Association of Ghrelin Gene Polymorphisms with Fattening Traits and Feed Intake in Pig: A Preliminary Study
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Feeding
2.2. Performance Test
2.3. Genotyping
2.4. Statistical Analyses
3. Results and Discussion
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Cone, R.D. The central melanocortin system and energy homeostasis. Trends Endocrinol. Metab. 1999, 10, 212–216. [Google Scholar] [CrossRef] [Scilit]
- Cone, R.D. Anatomy and regulation of the central melanocortin system. Nat. Neurosci. 2005, 8, 571–578. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jeong, J.K.; Kim, J.G.; Lee, B.J. Cellular and Molecular Life Sciences Participation of the central melanocortin system in metabolic regulation and energy homeostasis. Cell. Mol. Life Sci. 2014, 71, 3799–3809. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ellacott, K.L.J.; Cone, R.D. The role of the central melanocortin system in the regulation of food intake and energy homeostasis: Lessons from mouse models. Philos. Trans. R. Soc. B Biol. Sci. 2006, 361, 1265–1274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hahn, T.; Breininger, J.; Baskin, D.; Schwartz, M.W. Coexpression of Agrp and NPY in fasting-activated hypothalamic neurons. Nat. Neurosci. 1998, 1, 271–272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gropp, E.; Shanabrough, M.; Borok, E.; Xu, A.W.; Janoschek, R.; Buch, T.; Plum, L.; Balthasar, N.; Hampel, B.; Waisman, A.; et al. Agouti—Related peptide—Expressing neurons are mandatory for feeding. Nat. Neurosci. 2005, 8, 1289–1291. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luquet, S.; Perez, F.A.; Hnasko, T.S.; Palmiter, R.D. NPY/AgRP Neurons Are Essential for Feeding in Adult Mice but Can Be Ablated in Neonates. Science (80-) 2005, 310, 683–686. [Google Scholar] [CrossRef] [Scilit]
- Chen, H.Y.; Trumbauer, M.E.; Chen, A.S.; Weingarth, D.T.; Adams, J.R.; Frazier, E.G.; Shen, Z.; Marsh, D.J.; Feighner, S.D.; Guan, X.M.; et al. Orexigenic action of peripheral ghrelin is mediated by neuropeptide Y and agouti-related protein. Endocrinology 2004, 145, 2607–2612. [Google Scholar] [CrossRef] [Scilit]
- Cummings, D.E.; Foster, K.E. Ghrelin-Leptin Tango in Body-Weight Regulation. Gastroenterolog 2003, 124, 1532–1544. [Google Scholar] [CrossRef] [Scilit]
- Kojima, M.; Hosoda, H.; Date, Y.; Nakazato, M.; Matsuo, H.; Kangawa, K. Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 1999, 402, 656–660. [Google Scholar] [CrossRef] [Scilit]
- Korbonits, M.; Goldstone, A.P.; Gueorguiev, M.; Grossman, A.B. Ghrelin—A hormone with multiple functions. Front. Neuroendocrinol. 2004, 25, 27–68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, K.-S.S.; Thomsen, H.; Bastiaansen, J.; Nguyen, N.T.; Dekkers, J.C.M.M.; Plastow, G.S.; Rothschild, M.F.; Bastiaanse, J.; Thu Nguyen, N.; Dekkers, J.C.M.M.; et al. Investigation of Obesity Candidate Genes On Porcine Fat Deposition Quantitative Trait Loci Regions. Obes. Res. 2004, 12, 1981–1994. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cummings, D.E.; Eigle, D.S.; Frayo, R.S.; Breen, P.A.; Ma, M.K.; Dellinger, E.P.; Purnell, J.Q. Plasma ghrelin levels after diet-inducted weight loss or gastric bypass surgery. N. Engl. J. Med. 2002, 346, 1623–1630. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wortley, K.E.; Anderson, K.D.; Garcia, K.; Murray, J.D.; Malinova, L.; Liu, R.; Moncrieffe, M.; Thabet, K.; Cox, H.J.; Yancopoulos, G.D.; et al. Genetic deletion of ghrelin does not decrease food intake but influences metabolic fuel preference. Proc. Natl. Acad. Sci. USA 2004, 101, 8227–8232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sherman, E.L.; Nkrumah, J.D.; Murdoch, B.M.; Li, C.; Wang, Z.; Fu, A.; Moore, S.S. Polymorphisms and haplotypes in the bovine neuropeptide Y, growth hormone receptor, ghrelin, insulin-like growth factor 2, and uncoupling proteins 2 and 3 genes and their associations with measures of growth, performance, feed efficiency, and carcass meri. J. Anim. Sci. 2008, 86, 1–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, J.; Jin, Q.; Zhang, C.; Fang, X.; Gu, C.; Lei, C.; Wang, J.; Chen, H. Polymorphisms in the bovine ghrelin precursor (GHRL) and Syndecan-1 (SDC1) genes that are associated with growth traits in cattle. Mol. Biol. Rep. 2011, 38, 3153–3160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Braz, C.U.; Camargo, G.M.F.; Cardoso, D.F.; Gil, F.M.M.; Fonseca, S.; Cyrillo, J.N.S.G.; Mercadante, M.E.Z.; Oliveira, H.N.; Tonhati, H. Polymorphisms in the GHRL gene and their associations with traits of economic interest in beef cattle. Genet. Mol. Res. 2015, 14, 18188–18197. [Google Scholar] [CrossRef] [Scilit]
- Li, C.C.; Li, K.; Li, J.; Mo, D.L.; Xu, R.F.; Chen, G.H.; Qiangba, Y.Z.; Ji, S.L.; Tang, X.H.; Fan, B.; et al. Polymorphism of Ghrelin Gene in Twelve Chinese Indigenous Chicken Breeds and Its Relationship with Chicken Growth Traits. Asian-Aust. J. Anim. Sci. 2006, 19, 153–159. [Google Scholar] [CrossRef] [Scilit]
- Fang, M.; Nie, Q.; Luo, C.; Zhang, D.; Zhang, X. An 8bp indel in exon 1 of Ghrelin gene associated with chicken growth. Domest. Anim. Endocrinol. 2007, 32, 216–225. [Google Scholar] [CrossRef] [Scilit]
- Jin, S.; Chen, S.; Li, H.; Lu, Y.; Xu, G.; Yang, N. Associations of polymorphisms in GHRL, GHSR, and IGF1R genes with feed efficiency in chickens. Mol. Biol. Rep. 2014, 41, 3973–3979. [Google Scholar] [CrossRef] [Scilit]
- Patience, J.F.; Rossoni-Serão, M.C.; Gutiérrez, N.A. A review of feed efficiency in swine: Biology and application. J. Anim. Sci. Biotechnol. 2015, 6, 33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Różycki, M.; Tyra, M. Rules at evaluating the pigs in Pig Slaughter Testing Station. State of pig breeding and pig evaluation results. IZ PIB 2010, 28, 92–117. [Google Scholar]
- Ropka-Molik, K.; Oczkowicz, M.; Piorkowska, K.; Rozycki, M.; Romanek, J.; Natonek-Wisniewska, M. New polymorphisms and expression of the porcine ghrelin (GHRL) gene in different pig breeds. J. Anim. Feed Sci. 2011, 20, 186–199. [Google Scholar] [CrossRef] [Scilit]
- Tschop, M.; Smiley, D.L.; Heiman, M.L. Ghrelin induces adiposity in rodents. Nature 2000, 407, 908–913. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Drazen, D.L.; Vahl, T.P.; D’alessio, D.A.; Seeley, R.J.; Woods, S.C. Effects of a Fixed Meal Pattern on Ghrelin Secretion: Evidence for a Learned Response Independent of Nutrient Status. Endocrinology 2006, 147, 23–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wren, A.M.; Small, C.J.; Abbott, C.R.; Dhillo, W.S.; Seal, L.J.; Cohen, M.A.; Batterham, R.L.; Taheri, S.; Stanley, S.A.; Ghatei, M.A.; et al. Ghrelin causes hyperphagia and obesity in rats. Diabetes 2001, 50, 2540–2547. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wren, A.M.; Small, C.J.; Ward, H.L.; Murphy, K.G.; Dakin, C.L.; Taheri, S.; Kennedy, A.R.; Roberts, G.H.; Morgan, D.G.; Ghatei, M.A.; et al. The novel hypothalamic peptide ghrelin stimulates food intake and growth hormone secretion. Endocrinol. Print. USA 2000, 141, 4325–4328. [Google Scholar] [CrossRef]
- Wren, A.M.; Seal, L.J.; Cohen, M.A.; Brynes, A.E.; Frost, G.S.; Murphy, K.G.; Dhillo, W.S.; Ghatei, M.A.; Bloom, S.R. Ghrelin enhances appetite and increases food intake in humans. J. Clin. Endocrinol. Metab. 2001, 86, 5992–5995. [Google Scholar] [CrossRef]
- Dong, X.-Y.; Xu, J.; Tang, S.-Q.; Li, H.-Y.; Jiang, Q.-Y.; Zou, X.-T. Ghrelin and its biological effects on pigs. Peptides 2009, 30, 1203–1211. [Google Scholar] [CrossRef] [Scilit]
- Wojtysiak, D.; Kaczor, U. Effect of polymorphisms at the ghrelin gene locus on carcass, microstructure and physicochemical properties of longissimus lumborum muscle of Polish Landrace pigs. Meat Sci. 2011, 89, 514–518. [Google Scholar] [CrossRef] [Scilit]
- Jin, Q.J.; Fang, X.T.; Zhang, C.L.; Yang, L.; Sun, J.J.; Chen, D.X.; Shi, X.Y.; Du, Y.; Lan, X.Y.; Chen, H. A novel SNP of the GHRL gene in goat and its association with growth traits. Small Rumin. Res. 2010, 90, 150–152. [Google Scholar] [CrossRef] [Scilit]
- Gil, F.; de Camargo, G.; Pablos de Souza, F.; Cardoso, D.; Fonseca, P.; Zetouni, L.; Braz, C.; Aspilcueta-Borquis, R.; Tonhati, H. Polymorphisms in the ghrelin gene and their associations with milk yield and quality in water buffaloes. J. Dairy Sci. 2013, 96, 3326–3331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ukkola, O.; Ravussin, E.; Jacobson, P.; Pérusse, L.; Rankinen, T.; Tschöp, M.; Heiman, M.L.; Leon, A.S.; Rao, D.C.; Skinner, J.S.; et al. Role of Ghrelin polymorphisms in obesity based on three different studies. Obes. Res. 2002, 10, 782–791. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kowalewska-Łuczak, I.; Szembek, M.; Kulig, H. Ghrelin gene polymorphism in dairy cattle Polimorfizm w genie greliny u bydła mlecznego. J. Cent. Eur. Agric. 2011, 12, 744–751. [Google Scholar] [CrossRef] [Scilit]
- Bahrami, A.; Behzadi, S.; Miraei-Ashtiani, S.R.; Roh, S.-G.; Katoh, K. Genetic polymorphisms and protein structures in growth hormone, growth hormone receptor, ghrelin, insulin-like growth factor 1 and leptin in Mehraban sheep. Gene 2013, 527, 397–404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tanaka, K.; Takizawa, T.; Oki, O.; Fukawa, K.; Ito, T.; Miyabe, M.; Mannen, H.; Kurosawa, Y.; Hirose, K. Allele frequency for c.335 A>C polymorphisms in porcine ghrelin/obestatin prepropeptide gene and association analysis with performance traits in various pig breeds. Czech J. Anim. Sci. 2015, 60, 411–416. [Google Scholar] [CrossRef] [Scilit]
- Lents, C.A.; Brown-Brandl, T.M.; Rohrer, G.A.; Oliver, W.T.; Freking, B.A. Plasma concentrations of acyl-ghrelin are associated with average daily gain and feeding behavior in grow-finish pigs. Domest. Anim. Endocrinol. 2016, 55, 107–113. [Google Scholar] [CrossRef] [Scilit]
- Gjerlaug-Enger, E.; Kongsro, J.; Ødegård, J.; Aass, L.; Vangen, O. Genetic parameters between slaughter pig efficiency and growth rate of different body tissues estimated by computed tomography in live boars of Landrace and Duroc. Animal 2012, 6, 9–18. [Google Scholar] [CrossRef] [Scilit]
- Saintilan, R.; Sellier, P.; Billon, Y.; Gilbert, H. Genetic correlations between males, females and castrates for residual feed intake, feed conversion ratio, growth rate and carcass composition traits in Large White growing pigs. J. Anim. Breed. Genet. 2012, 129, 103–106. [Google Scholar] [CrossRef] [Scilit]
- Wu, X.; Tang, M.; Ma, Q.; Hu, X.; Ju, C.; Hu, Z.; Ji, C. Effects of exogenous ghrelin on the behaviors and performance of weanling piglets. Asian-Australas. J. Anim. Sci. 2008, 21, 861–867. [Google Scholar] [CrossRef] [Scilit]
- Scrimgeour, K.; Gresham, M.J.; Giles, L.R.; Thomson, P.C.; Wynn, P.C.; Newman, R.E. Ghrelin secretion is more closely aligned to energy balance than with feeding behaviour in the grower pig. J. Endocrinol. 2008, 198, 135–145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sugino, T.; Hasegawa, Y.; Kurose, Y.; Kojima, M.; Kangawa, K.; Terashima, Y. Effects of ghrelin on food intake and neuroendocrine function in sheep. Anim. Reprod. Sci. 2004, 8283, 183–194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Geelissen, S.M.E.; Swennen, Q.; Van Der Geyten, S.; Kühn, E.R.; Kaiya, H.; Kangawa, K.; Decuypere, E.; Buyse, J.; Darras, V.M. Peripheral ghrelin reduces food intake and respiratory quotient in chicken. Domest. Anim. Endocrinol. 2006, 30, 108–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Costa, E.V.; Diniz, D.B.; Veroneze, R.; Resende, M.D.V.; Azevedo, C.F.; Guimaraes, S.E.F.; Silva, F.F.; Lopes, P.S. Estimating additive and dominance variances for complex traits in pigs combining genomic and pedigree information. Genet. Mol. Res. 2015, 14, 6303–6311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rohrer, G.A.; Brown-Brandl, T.; Rempel, L.A.; Schneider, J.F.; Holl, J. Genetic analysis of behavior traits in swine production. Livest. Sci. 2013, 157, 28–37. [Google Scholar] [CrossRef] [Scilit]
- Foote, A.P.; Hales, K.E.; Lents, C.A.; Freetly, H.C. Association of circulating active and total ghrelin concentrations with dry matter intake, growth, and carcass characteristics of finishing beef cattle. J. Anim. Sci. 2014, 92, 5651–5658. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Foote, A.P.; Hales, K.E.; Freetly, H.C. Changes in acyl and total ghrelin concentrations and their association with dry matter intake, average daily gain, and feed efficiency of finishing beef steers and heifers. Domest. Anim. Endocrinol. 2016, 57, 100–107. [Google Scholar] [CrossRef] [Scilit]
- Reynolds, C.B.; Elias, A.N.; Whisnant, C.S. Effects of feeding pattern on ghrelin and insulin secretion in pigs. Domest. Anim. Endocrinol. 2010, 39, 90–96. [Google Scholar] [CrossRef] [Scilit]
| Item | Grower Diet 30–80 kg | Finisher Diet 80–100 kg | |
|---|---|---|---|
| Energy (MJ/Kg) | min | 13.50 | 13.00 |
| Crude protein (%) | min-max | 17–19 | 16–18 |
| Digestible protein (%) | min | 13.90 | 12.80 |
| GHRL Gene Region | SNP | Primers Sequence | Endonuclease | Obtained Alleles |
|---|---|---|---|---|
| 5’ gene flanking region | c.-93A>G rs196957643 | FCTTGCCACTTCAGCTCCATT R CTCCACTCCCTCATCTGCTC | MwoI | A-343,301,109bp G-301, 195, 148, 109bp |
| Exon 4 (3’UTR region) | g.4428T>C rs196958624 | FACCAAGCACGTTTCCTGAAG RGAAATCTTCCTGTGGGGTGA | BslI | T-282bp; C-173, 109bp |
| g.4486C>T rs196950724 | HgaI | C-180, 71, 31bp T-180, 102bp |
| SNP | Alleles (%) | Genotype Observed (%) | Genotype Expected (%) | Significance Level | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| A | G | AA | AG | GG | AA | AG | GG | |||
| c.-93A>G | 82.6 | 17.4 | 69.0 | 27.2 | 3.8 | 68.0 | 29.0 | 3.0 | ns | (2= 0.8571) |
| C | T | CC | CT | TT | CC | CT | TT | |||
| g.4428T>C | 69.0 | 31.0 | 49.4 | 39.3 | 11.3 | 47.7 | 42.8 | 9.5 | ns | (2= 2.2125) |
| C | T | CC | CT | TT | CC | CT | TT | |||
| g.4486C>T | 31.1 | 68.9 | 12.7 | 37.0 | 50.3 | 9.7 | 42.8 | 47.5 | * | (2= 5.8131) |
| SNP | Landrace N = 188 | Duroc N = 74 | Pietrain N = 84 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| AA | AG | GG | AA | AG | GG | AA | AG | GG | |
| c.-93A>G | 73.84 | 25.58 | 0.58 | 84.51 | 14.08 | 1.41 | 44.26 | 42.84 | 12.90 |
| CC | CT | TT | CC | CT | TT | CC | CT | TT | |
| g.4428T>C | 42.55 | 48.40 | 9.05 | 31.08 | 39.19 | 29.73 | 78.57 | 19.05 | 2.38 |
| CC | CT | TT | CC | CT | TT | CC | CT | TT | |
| g.4486C>T | 17.09 | 43.67 | 39.24 | 9.72 | 22.22 | 68.06 | 6.41 | 37.18 | 56.41 |
| Fattening Traits | Mean | ± SE | CV | GLM Significance | |||
|---|---|---|---|---|---|---|---|
| Breed | c.-93A>G | g.4428T>C | g.4486C>T | ||||
| Test daily gain(g) | 892 | 7.07 | 14.70 | ** | * | ||
| Daily gain (g) | 605 | 4.43 | 13.60 | * | ** | ||
| Feed-gain ratio (kg/kg b.w.) | 2.85 | 0.02 | 12.30 | * | |||
| Daily feed intake (kg) | 2.49 | 0.02 | 14.40 | ** | * | ||
| Total feed intake (kg) | 210 | 1.40 | 12.40 | * | * | ||
| Age at slaughter(days) | 171 | 1.20 | 13.10 | * | ** | ||
| Fattening period (days) | 85.3 | 0.63 | 13.60 | ** | * | * | |
| Fattening Traits | Effect (mean ± SE) | |||||
|---|---|---|---|---|---|---|
| c.-93A>G | g.4428T>C | g.4486C>T | ||||
| Additive | Dominance | Additive | Dominance | Additive | Dominance | |
| Test daily gain(g) | −37.34 ± 19.39 | −2.73 ± 11.97 | 26.07 ± 11.59 * | −0.77 ± 8.06 | 14.36 ± 12.32 | 6.90 ± 8.91 |
| Daily gain (g) | −33.88 ± 12.1 ** | −6.75 ± 7.47 | 9.23 ± 7.29 | −3.23 ± 5.07 | 1.23 ± 7.42 | 3.81 ± 5.37 |
| Feed-gain ratio (kg/kg b.w.) | 0.07 ± 0.05 | −0.01 ± 0.03 | −0.04 ± 0.03 | −0.02 ± 0.02 | −0.03 ± 0.03 | 0.03 ± 0.02 |
| Daily feed intake (g) | −0.08 ± 0.05 | −0.02 ± 0.03 | 0.06 ± 0.03 | −0.02 ± 0.02 | 0.01 ± 0.03 | 0.03 ± 0.03 |
| Total feed intake (kg) | −0.13 ± 3.87 | −1.40 ± 2.39 | −3.22 ± 2.31 | −0.46 ± 1.61 | −4.34± 2.29 | 1.32 ± 1.73 |
| Age at slaughter(days) | 9.67 ± 3.28 ** | 2.40 ± 2.03 | −2.06 ± 1.97 | 1.96 ± 1.37 | 0.41 ± 2.01 | −1.24 ± 1.46 |
| Fattening period (days) | 3.24 ± 1.72 | 0.13 ± 1.06 | −2.28 ± 1.03 * | 0.29 ± 0.71 | −2.07 ± 1.08 | −0.49 ± 0.78 |
| Traits | c.-93A>G | ||
|---|---|---|---|
| AA | AG | GG | |
| Test daily gain(g) | 891 ± 9.22 | 859 ± 12.55 | 826 ± 29.1 |
| Daily gain (g) | 612 ± 5.78 Aa(A) | 592 ± 7.93 ABb(AB) | 545 ± 11.66 Bab(B) |
| Feed-gain ratio (kg/kg b.w.) | 2.84 ± 0.02 | 2.86 ± 0.03 | 2.85 ± 0.07 |
| Daily feed intake (kg) | 2.50 ± 0.02 | 2.45 ± 0.04 | 2.33 ± 0.09 |
| Total feed intake (kg) | 209 ± 1.82 | 212 ± 2.66 | 208 ± 4.46 |
| Age at slaughter(days) | 169 ± 1.53 A(A) | 174 ± 2.31 Aba(AB) | 189 ± 4.32 Bb(B) |
| Fattening period (days) | 84.5 ± 0.80 | 87.6 ± 1.14 | 91.0 ± 3.04 |
| Traits | g.4428T>C | ||
|---|---|---|---|
| CC | TC | TT | |
| Test daily gain(g) | 865 ± 19.6 a(a) | 893 ± 14.03 ab(ab) | 917 ± 10.55 b(b) |
| Daily gain (g) | 597 ± 9.52 | 612 ± 7.61 | 615 ± 7.12 |
| Feed-gain ratio (kg/kg b.w.) | 2.86 ± 0.06 | 2.86 ± 0.03 | 2.76 ± 0.03 |
| Daily feed intake (kg) | 2.41 ± 0.06 a | 2.58 ± 0.03 b | 2.57 ± 0.03 b |
| Total feed intake (kg) | 211 ± 4.64 | 209 ± 2.63 | 205 ± 2.01 |
| Age at slaughter(days) | 174 ± 4.73 | 168 ± 2.16 | 170 ± 1.86 |
| Fattening period (days) | 87.3 ± 2.04 a(a) | 84.0 ± 1.19 ab(ab) | 82.3 ± 0.92 b(b) |
| Traits | g.4486C>T | ||
|---|---|---|---|
| CC | CT | TT | |
| Test daily gain(g) | 868 ± 8.93 | 869 ± 12.34 | 897 ± 21.99 |
| Daily gain (g) | 607 ± 6.05 | 601 ± 7.22 | 610 ± 14.08 |
| Feed-gain ratio (kg/kg b.w.) | 2.91 ± 0.03 | 2.87 ± 0.03 | 2.84 ± 0.05 |
| Daily feed intake (kg) | 2.51 ± 0.02 | 2.47 ± 0.04 | 2.53 ± 0.05 |
| Total feed intake (kg) | 217 ± 2.06 a | 210 ± 2.02 ab | 208 ± 4.63 b |
| Age at slaughter(days) | 169 ± 1.73 | 172 ± 1.83 | 170 ± 3.74 |
| Fattening period (days) | 87.4 ± 0.83 a(a) | 86.3 ± 1.06 ab(ab) | 83.3 ± 1.84 b(b) |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tyra, M.; Ropka-Molik, K.; Piórkowska, K.; Oczkowicz, M.; Szyndler-Nędza, M.; Małopolska, M. Association of Ghrelin Gene Polymorphisms with Fattening Traits and Feed Intake in Pig: A Preliminary Study. Animals 2019, 9, 410. https://doi.org/10.3390/ani9070410
Tyra M, Ropka-Molik K, Piórkowska K, Oczkowicz M, Szyndler-Nędza M, Małopolska M. Association of Ghrelin Gene Polymorphisms with Fattening Traits and Feed Intake in Pig: A Preliminary Study. Animals. 2019; 9(7):410. https://doi.org/10.3390/ani9070410
Chicago/Turabian StyleTyra, Mirosław, Katarzyna Ropka-Molik, Katarzyna Piórkowska, Maria Oczkowicz, Magdalena Szyndler-Nędza, and Martyna Małopolska. 2019. "Association of Ghrelin Gene Polymorphisms with Fattening Traits and Feed Intake in Pig: A Preliminary Study" Animals 9, no. 7: 410. https://doi.org/10.3390/ani9070410
APA StyleTyra, M., Ropka-Molik, K., Piórkowska, K., Oczkowicz, M., Szyndler-Nędza, M., & Małopolska, M. (2019). Association of Ghrelin Gene Polymorphisms with Fattening Traits and Feed Intake in Pig: A Preliminary Study. Animals, 9(7), 410. https://doi.org/10.3390/ani9070410

