Novel Vitronectin Variations and Their Comparative Analysis in Six Porcine Breeds
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Sampling
2.2. DNA Extraction and PCR Amplification
2.3. Sequencing of Amplicons and Sequence Analysis
2.4. Statistical Analysis
3. Results
3.1. Identification of the Variation and Amino Acid Change in the Amplified Regions
3.2. Frequencies of Variations in Different Breeds
3.3. A difference of Variable Frequencies in Various Breeds
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Preissner, K.T.; Seiffert, D. Role of vitronectin and its receptors in haemostasis and vascular remodeling. Thromb. Res. 1998, 89, 1–21. [Google Scholar] [CrossRef]
- Ekmekci, H.; Sonmez, H.; Ekmekci, O.B.; Ozturk, Z.; Domanic, N.; Kokoglu, E. Plasma vitronectin levels in patients with coronary atherosclerosis are increased and correlate with extent of disease. J. Thromb. Thrombolysis 2002, 14, 221–225. [Google Scholar] [CrossRef] [PubMed]
- Bittorf, S.V.; Williams, E.C.; Mosher, D.F. Alteration of vitronectin. Characterization of changes induced by treatment with urea. J. Biol. Chem. 1993, 268, 24838–24846. [Google Scholar]
- Leavesley, D.I.; Kashyap, A.S.; Croll, T.; Sivaramakrishnan, M.; Shokoohmand, A.; Hollier, B.G.; Upton, Z. Vitronectin—Master controller or micromanager. IUBMB Life 2013, 65, 807–818. [Google Scholar] [CrossRef]
- Zhang, D.; Hudson, A.E.; Delostrinos, C.F.; Carmean, N.; Eastman, R., Jr.; Hicks, B.; Hurst, R.E.; Bassuk, J.A. Dual sources of vitronectin in the human lower urinary tract: Synthesis by urothelium vs. extravasation from the bloodstream. Am. J. Physiol.-Ren. Physiol. 2011, 300, 475–487. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Preissner, K.T.; Reuning, U. Vitronectin in vascular context: Facets of a multitalented matricellular protein. Semin. Thromb. Hemost. 2011, 37, 408–424. [Google Scholar] [CrossRef] [PubMed]
- Preissner, K.T.; May, A.E.; Wohn, K.D.; Germer, M.; Kanse, S.M. Molecular crosstalk between adhesion receptors and proteolytic cascades in vascular remodelling. Thromb. Haemost. 1997, 78, 88–95. [Google Scholar] [CrossRef] [PubMed]
- Mohri, H.; Ohkubo, T. How vitronectin binds to activated glycoprotein IIb-IIIa complex and its function in platelet aggregation. Am. J. Clin. Pathol. 1991, 96, 605–609. [Google Scholar] [CrossRef] [PubMed]
- Rösen, P.; Schwippert, B.; Tschöpe, D. Adhesive proteins in platelet-endothelial interactions. Eur. J. Clin. Investig. 1994, 24, 21–24. [Google Scholar] [CrossRef]
- Boddicker, N.; Gabler, N.K.; Spurlock, M.E.; Nettleton, D.; Dekkers, J.C. Effects of ad libitum and restricted feed intake on growth performance and body composition of Yorkshire pigs selected for reduced residual feed intake. J. Anim. Sci. 2011, 89, 40–51. [Google Scholar] [CrossRef] [PubMed]
- Grubbs, J.K.; Dekkers, J.C.; Huff-Lonergan, E.; Tuggle, C.K.; Lonergan, S.M. Identification of potential serum biomarkers to predict feed efficiency in young pigs. J. Anim. Sci. 2016, 94, 1482–1492. [Google Scholar] [CrossRef] [PubMed]
- Duarte, D.A.S.; Newbold, C.J.; Detmann, E.; Silva, F.F.; Freitas, P.H.F.; Veroneze, R.; Duarte, M.S. Genome-wide association studies pathway-based meta-analysis for residual feed intake in beef cattle. Anim. Genet. 2019, 50, 150–153. [Google Scholar] [CrossRef] [PubMed]
- Gechtman, Z.; Belleli, A.; Lechpammer, S.; Shaltiel, S. The cluster of basic amino acids in vitronectin contributes to its binding of plasminogen activator inhibitor-1: Evidence from thrombin-, elastase- and plasmin-cleaved vitronectins and anti-peptide antibodies. Biochem. J. 1997, 325, 339–349. [Google Scholar] [CrossRef] [PubMed]
- Mayasundari, A.; Whittemore, N.A.; Serpersu, E.H.; Peterson, C.B. The solution structure of the N-terminal domain of human vitronectin: Proximal sites that regulate fibrinolysis and cell migration. J. Biol. Chem. 2004, 279, 29359–29366. [Google Scholar] [CrossRef] [PubMed]
- Seger, D.; Gechtman, Z.; Shaltiel, S. Phosphorylation of vitronectin by casein kinase II. Identification of the sites and their promotion of cell adhesion and spreading. J. Biol. Chem. 1998, 273, 24805–24813. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Chen, Q.; Yang, Y.; Liao, R.; Zhao, J.; Zhang, Z.; Chen, Z.; Zhang, X.; Xue, M.; Yang, H.; et al. Genetic diversity and population structure of six Chinese indigenous pig breeds in the Taihu Lake region revealed by sequencing data. Anim. Genet. 2015, 46, 697–701. [Google Scholar] [CrossRef] [PubMed]
- Xu, P.; Wang, X.; Ni, L.; Zhang, W.; Lu, C.; Zhao, X.; Zhao, X.; Ren, J. Genome-wide genotyping uncovers genetic diversity, phylogeny, signatures of selection, and population structure of Chinese Jiangquhai pigs in a global perspective. J. Anim. Sci. 2019, 97, 1491–1500. [Google Scholar] [CrossRef] [PubMed]
- Badke, Y.M.; Bates, R.O.; Ernst, C.W.; Schwab, C.; Steibel, J.P. Estimation of linkage disequilibrium in four US pig breeds. BMC Genom. 2012, 13, 24. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Song, Q.Q.; Wu, F.; Zhang, J.Z.; Xu, M.S.; Li, H.H.; Han, Z.J.; Gao, H.X.; Xu, N.Y. Evaluation of the four breeds in synthetic line of Jiaxing Black Pigs and Berkshire for meat quality traits, carcass characteristics, and flavor substances. Anim. Sci. J. 2019, 90, 574–582. [Google Scholar] [CrossRef] [PubMed]
Breed Abbreviation | Breed Name | Sampling Location | Number (n) |
---|---|---|---|
MX | American Duroc | Sampled in Hunan, China | 24 |
JX | Canadian Duroc | Sampled in Jiangsu, China | 24 |
BKX | Berkshire | Sampled in Jiangsu, China | 24 |
JQH | Jiangqu-hai | Sampled in Jiangsu, China | 24 |
SJ | Sujiang | Sampled in Jiangsu, China | 24 |
JXH | Jiaxing-black | Sampled in Zhejiang, China | 24 |
Total | 144 |
Primer Sequence (5′–3′) | Amplicon Size | Amplified Region | |
---|---|---|---|
Region 1 | Up: GCTGTCATACTCCCTCTCCA | 498 bp | Spanning a region of exon 2 and exon 3 |
Dn: TCTGCCATTCCAGTCACCT | |||
Region 2 | Up: ACTGGAATGGCAGACCTTG | 253 bp | Spanning a region of exon 5 and intron 5 |
Dn: AGATAGCCTTGACCCTGACC |
Gene | Variable Region | Position a | Amino Acid Change |
---|---|---|---|
Vitronectin | Exon 2 | c.153C/T * | No change |
c.154G/A * | Ala52Thr | ||
c.156C/T * | No change | ||
c.180C/G * | No change | ||
Intron 2 | c.184 + 66C/T * | / | |
c.184 + 81C/T * | / | ||
Exon 3 | c.189C/T * | No change | |
c.281T/C | Leu94Pro | ||
c.281A/T | Leu94Gln | ||
c.281A/C | Gln94Pro | ||
c.282A/G * | No change | ||
c.377A/G * | Glu126Gly | ||
Intron 3 | c.378 + 5C/T * | / | |
Exon 5 | c.459A/G * | No change | |
Intron 5 | c.597 + 12A/G * | / | |
c.597 + 15A/G * | / |
Breed | JiaXing-Black (Frequency) (n = 24) | Jiangqu-Hai (Frequency) (n = 24) | SuJiang (Frequency) (n = 24) | American Duroc (Frequency) (n = 24) | Canadian Duroc (Frequency) (n = 24) | Berkshire (Frequency) (n = 24) | Total (Frequency) (n = 144) | |
---|---|---|---|---|---|---|---|---|
Position | ||||||||
c.153C/T | 0.00% | 0.00% | 0.00% | 0.00% | 0.00% | 8.3% (2) | 1.39% | |
c.154G/A | 0.00% | 29.1% (7) | 0.00% | 0.00% | 25.0% (6) | 8.3% (2) | 10.4% | |
c.156C/T | 79.2% (19) | 79.2% (19) | 45.8% (11) | 29.1% (7) | 62.5% (15) | 0.00% | 49.3% | |
c.180C/G | 0.00% | 0.00% | 0.00% | 0.00% | 0.00% | 8.3% (2) | 1.39% | |
c.184 + 66C/T | 0.00% | 29.1% (7) | 0.00% | 0.00% | 29.1% (7) | 8.3% (2) | 11.1% | |
c.184 + 81C/T | 79.2% (19) | 29.1% (7) | 0.00% | 16.7% (4) | 0.00% | 0.00% | 20.8% | |
c.189C/T | 0.00% | 33.3% (8) | 45.8% (11) | 0.00% | 0.00% | 0.00% | 13.2% | |
c.281T/C | 0.00% | 0.00% | 45.8% (11) | 0.00% | 33.3% (8) | 8.3% (2) | 14.6% | |
c.281A/T | 79.2% (19) | 79.2% (19) | 12.5% (3) | 16.7% (4) | 0.00% | 0.00% | 31.3% | |
c.281A/C | 0.00% | 0.00% | 16.7% (4) | 8.3% (2) | 0.00% | 0.00% | 4.17% | |
c.282A/G | 0.00% | 33.3% (8) | 45.8% (11) | 8.3% (2) | 33.3% (8) | 8.3% (2) | 21.5% | |
c.377A/G | 79.2% (19) | 62.5% (15) | 50.0% (12) | 0.00% | 0.00% | 0.00% | 31.9% | |
c.378 + 5C/T | 0.00% | 50.0% (12) | 50.0% (12) | 8.3% (2) | 62.5% (15) | 0.00% | 28.5% | |
c.459A/G | 0.00% | 16.7% (4) | 0.00% | 0.00% | 16.7% (4) | 62.5% (15) | 16.0% | |
c.597 + 12A/G | 79.2% (19) | 12.5% (3) | 45.8% (11) | 8.3% (2) | 91.7% (22) | 0.00% | 39.6% | |
c.597 + 15A/G | 66.7% (16) | 29.1% (7) | 33.3% (8) | 0.00% | 50.0% (12) | 8.3% (2) | 31.3% |
Sites | Breeds (Frequency %) | p Value | Breeds (Frequency %) | p Value | Breeds (Frequency %) | p Value |
---|---|---|---|---|---|---|
c.154G/A | Jiangqu-Hai (29.1%) | p > 0.05 | Canadian Duroc (25.0%) | p > 0.05 | / | / |
Canadian Duroc (25.0%) | Berkshire (8.3%) | / | / | |||
Berkshire (8.3%) | / | / | / | / | ||
c.156C/T | Jiaxing-black (79.2%) | p < 0.05 | JiaXing-Black (79.2%) | p < 0.05 | American Duroc (29.1%) | p < 0.05 |
Jiangqu-Hai (79.2%) | Jiangqu-Hai (79.2%) | Canadian Duroc (62.5%) | ||||
Sujiang (45.8%) | SuJiang (45.8%) | / | / | |||
American Duroc (29.1%) | / | / | / | / | ||
Canadian Duroc (62.5%) | / | / | / | / | ||
c.281T/C | Sujiang (45.8%) | p < 0.05 | Canadian Duroc (33.3%) | p < 0.05 | / | / |
Canadian Duroc (33.3%) | Berkshire (8.3%) | / | / | |||
Berkshire (8.3%) | / | / | / | / | ||
c.281A/T | Jiaxing-black (79.2%) | p < 0.05 | JiaXing-Black (79.2%) | p < 0.05 | / | / |
Jiangqu-Hai (79.2%) | Jiangqu-Hai (79.2%) | / | / | |||
Sujiang (12.5%) | SuJiang (12.5%) | / | / | |||
American Duroc (16.7%) | / | / | / | / | ||
c.281A/C | Sujiang (16.7%) | p > 0.05 | / | / | / | / |
American Duroc (8.3%) | / | / | / | / | ||
c.282A/G | Jiangqu-Hai (33.3%) | p < 0.05 | Jiangqu-Hai (33.3%) | p > 0.05 | American Duroc (8.3%) | p < 0.05 |
Sujiang (45.8%) | SuJiang (45.8%) | Canadian Duroc (33.3%) | ||||
American Duroc (8.3%) | / | / | Berkshire (8.3%) | |||
Canadian Duroc (33.3%) | / | / | / | / | ||
Berkshire (8.3%) | / | / | / | / | ||
c.377A/G | JiaXing-Black (79.2%) | p > 0.05 | / | / | / | / |
Jiangqu-Hai (62.5%) | / | / | / | / | ||
SuJiang (50%) | / | / | / | / | ||
c.459A/G | Jiangqu-Hai (16.7%) | p < 0.05 | Canadian Duroc (16.7%) | p < 0.05 | / | / |
Canadian Duroc (16.7%) | Berkshire (62.5%) | / | / | |||
Berkshire (62.5%) | / | / | / | / |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yan, W.; Zhao, X.; Li, J.; Cheng, L.; Li, Y. Novel Vitronectin Variations and Their Comparative Analysis in Six Porcine Breeds. Animals 2019, 9, 520. https://doi.org/10.3390/ani9080520
Yan W, Zhao X, Li J, Cheng L, Li Y. Novel Vitronectin Variations and Their Comparative Analysis in Six Porcine Breeds. Animals. 2019; 9(8):520. https://doi.org/10.3390/ani9080520
Chicago/Turabian StyleYan, Wei, Xutin Zhao, Juyin Li, Long Cheng, and Yanqing Li. 2019. "Novel Vitronectin Variations and Their Comparative Analysis in Six Porcine Breeds" Animals 9, no. 8: 520. https://doi.org/10.3390/ani9080520
APA StyleYan, W., Zhao, X., Li, J., Cheng, L., & Li, Y. (2019). Novel Vitronectin Variations and Their Comparative Analysis in Six Porcine Breeds. Animals, 9(8), 520. https://doi.org/10.3390/ani9080520