Ciprofloxacin and Imipenem Resistance in Bathing Waters—Preliminary Studies of Great Rudnickie Lake

Abstract

The phenomenon of bacterial resistance to antibiotics, the emission and spread of these bacteria, and the genes that determine antibiotic resistance in the environment are now a major health security concern. This is especially important for anthropopressed surface waters used for recreational purposes. A particular threat is the occurrence of bacteria resistant to frequently applied pharmaceuticals, especially those used to treat persistent and complicated bacterial infections. Hence, a preliminary study of the occurrence of bacteria and genes determining resistance to selected antibiotics, ciprofloxacin and imipenem, was conducted in the bathing waters of the Great Rudnickie Lake. The research showed that the resistance to ciprofloxacin was exhibited by 28% of the total mesophilic bacteria present in water, while the resistance to imipenem was detected in 3.6% of them. It was found that 17–40% of ciprofloxacin-resistant isolates contained the fluoroquinolone-resistance gene qnrS, while the β-lactam-resistance gene blaTEM was found in all the imipenem-resistant strains. The increase in the number of bacteria resistant to the tested antibiotics in the waters of the river outflowing from the lake was observed compared to the inflowing waters, suggesting the potential of the water reservoir as a site for the spreading of drug resistance against tested antibiotics.

1. Introduction

In recent years, there has been an unabated upward trend in the consumption of antibiotics. They are widely used not only in medicine but also in veterinary medicine, animal husbandry and aquaculture [1,2,3]. Antibiotic residues enter the environment both in metabolized and unchanged form [4,5]. They are detected in surface and groundwater, bottom sediments, and the soil environment [6,7,8]. Such micropollutants are often not effectively removed in the wastewater treatment process, which increases the likelihood of their release into the environment [6,9,10]. The effluents from the wastewater treatment plants contain up to 1 mg/L of antibiotics such as β-lactams, macrolides, fluoroquinolones, tetracyclines, sulfonamides and trimethoprim [11]. Antibiotics entering waterways negatively affect aquatic ecosystems. Experiments conducted in model aquatic systems have shown detrimental effects on the population of nitrifying bacteria [7]. Antibiotics such as amoxicillin, sarafloxacin, and tetracycline were harmful to the blue-green algae [12]. Levofloxacin and clarithromycin appeared strongly toxic to the microalgae. Metronidazole revealed a toxic effect on Chlorella sp. and Selenastrum capricornutum [13]. Numerous antibiotics, including sulfamethoxazole and levofloxacin, negatively affected communities of water macrophytes [14]. It has also been shown that clarithromycin can be harmful to freshwater invertebrates, impairing their behavior, reproduction, growth, and survival of early life stages [7]. There are also data supporting the ecotoxicity of antibiotics to fish and fish embryos [10].

One of the main effects of environmental pollution with antibiotics is the appearance and development of antibiotic-resistant bacteria [11,15]. The sources of this pollution can be diverse. A study carried out in Australia found that water bodies near sewage treatment plants were contaminated with antibiotic-resistant Escherichia coli. Pig farms have been identified as a source of surface water contamination with tetracycline-resistant enterococci. Resistance genes to sulfonamides, macrolides and trimethoprim have been detected in Japanese rivers [1]. Several antibiotics used as growth promoters (spiramycin, tylosin, carbadox, monensin, and virginiamycin) were suspected of being a cause of the cross-resistance to other pharmaceuticals [16]. The mechanisms related to microbial resistance to antibiotics include horizontal gene transfer, the modification of the binding target, the removal of antibiotics out of the cell (active efflux) and the enzymatic degradation and modification of antibiotics [17].

Water bodies used for recreational purposes require special care when it comes to ensuring health and safety. Routine sanitary testing of bathing water does not reflect the full spectrum of potential risks of a microbiological nature. The objects of interest when it comes to potential health risks associated with microbiological contamination of surface waters are usually fecal bacteria, mainly from the Enterobacteriaceae family (Salmonella spp., Shigella spp., Yersinia pestis, Klebsiella spp., and pathogenic strains of E. coli). Staphylococcus aureus bacteria have also been detected in the waters [18].

Surface water quality regulations do not address the presence of antibiotic-resistant bacteria and drug-resistance genes in the water [18]. In this context, the problem of contamination of recreational waters with antibiotic-resistant microorganisms seems particularly relevant. There is a need to pay special attention to the phenomenon of bacterial resistance to new-generation antibiotics, including those used to treat severe bacterial infections that are difficult to treat.

In this research, we focused on the occurrence of bacteria resistant to two frequently used antibiotics—ciprofloxacin and imipenem—in the bathing waters of the Great Rudnickie Lake, one of the popular recreational sites in Poland. The aim of the study was to find out if the phenomenon of antibiotic-resistant bacteria can also affect recreational reservoirs in Central Europe.

2. Materials and Methods

2.1. Characteristics of the Studied Object

Great Rudnickie Lake is located in Poland, in Kujawsko-Pomorskie Province, in the Vistula River basin, in a typically agricultural area, in the so-called Grudziądz Basin at a distance of about 3 km from Grudziądz, a city with approximately 100,000 people. The lake is a post-glacial reservoir, and due to its origin and morphology, it is counted among the so-called extrusion lakes. It has a flowing character—water is fed to the reservoir from its eastern side by the Marusha River, while it is discharged by the Rudniczanka River in the southeastern part of the lake. The lake basin is diversified with numerous peninsulas, and there is also an island with an area of 7000 m². The varied relief of the silty-sandy bottom of the basin is also characteristic.

The surface area of the lake (depending on the source of available data) is from 1,609,000 m² to 1,887,000 m², while the maximum depth is 11.5–11.9 m (average depth—4.4 m). The water mirror is at 22.6 m above sea level. The total volume of water in the lake is about 6.7 million m³. The total catchment area of the reservoir is 129.2 km². The temperature of the lake’s water is typical for surface waters located at this latitude, which is at a level of 10–23 °C. According to available data, the pH of the water ranges from 7.55 to 8.48.

The shores of the lake provide habitat for numerous species of water and wading birds, including swans, great crested grebe, gray heron, wild ducks, and geese. The ichthyofauna of the lake is varied and, in addition to native species such as pike, perch, bream, and roach, includes species introduced as part of the stocking—carp, pike-perch, and amur.

For many years, the lake was subject to intensive anthropopression [19], among other things, due to pollution of its waters by municipal sewage entering the lake seasonally in an uncontrolled manner from holiday plots and resorts located in the vicinity, as well as due to the reach of pollutants present in surface runoff from the agriculturally used part of the lake’s direct catchment area. Until 2003, the waters of the Marusha River flowing into Great Rudnickie Lake were discharged by sugar industry effluents, which further influenced the poor condition of the lake and its progressive degradation. Episodes of ecological disasters were also recorded in the 1970s and 1980s.

In 1980, a process of lake reclamation was carried out, involving laying a drain at the bottom of the lake, discharging bottom waters from the depths directly into the waters flowing out of the lake. In addition, the lake waters were subjected to intensive aeration. Since 2001, the water supply and sewerage system has been expanded in the areas adjacent to the lake in order to reduce the uncontrolled flow of municipal pollutants into its waters.

A hotel, a number of sailing centers, and campgrounds are located in the immediate vicinity of the lake. In addition, there are numerous catering outlets, sports and tourism equipment rentals and rowing marinas. The lake has public beaches, including three seasonally guarded bathing beaches. Adjacent to the reservoir, on three of its sides, are pine and spruce forest complexes with marked hiking trails. Due to its attractive location and favorable transportation infrastructure, the reservoir is intensively used for recreational purposes by both local residents and numerous tourists.

2.2. Water Sampling and the Microbiological Water Assessment

Water samples for testing were collected within the summer season at four different locations, namely:

• River waters flowing into the lake (the Marusha River directly before entering the lake);
• A bathing area on the northern shore of the lake;
• A bathing area on the east side of the lake;
• Waters flowing out of the lake as the river (the Rudniczanka River directly after leaving the lake).

The sampling season was selected due to the highest number of people using the bathing areas at the time to better reflect the potential health risks associated with the possible presence and transmission of antibiotic-resistant bacteria.

Water samples were taken into 250 cm³ sterile containers, submerging the container 20 cm below the water surface at the time of collection. The samples were transported to the laboratory within 24 h in cooling conditions and subjected to microbiological tests. Microbiological water assessment covered the quantitative analysis of the total number of mesophilic bacteria (bacteria capable of growing in a temperature close to the temperature of the human’s body), taking into account the number of bacteria resistant to selected antibiotics: ciprofloxacin and imipenem. The bacteria were cultivated on nutrient agar medium (Biocorp Ltd., Warsaw, Poland) to determine the total bacterial count and on nutrient agar with the addition of 16 mg/L of imipenem or 8 mg/L of ciprofloxacin (Lab Empire S.C., Rzeszów, Poland). The concentrations of antibiotics in the cultivation medium were determined to be significantly higher than the MIC values reported by EUCAST (2021) to ensure that only antibiotic-resistant strains would be able to grow. To determine the total number of mesophilic bacteria, 0.1 cm³ of the tested water was spread on the surface of nutrient agar medium in Petri dishes and incubated at 37 °C for 48. After this time, all colonies capable of growing at 37 °C were counted and presented as colony forming units (CFU) counts in 1 cm³ of the tested water. The resulting value was taken as the total number of mesophilic bacteria in the tested water. An analogous procedure was used to test bacteria resistant to the antibiotics tested. Samples of the water were spread on nutrient agar with ciprofloxacin and nutrient agar with imipenem, respectively, and the subsequent incubation of bacteria for 48 h at 37 °C was applied. The counts of resistant bacteria were reported as the number of CFU in 1 cm³ of water. The spread plate method was applied in triplicates. For the quantitative analysis, the average values and standard deviations were calculated. The percentages of imipenem-resistant and ciprofloxacin-resistant bacteria in mesophilic bacteria were determined based on the average CFU counts.

2.3. Molecular Gene Analysis

To study the occurrence of genes responsible for the resistance to the selected antibiotics, 42 pure strains of antibiotic-resistant bacteria were obtained by the multiple passage technique using the streak plate method.

They were purified on cultivation media with antibiotics, with the incubation conditions mentioned above. The obtained microbial isolates were used as a source of DNA for further analyses.

DNA was extracted using the EXTRACTME DNA BACTERIA KIT (DNAGdańsk, Gdańsk, Poland) and applied for PCR. In order to effectively extract the nucleic acid from the bacterial cells, microorganisms from individual isolates were first suspended in 300 μL of BacL Buffer reagent. Solutions of RNase A and proteinase K in the respective buffers (RNase Buffer and Proteinase Buffer) were prepared. An amount of 4 μL of RNase A solution was added to the above-mentioned suspension of bacteria in BacL Buffer, mixed, and incubated for 10 min at 37 °C. In the next step, 10 μL of Proteinase K solution was added to the sample, mixed and then incubated for another 10 min at 55 °C. Then, 350 μL of BacB Buffer reagent was added to the mixture and incubated for 5 min at 55 °C. After incubation, the sample was subjected to intense shaking for 15 s and centrifuged for 2 min at 10–12,000 rpm. The obtained supernatant was transferred to a deposit mini-column placed in a collection tube and once again centrifuged for 1 min at 10–12,000 rpm. The mini-column was placed in a new collection tube, washed with 600 μL of BacW Buffer and centrifuged for 30 s at 10–12,000 rpm. The washing was repeated using 400 μL of BacW Buffer reagent. In order to dry, the minicolumn was centrifuged for 2 min at 12–14,000 rpm, and then it was placed in a sterile Eppendorf tube. Next, 80 μL of Elution Buffer reagent heated to 70 °C was poured into the tube, which was then incubated for 2 min at ambient temperature. After this time, the tube was centrifuged for 1 min at 10–12,000 rpm. The isolated DNA obtained in minicolumn was stored at −20 °C.

Amplification of isolated bacterial DNA was accomplished using a dedicated PCR reagent kit: REDTaq^® ReadyMix™ PCR Reaction Mix (Sigma-Aldrich, St. Louis, MO, USA). Product sizes were compared to DNA size markers (FastRuler Middle-Range DNA Ladder (Thermo Fisher Scientific Inc., Waltham, MA, USA)). The primers for PCR reaction were supplied by Syngen Biotech Ltd. (Wrocław, Poland).

The sequences of oligonucleotides applied as the primers for PCR reactions for individual genes are presented in

Table 1. Oligonucleotides used as primers for PCR reactions.

Gene	Type of the Primer	Sequence	Size (bp)	References
qnrS	forward	GCAAGTTCATTGAACAGGGT	428	[20]
	reverse	TCTAAACCGTCGAGTTCGGCG
blaTEM	forward	TCGCCGCATACACTATTCTCAGAATGAC	422
	reverse	CAGCAATAAACCAGCCAGCCGGAAG		[21]

.

The PCR reaction was carried out in the following steps: initial denaturation at 95 °C for 3 min, 35 denaturation cycles (95 °C for 30 s each), connection of primers (in temperature depending on the primer, 30–60 s), extension (72 °C for 60 s), and the final extension (72 °C for 10 min). The amplification products were applied to an agarose gel immersed in Tris-Acetate-EDTA Buffer (pH 8.2–8.4) (Sigma Aldrich, St. Louis, MO, USA), along with the DNA size marker The concentration of agarose was chosen according to the size of the expected DNA product. The separation of the products by electrophoresis was carried out at 100–110 V for about 40–60 min. After electrophoresis, the gels were then immersed in ethidium bromide solution for staining. The UV light was used for the visualization of the obtained PCR products.

3. Results and Discussion

The Great Rudnickie Lake is a very popular recreational destination for both local residents and tourists staying in the area. However, at the same time, as mentioned above, when characterizing the site, a body of water is subject to strong anthropopression and associated exposure to pollution from various sources. Therefore, the results obtained in the present study are not surprising, indicating a relatively high content in the water of bacteria capable of growing at human body temperature, among which, unfortunately, the presence of potentially pathogenic microorganisms cannot be excluded.

The quantitative analysis of water samples for mesophilic bacteria showed that the number of these bacteria in the samples was 5.7 ± 0.9·10³ CFU/cm³, with the average value ranging from 4.5·10³ CFU/cm³ (bathing area—east) to 6.7·10³ CFU/cm³ (bathing area— north). The highest concentrations of mesophilic bacteria were detected in the bathing area in the northern part of the lake, located near numerous tourist facilities, which can be a source of pollution of a municipal nature, including sewage, and thus a source of bacteria of human origin. However, the research results did not confirm previous observations of other authors regarding the increase in the number of mesophilic bacteria in the areas of the lake adjacent to the outflow of its waters into the river. Elevated levels of mesophilic bacteria have previously been recorded by Berleć et al. [22] at the outflow from Great Rudnickie Lake. The lake’s waters were also found to be significantly contaminated with coliform bacteria and, occasionally, fecal streptococci. In this research, it was noticed that the concentration of bacteria in waters outflowing from the lake into Rudniczanka River was comparable to their numbers in river waters flowing into the lake (average concentrations of mesophilic bacteria: 5.3·10³ CFU/cm³ and 5.8·10³ CFU/cm³, respectively).

The choice of antibiotics against which bacterial resistance was tested in this study was dictated by both their belonging to pharmaceuticals used in difficult-to-treat infections and the possibility of their presence in sewage and surface runoff, which are potential pollutant sources of surface waters.

For the study, two commonly used antibiotics—ciprofloxacin and imipenem were selected. Ciprofloxacin belongs to the group of antibiotics known as second-generation fluoroquinolones and is a pharmaceutical used to treat infections caused by gram-positive bacteria (S. aureus, Streptococcus pneumoniae) as well as gram-negative bacteria (Pseudomonas aeruginosa, Moraxella catarrhalis, Haemophilus spp. Neisseria spp., bacteria of the Enterobacteriaceae family, also an atypical bacteria such as Legionella pneumophila, Ureaplasma urealyticum, Mycobacterium spp. and others). As anti-infective drugs, ciprofloxacin medicinal preparations are used for infections of the genitourinary tract, respiratory tract (especially for patients with cystic fibrosis or tuberculosis), skin, soft tissues, and bones, in cases of gastrointestinal infections (including peritonitis, chloramphenicol-resistant typhoid fever and systemic salmonellosis). Ciprofloxacin is also sometimes used to treat opportunistic infections in immunocompromised patients and patients on immunosuppressive therapy, as well as in cases of sepsis [23]. Ciprofloxacin can occur in treated, discharged wastewater from hospitals [24]. Some ciprofloxacin-resistant E. coli strains were also isolated from the wastewater [16]. In ciprofloxacin-containing wastewater, the co-occurrence of ESBL-producing Enterobacter spp., Citrobacter spp., Klebsiella spp. and multi-resistant P. aeruginosa strains was observed [25]. The fluoroquinolone-resistant bacteria may also originate from swine manure used as fertilizer. They can move through the soil environment or enter water bodies with surface runoff [26]. This is a very important factor for water bodies located in agricultural areas.

Imipenem belongs to carbapenems, a group within β-lactam antibiotics. It is a derivative of the natural antibiotic thienamycin produced by the bacteria Streptomyces cattleya. It is applied in the treatment of bacterial bloodstream infections, complicated infections in the genitourinary tract, abdominal cavity, skin and soft tissue infections, lung infections and pneumonia [27]. β-lactams occur as contaminants in industrial wastewater, and they undergo only 20–30% removal in wastewater treatment processes [28], while they are among the most widely used bactericides [29].

In the case of this research, an important criterion for selecting these antibiotics was the fact that they are used to combat infections of parts of the human body exposed to potential contact with microorganisms that may be present in the water (skin, mucous membranes, and respiratory and digestive tracts). On the other hand, these antibiotics and the antibiotic-resistant bacteria related to them can be found in surface runoff from nearby agricultural areas and municipal wastewater from tourist facilities.

Drug-resistant microorganisms are increasingly common in the environment [30,31,32]. Therefore, recognizing potential environmental reservoirs of antibiotic-resistant bacteria is becoming increasingly important [18]. Antibiotic-resistant bacteria present in surface waters may serve as a source of resistance genes for potentially pathogenic strains [1]. Due to the possibility of horizontal gene transfer, the spread of antibiotic resistance is possible even between different bacterial species [33]. The pressure of the pharmaceutical contaminants can intensify the process [34], although the presence of antibiotic-resistant bacteria and the genes responsible for the resistance may not correspond directly with the concentrations of antibiotics in water [35]. On the other hand, the increase in the number of antibiotic-resistant strains may correlate with water contamination with biocides [35] and heavy metals [1].

The problem is particularly important in the case of natural water bodies used for recreational purposes [18,36,37,38], such as the water reservoir under study. It should be noted that the phenomenon of resistant microorganisms can also be observed in environments that are not subject to direct selective pressure caused by the presence of antibiotics and/or their metabolites [18].

The results of studies conducted in different parts of the world confirm both the possibility of antibiotic-resistant bacteria in recreational waters and the coincidence of the characteristics of these bacteria with the gastrointestinal microflora of water users. Thapaliya et al. [39] detected multi-resistant strains of S. aureus at freshwater beaches in Ohio. A convergence was also noted between β-lactams-resistant E. coli isolated from recreational waters and bacteria from the gastrointestinal tract of people using these water bodies for bathing [18]. A study conducted in the United Kingdom by Leonard et al. [37] found an increased incidence of antibiotic-resistant strains of E. coli in the digestive tracts of surfers who regularly use coastal waters. Numerous detected E. coli strains contained the blaCTX-M gene found in bacteria capable of producing ESBLs and with increased resistance to fluoroquinolone antibiotics, aminoglycosides and tetracyclines. In addition, Søraas et al. [40], in a study in Eastern Norway, observed that freshwater swimming might be a risk factor associated with gastrointestinal colonization by bacterial strains belonging to the Enterobacteriaceae family and being carriers of genes conditioning their production of extended-spectrum β-lactamases. The possibility of exposure to antibiotic resistance factors (bacteria, genes conditioning drug resistance) via recreationally used waters was also confirmed by the study of O’Flaherty et al. [41] conducted on two rivers and recreational beaches located in central Italy. The results of the study on Great Rudnickie Lake allow us to expand our knowledge in this area when it comes to recreational waters in Central Europe.

It should also be pointed out that bathing water users can be a source of resistant microflora, which can then spread via water to other users of the water reservoir. The higher the concentration of this antibiotic-resistant bacteria, the greater the likelihood that this particular bacteria will be transmitted. As for local residents, the use of the reservoir water to irrigate nearby fields may also become a source of the spread of antibiotic resistance in proportion to the scale of occurrence of these factors in the water.

Our study revealed that mesophilic bacteria resistant to ciprofloxacin and imipenem were present in the samples collected at all sampling points, including those taken directly from the bathing areas heavily frequented by tourists. The average number of ciprofloxacin-resistant bacteria ranged from 201 to 1490 CFU/cm³ (584 ± 453 CFU/cm³ for all the samples), and it was quite similar in the waters flowing into the lake and in samples collected from the bathing area located on the east side of the Great Rudnickie Lake.

The ciprofloxacin-resistant bacteria in inflowing Marusha river waters and water samples from bathing areas accounted for from 3% to 7.3% of the total number of mesophilic bacteria. What was surprising, however, was that the percentage of these bacteria was four times higher in the waters flowing out of the lake, reaching 28% of the total bacterial count. The number of imipenem-resistant bacteria was at the level of 89–190 CFU/cm³, with an average value of 145 ± 44 CFU/cm³ of tested water. Similarly to the ciprofloxacin-resistant bacteria, the highest number and percentage of imipenem-resistant bacteria was detected in waters flowing out of the lake, reaching 3.6% of the total number of mesophilic bacteria, which was almost twice as high as in waters flowing into the lake. The average percentage of imipenem-resistant bacteria in bathing areas was also lower compared to the waters inflowing to the Rudniczanka River (Figure 1).

Of the 42 pure bacterial isolates obtained, 25 were resistant to ciprofloxacin but sensitive to imipenem; six showed resistance to imipenem but sensitivity to ciprofloxacin, while 11 strains were resistant to both antibiotics tested.

Analysis of genes determining mechanisms of antibiotic resistance is a useful tool in the study of this phenomenon. In this research, two antibiotic-resistance genes were considered: blaTEM and qnrS. The blaTEM gene encodes TEM-1 β-lactamase typical for Enterobacteriaceae [42]. β-lactamases are originally encoded by the genes located on bacterial nucleoid, although they can also be found on plasmids and mobile elements like transposons and integrons [42,43]. The TEM enzymes are the representatives of fast-evolving extended spectrum β-lactamases [44]. The qnrS gene is one of the genes responsible for the resistance against fluoroquinolone antibiotics (including ciprofloxacin). The gene has been primarily found in Enterobacteriaceae. It was revealed that it can be spread by IncU-type plasmids [45,46].

The analysis of the occurrence of blaTEM and qnrS in 42 antibiotic-resistant isolates from the Great Rudnickie Lake revealed the presence of the blaTEM gene in 100% of imipenem-resistant strains (Figure 2), while the qnrS was present only in 17–40% of ciprofloxacin-resistant bacteria which suggests that different determinants of antibiotic resistance should be seen in the case of ciprofloxacin. The presence of genes that usually co-occur with mobile genetic elements may explain the prevalence of certain antibiotic-resistance mechanisms and implies the possibility of spreading antibiotic-resistance in studied recreational areas and its transfer into the other microorganisms, including potentially pathogenic microflora.

The frequency of occurrence of the qnrS gene in the individual samples at the same location did not differ significantly. The average frequency of the gene was higher in mesophilic bacteria isolated from water samples taken at the bathing site located on the northern shore of the lake compared to the bathing site on the eastern shore (Figure 3). This suggests that the elevated presence of this gene was unlikely to be related to the inflow of river water feeding the lake from the east.

At present, we do not yet have complete data to provide a meaningful estimate of the magnitude of the threat posed by antibiotic resistance agents in recreationally used water bodies. The quantitative studies conducted use both culture-based methods and molecular techniques. In the case of molecular techniques, an important consideration is the proper selection of target genes. As reported by Nappier et al. [18], such genes could be, for example, intI, mcr-1, sul1, tetW, blaTEM, qnrA, and a number of others. The results obtained in this study confirm the suitability of the application of blaTEM and qnr genes as indicators of recreational water contamination with resistance factors.

The results of this study conducted on the Great Rudnickie Lake showed that recreational waters in Central Europe may be a site for the occurrence and the spread of bacteria showing resistance to frequently used antibiotics, and thus help to signal another serious problem related to the phenomenon of drug resistance. Commonly isolated resistance genes have been detected in antibiotic-resistant strains, which may suggest that bacteria present in the bathing area have a predisposition to both fluoroquinolone and β-lactam antibiotics.

It can also be mentioned that parallel studies of our own (not yet published) on the occurrence of bacteria in one of the wastewater treatment plants located in the area in question showed that there were significant amounts of antibiotic-resistant bacteria in the treated wastewater discharged into the environment. Their abundance for some antibiotics, including β-lactam antibiotics, reached as high as 10³ CFU/cm³, while resistance was related to such pharmaceuticals as amoxicillin, rifampicin, vancomycin, and nitrofurantoin, among others. In this context, the fact that treated wastewater from one of the nearby treatment plants is discharged into the river that feeds with its waters into the studied water body cannot be overlooked. Thus, it can be suggested that the occurrence of antibiotic-resistant microorganisms in the waters of Great Rudnickie Lake may be part of a broader phenomenon resulting from the possibility of the spread of bacteria due to the overlap of their various sources, including municipal and agricultural.

4. Conclusions

The pilot study carried out in Great Rudnickie Lake revealed that bacteria resistant to commonly used antibiotics can be present in comparatively high numbers in waters used for bathing purposes. It was stated that water in the lake contained a noticeable concentration of bacteria resistant to antibiotics like ciprofloxacin and imipenem. Moreover, it can be suggested that the bathing areas of Great Rudnickie Lake can be a reservoir of these resistant bacteria—the percentage of ciprofloxacin-resistant bacteria in water flowing out of the lake was even higher compared with their concentration in bathing waters and reached 28% of the total bacterial number.