β-lactolin, a Monoamine Oxidase B Inhibitory Lactopeptide, Suppresses Reactive Oxygen Species Production in Lipopolysaccharide-Stimulated Astrocytes
Abstract
Featured Application
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Treatment
2.2. ROS Analysis
2.3. MAO Activity Assay
2.4. Monoamine Analysis
2.5. RT-qPCR Analysis
2.6. COMT Activity Assay
2.7. Statistical Analysis
3. Results
3.1. Effects of β-Lactolin on ROS Production in Astrocytes
3.2. Effect of β-Lactolin on MAO-B in Astrocytes
3.3. Effects of β-Lactolin-Induced MAO-B Inhibition on DA Metabolism in Astrocytes
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sidoryk-Wegrzynowicz, M.; Wegrzynowicz, M.; Lee, E.; Bowman, A.B.; Aschner, M. Role of Astrocytes in Brain Function and Disease. Toxicol. Pathol. 2010, 39, 115–123. [Google Scholar] [CrossRef] [PubMed]
- Tabata, H. Diverse subtypes of astrocytes and their development during corticogenesis. Front. Neurosci. 2015, 9, 114. [Google Scholar] [CrossRef] [PubMed]
- Ota, Y.; Zanetti, A.T.; Hallock, R.M. The Role of Astrocytes in the Regulation of Synaptic Plasticity and Memory Formation. Neural. Plast. 2013, 2013, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Liddelow, S.A.; Barres, B.A. Reactive Astrocytes: Production, Function, and Therapeutic Potential. Immunity 2017, 46, 957–967. [Google Scholar] [CrossRef]
- Dossi, E.; Vasile, F.; Rouach, N. Human astrocytes in the diseased brain. Brain Res. Bull. 2018, 136, 139–156. [Google Scholar] [CrossRef]
- Liddelow, S.A.; Guttenplan, K.A.; Clarke, L.E.; Bennett, F.C.; Bohlen, C.J.; Schirmer, L.; Bennett, M.L.; Münch, A.E.; Chung, W.-S.; Peterson, T.C.; et al. Neurotoxic reactive astrocytes are induced by activated microglia. Nature 2017, 541, 481–487. [Google Scholar] [CrossRef]
- Poewe, W.; Seppi, K.; Tanner, C.M.; Halliday, G.M.; Brundin, P.; Volkmann, J.; Schrag, A.E.; Lang, A.E. Parkinson disease. Nat. Rev. Dis. Prim. 2017, 3, 1–21. [Google Scholar] [CrossRef]
- Epuig, M.V.; Erose, J.; Eschmidt, R.; Efreund, N. Dopamine modulation of learning and memory in the prefrontal cortex: Insights from studies in primates, rodents, and birds. Front. Neural Circuits 2014, 8, 93. [Google Scholar] [CrossRef]
- Arnsten, A.F.; Li, B.-M. Neurobiology of Executive Functions: Catecholamine Influences on Prefrontal Cortical Functions. Biol. Psychiatry 2005, 57, 1377–1384. [Google Scholar] [CrossRef]
- Morgan, R.G.; Gibbs, J.T.; Melief, E.J.; Postupna, N.O.; Sherfield, E.E.; Wilson, A.; Keene, C.D.; Montine, T.J.; Palmiter, R.D.; Darvas, M. Relative contributions of severe dopaminergic neuron ablation and dopamine depletion to cognitive impairment. Exp. Neurol. 2015, 271, 205–214. [Google Scholar] [CrossRef]
- Nobili, A.; Latagliata, E.C.; Viscomi, M.T.; Cavallucci, V.; Cutuli, D.; Giacovazzo, G.; Krashia, P.; Rizzo, F.R.; Marino, R.; Federici, M.; et al. Dopamine neuronal loss contributes to memory and reward dysfunction in a model of Alzheimer’s disease. Nat. Commun. 2017, 8, 1–14. [Google Scholar] [CrossRef]
- Hansson, E.; Sellström, Å. MAO COMT, and GABA-T Activities in Primary Astroglial Cultures. J. Neurochem. 1983, 40, 220–225. [Google Scholar] [CrossRef]
- Levitt, P.; Pintar, J.E.; Breakefield, X.O. Immunocytochemical demonstration of monoamine oxidase B in brain astrocytes and serotonergic neurons. Proc. Natl. Acad. Sci. USA 1982, 79, 6385–6389. [Google Scholar] [CrossRef]
- Borroni, E.; Bohrmann, B.; Grueninger, F.; Prinssen, E.; Nave, S.; Loetscher, H.; Chinta, S.J.; Rajagopalan, S.; Rane, A.; Siddiqui, A.; et al. Sembragiline: A Novel, Selective Monoamine Oxidase Type B Inhibitor for the Treatment of Alzheimer’s Disease. J. Pharmacol. Exp. Ther. 2017, 362, 413–423. [Google Scholar] [CrossRef]
- Wang, Y.; Sun, Y.; Guo, Y.; Wang, Z.; Huang, L.; Li, X. Dual functional cholinesterase and MAO inhibitors for the treatment of Alzheimer’s disease: Synthesis, pharmacological analysis and molecular modeling of homoisoflavonoid derivatives. J. Enzym. Inhib. Med. Chem. 2015, 31, 1–9. [Google Scholar] [CrossRef]
- Vindis, C.; Séguélas, M.-H.; Lanier, S.; Parini, A.; Cambon, C. Dopamine induces ERK activation in renal epithelial cells through H2O2 produced by monoamine oxidase. Kidney Int. 2001, 59, 76–86. [Google Scholar] [CrossRef]
- Cohen, G.; Farooqui, R.; Kesler, N. Parkinson disease: A new link between monoamine oxidase and mitochondrial electron flow. Proc. Natl. Acad. Sci. USA 1997, 94, 4890–4894. [Google Scholar] [CrossRef]
- Pizzinat, N.; Copin, N.; Vindis, C.; Parini, A.; Cambon, C. Reactive oxygen species production by monoamine oxidases in intact cells. Naunyn-Schmiedeberg’s Arch. Pharmacol. 1999, 359, 428–431. [Google Scholar] [CrossRef]
- Mallajosyula, J.K.; Kaur, D.; Chinta, S.J.; Rajagopalan, S.; Rane, A.; Nicholls, D.G.; Di Monte, D.A.; MacArthur, H.; Andersen, J.K. MAO-B Elevation in Mouse Brain Astrocytes Results in Parkinson’s Pathology. PLoS ONE 2008, 3, e1616. [Google Scholar] [CrossRef]
- Ano, Y.; Ayabe, T.; Kutsukake, T.; Ohya, R.; Takaichi, Y.; Uchida, S.; Yamada, K.; Uchida, K.; Takashima, A.; Nakayama, H. Novel lactopeptides in fermented dairy products improve memory function and cognitive decline. Neurobiol. Aging 2018, 72, 23–31. [Google Scholar] [CrossRef]
- Ayabe, T.; Ano, Y.; Ohya, R.; Kitaoka, S.; Furuyashiki, T. The Lacto-Tetrapeptide Gly–Thr–Trp–Tyr, β-Lactolin, Improves Spatial Memory Functions via Dopamine Release and D1 Receptor Activation in the Hippocampus. Nutrition 2019, 11, 2469. [Google Scholar] [CrossRef]
- Ano, Y.; Ozawa, M.; Kutsukake, T.; Sugiyama, S.; Uchida, K.; Yoshida, A.; Nakayama, H. Preventive Effects of a Fermented Dairy Product against Alzheimer’s Disease and Identification of a Novel Oleamide with Enhanced Microglial Phagocytosis and Anti-Inflammatory Activity. PLoS ONE 2015, 10, e0118512. [Google Scholar] [CrossRef]
- Kita, M.; Obara, K.; Kondo, S.; Umeda, S.; Ano, Y. Effect of Supplementation of a Whey Peptide Rich in Tryptophan-Tyrosine-Related Peptides on Cognitive Performance in Healthy Adults: A Randomized, Double-Blind, Placebo-Controlled Study. Nutrition 2018, 10, 899. [Google Scholar] [CrossRef]
- Kita, M.; Kobayashi, K.; Obara, K.; Koikeda, T.; Umeda, S.; Ano, Y. Supplementation with Whey Peptide Rich in β-Lactolin Improves Cognitive Performance in Healthy Older Adults: A Randomized, Double-Blind, Placebo-Controlled Study. Front. Neurosci. 2019, 13, 399. [Google Scholar] [CrossRef]
- Jang, E.; Kim, J.-H.; Lee, S.; Kim, J.-H.; Seo, J.-W.; Jin, M.; Lee, M.-G.; Jang, I.-S.; Lee, W.-H.; Suk, K. Phenotypic Polarization of Activated Astrocytes: The Critical Role of Lipocalin-2 in the Classical Inflammatory Activation of Astrocytes. J. Immunol. 2013, 191, 5204–5219. [Google Scholar] [CrossRef]
- Asanuma, M.; Miyazaki, I.; Murakami, S.; Diaz-Corrales, F.J.; Ogawa, N. Striatal Astrocytes Act as a Reservoir for L-DOPA. PLoS ONE 2014, 9, e106362. [Google Scholar] [CrossRef]
- Landis-Piwowar, K.; Chen, D.; Chan, T.H.; Dou, Q.P. Inhibition of catechol-O-methyltransferase activity in human breast cancer cells enhances the biological effect of the green tea polyphenol (-)-EGCG. Oncol. Rep. 2010, 24, 563–569. [Google Scholar] [CrossRef]
- Kurkela, M.; Siiskonen, A.; Finel, M.; Tammela, P.; Taskinen, J.; Vuorela, P. Microplate screening assay to identify inhibitors of human catechol-O-methyltransferase. Anal. Biochem. 2004, 331, 198–200. [Google Scholar] [CrossRef]
- Tarassishin, L.; Suh, H.-S.; Lee, S.C. LPS and IL-1 differentially activate mouse and human astrocytes: Role of CD14. Glia 2014, 62, 999–1013. [Google Scholar] [CrossRef]
- Rizor, A.; Pajarillo, E.; Johnson, J.; Aschner, M.; Lee, E. Astrocytic Oxidative/Nitrosative Stress Contributes to Parkinson’s Disease Pathogenesis: The Dual Role of Reactive Astrocytes. Antioxidants 2019, 8, 265. [Google Scholar] [CrossRef] [PubMed]
- González-Reyes, R.E.; Nava-Mesa, M.O.; Vargas-Sánchez, K.; Ariza-Salamanca, D.; Mora-Muñoz, L. Involvement of Astrocytes in Alzheimer’s Disease from a Neuroinflammatory and Oxidative Stress Perspective. Front. Mol. Neurosci. 2017, 10, 427. [Google Scholar] [CrossRef] [PubMed]
- Hsieh, H.-L.; Yang, C.-M. Role of Redox Signaling in Neuroinflammation and Neurodegenerative Diseases. BioMed. Res. Int. 2013, 2013, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Halliwell, B. Reactive Oxygen Species and the Central Nervous System. J. Neurochem. 1992, 59, 1609–1623. [Google Scholar] [CrossRef] [PubMed]
- Okuyama, S.; Kanzaki, T.; Kotani, Y.; Katoh, M.; Sawamoto, A.; Nakajima, M.; Furukawa, Y. Continual Treatment with the Peels of Citrus kawachiensis (Kawachi Bankan) Protects against Dopaminergic Neuronal Cell Death in a Lipopolysaccharide-Induced Model of Parkinson’s Disease. J. Nutr. Sci. Vitaminol. 2019, 65, 205–208. [Google Scholar] [CrossRef]
- Park, W.H.; Kang, S.; Piao, Y.; Pak, C.J.; Oh, M.S.; Kim, J.; Kang, M.S.; Pak, Y.K. Ethanol extract of Bupleurum falcatum and saikosaponins inhibit neuroinflammation via inhibition of NF-κB. J. Ethnopharmacol. 2015, 174, 37–44. [Google Scholar] [CrossRef]
- Lee, Y.J.; Choi, I.S.; Park, M.H.; Lee, Y.M.; Song, J.K.; Kim, Y.H.; Kim, K.H.; Hwang, D.Y.; Jeong, J.H.; Yun, Y.P.; et al. 4-O-Methylhonokiol attenuates memory impairment in presenilin 2 mutant mice through reduction of oxidative damage and inactivation of astrocytes and the ERK pathway. Free Radic. Biol. Med. 2011, 50, 66–77. [Google Scholar] [CrossRef]
- McNaught, K.S.P.; Jenner, P. Altered Glial Function Causes Neuronal Death and Increases Neuronal Susceptibility to 1-Methyl-4-Phenylpyridinium- and 6-Hydroxydopamine-Induced Toxicity in Astrocytic/Ventral Mesencephalic Co-Cultures. J. Neurochem. 2002, 73, 2469–2476. [Google Scholar] [CrossRef]
- Lin, M.-S.; Sun, Y.-Y.; Chiu, W.-T.; Hung, C.-C.; Chang, C.-Y.; Shie, F.-S.; Tsai, S.-H.; Lin, J.-W.; Hung, K.-S.; Lee, Y.-H. Curcumin Attenuates the Expression and Secretion of RANTES after Spinal Cord Injury In Vivo and Lipopolysaccharide-Induced Astrocyte Reactivation In Vitro. J. Neurotrauma 2011, 28, 1259–1269. [Google Scholar] [CrossRef]
- Ano, Y.; Ayabe, T.; Ohya, R.; Kondo, K.; Kitaoka, S.; Furuyashiki, T. Tryptophan-Tyrosine Dipeptide, the Core Sequence of β-Lactolin, Improves Memory by Modulating the Dopamine System. Nutrition 2019, 11, 348. [Google Scholar] [CrossRef]
- Mazzio, E.; Harris, N.; Soliman, K. Food Constituents Attenuate Monoamine Oxidase Activity and Peroxide Levels in C6 Astrocyte Cells. Planta Med. 1998, 64, 603–606. [Google Scholar] [CrossRef]
- Lim, D.W.; Han, T.; Jung, J.; Song, Y.; Um, M.Y.; Yoon, M.; Kim, Y.T.; Cho, S.; Kim, I.-H.; Han, D.; et al. Chlorogenic Acid from Hawthorn Berry (Crataegus pinnatifida Fruit) Prevents Stress Hormone-Induced Depressive Behavior, through Monoamine Oxidase B-Reactive Oxygen Species Signaling in Hippocampal Astrocytes of Mice. Mol. Nutr. Food Res. 2018, 62, e1800029. [Google Scholar] [CrossRef]
- Lim, D.W.; Park, J.; Jung, J.; Kim, S.-H.; Um, M.Y.; Yoon, M.; Kim, Y.T.; Han, D.; Lee, C.; Lee, J. Dicaffeoylquinic acids alleviate memory loss via reduction of oxidative stress in stress-hormone-induced depressive mice. Pharmacol. Res. 2020, 161, 105252. [Google Scholar] [CrossRef]
- Hernández-Ledesma, B.; Amigo, L.; Recio, A.I.; Bartolomé, B. ACE-Inhibitory and Radical-Scavenging Activity of Peptides Derived from β-Lactoglobulin f(19−25). Interactions with Ascorbic Acid. J. Agric. Food Chem. 2007, 55, 3392–3397. [Google Scholar] [CrossRef]
- Zhang, Q.-X.; Wu, H.; Ling, Y.-F.; Lu, R.-R. Isolation and identification of antioxidant peptides derived from whey protein enzymatic hydrolysate by consecutive chromatography and Q-TOF MS. J. Dairy Res. 2013, 80, 367–373. [Google Scholar] [CrossRef]
- Jo, S.; Yarishkin, O.; Hwang, Y.J.; Chun, Y.E.; Park, M.; Woo, D.H.; Bae, J.Y.; Kim, T.; Lee, J.; Chun, H.; et al. GABA from reactive astrocytes impairs memory in mouse models of Alzheimer’s disease. Nat. Med. 2014, 20, 886–896. [Google Scholar] [CrossRef]
- Park, J.-H.; Ju, Y.H.; Choi, J.W.; Song, H.J.; Jang, B.K.; Woo, J.; Chun, H.; Kim, H.J.; Shin, S.J.; Yarishkin, O.; et al. Newly developed reversible MAO-B inhibitor circumvents the shortcomings of irreversible inhibitors in Alzheimer’s disease. Sci. Adv. 2019, 5, eaav0316. [Google Scholar] [CrossRef]
- Yasuhisa, A.; Rena, O.; Keiji, K. Antidepressant-Like Effect of b -Lactolin, a Glycine-Threonine-Tryptophan-Tyrosine Peptide. J. Nutr. Sci. Vitaminol. 2019, 65, 430–434. [Google Scholar]
- Broussard, J.I.; Yang, K.; Levine, A.T.; Tsetsenis, T.; Jenson, D.; Cao, F.; Garcia, I.; Arenkiel, B.R.; Zhou, F.-M.; De Biasi, M.; et al. Dopamine Regulates Aversive Contextual Learning and Associated In Vivo Synaptic Plasticity in the Hippocampus. Cell Rep. 2016, 14, 1930–1939. [Google Scholar] [CrossRef]
- McNamara, C.G.; Tejero-Cantero, Á.; Trouche, S.; Campo-Urriza, N.; Dupret, D. Dopaminergic neurons promote hippocampal reactivation and spatial memory persistence. Nat. Neurosci. 2014, 17, 1658–1660. [Google Scholar] [CrossRef]
- Chowdhury, R.; Guitart-Masip, M.; Lambert, C.; Dayan, P.; Huys, Q.; Düzel, E.; Dolan, R.J. Dopamine restores reward prediction errors in old age. Nat. Neurosci. 2013, 16, 648–653. [Google Scholar] [CrossRef]
- Petrelli, F.; Dallérac, G.; Pucci, L.; Calì, C.; Zehnder, T.; Sultan, S.; Lecca, S.; Chicca, A.; Ivanov, A.; Asensio, C.S.; et al. Dysfunction of homeostatic control of dopamine by astrocytes in the developing prefrontal cortex leads to cognitive impairments. Mol. Psychiatry 2020, 25, 732–749. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (3′-5′) |
---|---|---|
Gapdh | GTCATCCCAGAGCTGAACGG | ATACTTGGCAGGTTTCTCCAGG |
Mao-b | GCCCATTTCCACCAGTATGGA | CTGGGAATCTCTTGGCCCATC |
Comt | GGTTGGTTTGAGTTCGTGCAG | TTTGCGTGTTGCTGCACATG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Akiyama, S.; Ayabe, T.; Takahashi, C.; Ohya, R.; Ano, Y. β-lactolin, a Monoamine Oxidase B Inhibitory Lactopeptide, Suppresses Reactive Oxygen Species Production in Lipopolysaccharide-Stimulated Astrocytes. Appl. Sci. 2021, 11, 3034. https://doi.org/10.3390/app11073034
Akiyama S, Ayabe T, Takahashi C, Ohya R, Ano Y. β-lactolin, a Monoamine Oxidase B Inhibitory Lactopeptide, Suppresses Reactive Oxygen Species Production in Lipopolysaccharide-Stimulated Astrocytes. Applied Sciences. 2021; 11(7):3034. https://doi.org/10.3390/app11073034
Chicago/Turabian StyleAkiyama, Shiori, Tatsuhiro Ayabe, Chika Takahashi, Rena Ohya, and Yasuhisa Ano. 2021. "β-lactolin, a Monoamine Oxidase B Inhibitory Lactopeptide, Suppresses Reactive Oxygen Species Production in Lipopolysaccharide-Stimulated Astrocytes" Applied Sciences 11, no. 7: 3034. https://doi.org/10.3390/app11073034
APA StyleAkiyama, S., Ayabe, T., Takahashi, C., Ohya, R., & Ano, Y. (2021). β-lactolin, a Monoamine Oxidase B Inhibitory Lactopeptide, Suppresses Reactive Oxygen Species Production in Lipopolysaccharide-Stimulated Astrocytes. Applied Sciences, 11(7), 3034. https://doi.org/10.3390/app11073034