (n = 205) were analyzed 24 h after passaging (P3). Values were obtained from three pairs isolated from the same UC. SA-MSCs have a longer length, a higher polarity index, and a similar width to WJ-MSCs. Indicated statistical significance represents p < 0.05 *, p < 0.01 **, and a non-significant value is expressed as ‘ns’ in the graph.
Figure 2. The morphological characteristics of SA-MSCs (n = 220) and WJ-MSCs (n = 205) were analyzed 24 h after passaging (P3). Values were obtained from three pairs isolated from the same UC. SA-MSCs have a longer length, a higher polarity index, and a similar width to WJ-MSCs. Indicated statistical significance represents p < 0.05 *, p < 0.01 **, and a non-significant value is expressed as ‘ns’ in the graph.
Applsci 14 08036 g002
Applsci 14 08036 g003
Figure 3. Verification of MSC identity of adherent cells derived from WJ and SA by analyzing the expression of MSC markers. The numbers display the frequency of positive staining for cell surface markers (blue lines) in comparison to the isotype controls (gray histograms). The cells demonstrated positive expression of CD90, CD73, CD29, and HLA-ABC, and negative expression of CD34, CD45, and HLA-DR.
Figure 3. Verification of MSC identity of adherent cells derived from WJ and SA by analyzing the expression of MSC markers. The numbers display the frequency of positive staining for cell surface markers (blue lines) in comparison to the isotype controls (gray histograms). The cells demonstrated positive expression of CD90, CD73, CD29, and HLA-ABC, and negative expression of CD34, CD45, and HLA-DR.
Applsci 14 08036 g003
Applsci 14 08036 g004
Figure 4. Adipogenic and osteogenic differentiation potential of WJ-MSCs and SA-MSCs. Scale bar = 100 μm.
Figure 4. Adipogenic and osteogenic differentiation potential of WJ-MSCs and SA-MSCs. Scale bar = 100 μm.
Applsci 14 08036 g004
Applsci 14 08036 g005
Figure 5. Confocal microscopy images of WJ-MSCs and SA-MSCs stained with Vimentin and α- actinin. Scale bar = 100 μm.
Figure 5. Confocal microscopy images of WJ-MSCs and SA-MSCs stained with Vimentin and α- actinin. Scale bar = 100 μm.
Applsci 14 08036 g005
Applsci 14 08036 g006
Figure 6. Comparison of growth characteristics of WJ-MSCs and SA-MSCs at third passage. (A) Growth curves. The MSCs were plated at an initial density of 5000 cells/well, and the absorption values were detected over 7 days. Each point on the growth curve represents absorption value mean n = 3. (B) Cumulative population doubling time (PDT, measured in hours) (n = 6).
Figure 6. Comparison of growth characteristics of WJ-MSCs and SA-MSCs at third passage. (A) Growth curves. The MSCs were plated at an initial density of 5000 cells/well, and the absorption values were detected over 7 days. Each point on the growth curve represents absorption value mean n = 3. (B) Cumulative population doubling time (PDT, measured in hours) (n = 6).
Applsci 14 08036 g006
Applsci 14 08036 g007
Figure 7. Expression of pluripotency markers in WJ-MSCs and SA-MSCs. Confocal microscopic analysis of OCT4A, SOX2, NANOG, and SSEA-4. Scale bar = 100 μm.
Figure 7. Expression of pluripotency markers in WJ-MSCs and SA-MSCs. Confocal microscopic analysis of OCT4A, SOX2, NANOG, and SSEA-4. Scale bar = 100 μm.
Applsci 14 08036 g007
Applsci 14 08036 g008
Figure 8. Quantitative PCR results for expression of OCT4A, OCT4B, OCT4B1, NANOG, and SOX2 in WJ-MSCs and SA-MSCs at passage 3.
Figure 8. Quantitative PCR results for expression of OCT4A, OCT4B, OCT4B1, NANOG, and SOX2 in WJ-MSCs and SA-MSCs at passage 3.
Applsci 14 08036 g008
Table 1. Sequences of the oligonucleotide primers used for RT-PCR.
Table 1. Sequences of the oligonucleotide primers used for RT-PCR.
Gene NameForward Primer (5′ to 3′)Reverse Primer (5′ to 3′)Ta (°C)
oct4aAGTGAGAGGCAACCTGGAGAGTGAAGTGAGGGCTCCCATA60
oct4bTATGGGAGCCCTCACTTCACCAAAAACCCTGGCACAACT60
oct4b1AGACTATTCCTTGGGGCCACACGGCTGAATACCTTCCCAAATAGA63
sox2ACACCAATCCCATCCACACTGCAAACTTCCTGCAAAGCTC60
nanogGTCCCGGTCAAGAACAGAATGCGTCACACCATTGCTATT60
β-actinTGACGGGGTCACCCACACACTGTGCCCATCTACTAGAAGCATTTGCGGACGATGGAGGG62
Table 2. Comparison of the method that we applied to similar explant methods used for isolation of MSCs from UC.
Table 2. Comparison of the method that we applied to similar explant methods used for isolation of MSCs from UC.
AuthorOrigin of the ExplantSize of the ExplantsDiscarding of the Explants
(Days)		Initial Cell Number
Cells/cm (cm2)		Time for Reaching Confluence of 80–90% (Days)Population Doubling Time (on Average)/Passage Number
Our resultsWJ10 mm210 with transferring
of the explant
to new culture dish for another 10 days		5–6 × 104 cells/cm2 or 18 × 104 cells/cm16–18~29.2 (P3)
SA10 mm23–4 × 104 cells/cm2 or 12 × 104 cells/cm~31.9 (P3)
Hua et al., 2013 [29]WJ10 mm of UC
5 mm of UC
1 mm of UC		106.7 × 104 cells/cm
1.9 × 104 cells/cm
2.6 × 104 cells/cm		21
8–10
8–10		ND
Todtenhaupt et al., 2023 [41]WJ~1 cm2102.15 × 104 cells/cm210–12~ 26.6 h (P1)
Hendijani et al., 2014 [42] UC
WJ		1–3 mm2
1–3 mm2		NDND22~23 h (P6)
~24 h(P6)
Doan et al., 2014 [43]Amnion2–3 mm310–12ND21ND
Kita et al., 2010 [25]Amnion~1 inch long/2.5 cm of UCNDNDNDND
Semenova et al., 2021 [44]Amnion
WJ
Perivascular region		2–3 mm3
2–3 mm3
2–3 mm3		14ND14~35.25 h up to P12
~32.4 ± 3.6 up to P12
~27.8 ± 4.8 up to P12
He et al., 2014 [45]WJ1– 2 mm34–21NA14–21ND
Mori et al., 2015 [46]WJ1–2 mm39–12NA20.1 ± 4.4ND
Hassan et al., 2017 [47]UC5 cm214NDND38–95 h (P3)
Bharti et al., 2018 [48]WJ1 to 2 mm10–12ND18–22~49.30 h
Lee et al., 2020 [49]WJ1–2 mm
2–4 mm
10 mm		NDNA12~31.6 up to P3
~28.5 ± 1.6 h up to P3
~33.4 ± 1.2 h up to P3
Zheng et al., 2022 [32]WJ1–2 mm8NA8ND
Legend: WJ—Wharton’s jelly; SA—subamnion; UC—umbilical cord; ND—no data; NA—not applicable.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kestendjieva, S.; Chervenkov, M.; Oreshkova, T.; Mourdjeva, M.; Stoyanova, E. Mesenchymal Stromal/Stem Cells Isolated by Explant Culture Method from Wharton’s Jelly and Subamnion Possess Similar Biological Characteristics. Appl. Sci. 2024, 14, 8036. https://doi.org/10.3390/app14178036

AMA Style

Kestendjieva S, Chervenkov M, Oreshkova T, Mourdjeva M, Stoyanova E. Mesenchymal Stromal/Stem Cells Isolated by Explant Culture Method from Wharton’s Jelly and Subamnion Possess Similar Biological Characteristics. Applied Sciences. 2024; 14(17):8036. https://doi.org/10.3390/app14178036

Chicago/Turabian Style

Kestendjieva, Snejana, Mihail Chervenkov, Tsvetelina Oreshkova, Milena Mourdjeva, and Elena Stoyanova. 2024. "Mesenchymal Stromal/Stem Cells Isolated by Explant Culture Method from Wharton’s Jelly and Subamnion Possess Similar Biological Characteristics" Applied Sciences 14, no. 17: 8036. https://doi.org/10.3390/app14178036

APA Style

Kestendjieva, S., Chervenkov, M., Oreshkova, T., Mourdjeva, M., & Stoyanova, E. (2024). Mesenchymal Stromal/Stem Cells Isolated by Explant Culture Method from Wharton’s Jelly and Subamnion Possess Similar Biological Characteristics. Applied Sciences, 14(17), 8036. https://doi.org/10.3390/app14178036

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop