Next Article in Journal
Size-Dependent Tissue Translocation and Physiological Responses to Dietary Polystyrene Microplastics in Salmo trutta
Previous Article in Journal
Genetic Parameters of Egg Quality Traits and Albumen Density in White Leghorn Chickens
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Integrated Targeted and Untargeted Metabolomics Reveals the Toxic Mechanisms of Zearalenone in Goat Leydig Cells

1
Key Laboratory of Animal Genetics, Breeding and Reproduction in the Plateau Mountainous Region, Ministry of Education, Guizhou University, Guiyang 550025, China
2
College of Animal Science, Guizhou University, Guiyang 550025, China
3
Institute of New Rural Development, Guizhou University, Guiyang 550025, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this study.
Animals 2026, 16(2), 283; https://doi.org/10.3390/ani16020283
Submission received: 17 November 2025 / Revised: 20 December 2025 / Accepted: 22 December 2025 / Published: 16 January 2026
(This article belongs to the Section Small Ruminants)

Simple Summary

This study focuses on the toxic mechanisms of zearalenone (ZEA) in goat Leydig cells (LCs). Using various experimental techniques, it is found that ZEA damages LCs in a dose-dependent manner, induces cell apoptosis and cycle arrest, and disrupts steroid hormone synthesis, as well as metabolic pathways such as glycerophospholipid and choline metabolism. This study clarifies the multifaceted hazards of ZEA to male goat reproductive cells and provides theoretical support for evaluating the impact of ZEA on goat reproductive performance.

Abstract

Zearalenone (ZEA) is a mycotoxin commonly found in animal feed and is associated with pronounced reproductive toxicity. However, most studies on ZEA’s reproductive effects have focused on female monogastric animals, while research on male ruminants remains limited. This study aimed to investigate the cytotoxic and metabolic mechanisms underlying ZEA-induced damage in goat Leydig cells (LCs). The CCK8 assay was first used to determine the effective ZEA concentration (IC50 ≈ 20 μM), and a cytotoxicity model was subsequently established. The model’s validity was confirmed using qRT-PCR, transmission electron microscopy, flow cytometry, and JC-1 staining. Results showed that ZEA significantly reduced LCs viability in a dose-dependent manner, decreased mitochondrial membrane potential, induced cell cycle arrest, and triggered apoptosis. Targeted and untargeted metabolomics analyses revealed that ZEA disrupts steroidogenic pathways and alters steroid hormone secretion, resulting in elevated levels of progesterone, corticosterone, and androstenedione, and reduced dihydrotestosterone levels. Furthermore, 52 significantly altered metabolites were identified, predominantly enriched in glycerophospholipid metabolism, choline metabolism, and neurotransmitter vesicle pathways, with corresponding changes in gene expression. Collectively, this study has confirmed that ZEA causes harm to the reproductive cells of male goats in multiple aspects, underscoring the link between metabolic dysregulation and reproductive impairment, and offering a foundation for evaluating ZEA’s impact on goat reproductive performance.

1. Introduction

The goat industry represents a vital sector of animal husbandry, with reproductive performance serving as a key determinant of the efficiency and productivity of the goat industry. Regulation of male reproductive function plays a pivotal role in enhancing reproductive efficiency, particularly through the maintenance of testosterone homeostasis. Testosterone, primarily synthesized by testicular Leydig cells (LCs), is essential for sex differentiation, spermatogenesis, and the maintenance of male secondary sexual characteristics [1]. Abnormal testosterone levels can result in male reproductive disorders, such as reduced semen quality and increased sperm malformation rates, and are also strongly associated with diseases including adrenal tumors and cortical hyperplasia [2,3,4]. Therefore, maintaining stable testosterone levels is critical for preserving male reproductive function and overall health.
In recent years, mycotoxin contamination in animal feed has become a critical factor limiting the health and productivity of livestock and poultry. Among various mycotoxins, ZEA is of particular concern due to its chemical stability and resistance to degradation. ZEA is widely present in corn, sorghum, and animal feed, and is regarded as one of the most hazardous fungal toxins in animal husbandry, posing a serious threat to human safety and animal health [5,6]. Numerous studies have shown that ZEA and its metabolites can induce reproductive disorders, disrupt immune and endocrine system functions, cause visceral organ damage, and even promote tumor development [7,8,9]. Although ZEA can act on multiple tissues and organs, the reproductive system is recognized as its primary target [10,11]. Because its molecular structure is closely resembles that of estrogen, ZEA competitively binds to estrogen receptors (ER) and forms ZEA–ER complexes, which is translocated into the nucleus. This interaction disrupts the transcriptional regulation of reproduction-related genes, leading to reproductive dysfunction, organ abnormalities, and impaired fertility in animals [12,13,14]. In female animals, ZEA exposure often results in impaired corpus luteum formation, ovarian atrophy, and uterine abnormalities, and in severe cases, can cause abortion, premature birth, or stillbirth [15,16,17]. At the cellular level, ZEA significantly reduces the viability of endometrial stromal cells (ESCs) and ovarian granulosa cells (GCs), inducing apoptosis, necrosis, and oxidative stress responses [18,19,20]. Moreover, ZEA exposure further disrupts GCs by causing cell cycle arrest and intensifying oxidative stress [21].
In addition, owing to its estrogen-like effects, ZEA has the physiological potential to disrupt steroid hormone synthesis and exert toxic effects on the male reproductive system. Previous studies have demonstrated that ZEA induces structural abnormalities in testicular tissue, reduces sperm motility, and lowers testosterone levels [22,23]. Boeira et al. reported that oral administration of ZEA (40 mg/kg for 48 h) in mice significantly decreased sperm count, motility, and testosterone concentrations [24]. Similarly, Yan et al. [25] showed that 57.5 μM ZEA induced apoptosis and oxidative stress in porcine testicular cells, thereby reducing their antioxidant capacity. ZEA has also been shown to promote reactive oxygen species (ROS)-mediated oxidative stress and autophagy in goat Sertoli cells [26]. Furthermore, the toxic effects of ZEA on male animals can be transmitted to offspring through impaired sperm quality, resulting in increased sperm malformation rates and reduced fertility [27].
However, most studies on the toxic effects of ZEA have focused on monogastric animals or females, whereas research on male ruminants, particularly testicular LCs, remains limited, and the underlying mechanisms are not yet fully understood. Considering that LCs are the principal cell type responsible for steroid hormone synthesis, this study employed goat Leydig cells as a model and utilized both targeted and untargeted metabolomic approaches to systematically investigate the toxic effects of ZEA and its impact on metabolic pathways. The objective was to elucidate the mechanisms underlying ZEA-induced toxicity and to provide a theoretical basis for developing effective strategies to mitigate and degrade ZEA.

2. Materials and Methods

2.1. Experimental Animals and Sampling

Testes were collected from three healthy, one-month-old Guizhou Black goats raised at the Experimental Goat Farm of the College of Animal Science, Guizhou University. All animal housing, management, and sample collection procedures were approved by the Animal Ethics Committee of Guizhou University (Approval No. EAE-GZU-2020-T064) and conducted in strict accordance with institutional animal welfare and ethical guidelines.

2.2. Isolation, Culture and Identification of Testicular LCs

These animals were anesthetized with atropine sulfate salt monohydrate (0.04 mg/kg) (A0257; Sigma-Aldrich, St. Louis, MO, USA) before sampling. Anesthesia and surgical procedures were performed by a veterinarian, then the testicles were collected. The testes samples were digested in Dulbecco’s modified Eagle’s medium/F-12 (DMEM/F-12) (Gibco, Waltham, MA, USA) containing 10% fetal bovine serum (FBS) (Thermo Fisher Scientific, Waltham, MA, USA) and 1 mg/mL type I collagenase (C8140, Beijing Solarbio Science & Technology, Beijing, China) at 37 °C for 1 h by constant stirring. The collagenase digestion was terminated with a medium containing 10% FBS, filtered through 200 and 400 mesh cell sieves and centrifuged at 800× g for 10 min. The LCs were collected from precipitation and cultured in DMEM/F-12 containing 10% FBS at 37 °C with 5% CO2. Cell purity was evaluated by indirect immunofluorescence using 3β-HSD (Proteintech, 10366-1-AP, Suzhou, China) as the primary antibody and Alexa Fluor 488 (Proteintech, SA00006-2, Suzhou, China) as the secondary antibody. The cells were fixed with 4% paraformaldehyde, washed with PBS, and then permeated with 0.5% Triton X-100 for 10 min. After PBS washing, they were blocked with 5% BSA for 30 min. After PBS washing, the first antibody was incubated at 4 °C overnight, and then the second antibody was incubated in the dark at 37 °C. After PBS washing, the DAPI staining solution (10 μg/mL) was added for 10 min, and finally the cells were observed under a microscope (Nikon Eclpse Ti5, Tokyo, Japan).

2.3. Cell Counting Kit-8 (CCK-8) Analysis

Cells were digested with 0.25% trypsin and resuspended to a density of 3 × 104 cells/mL. A volume of 100 μL of the cell suspension was seeded into each well of a 96-well plate and incubated for 12 h. Experimental groups included a blank group (basal medium), a control group (basal medium + cells), and ZEA treatment groups (5, 10, 20, and 30 μM), with three replicates per group. After 24 h of ZEA exposure, 10 μL of CCK-8 solution was added to each well, and the plate was incubated for an additional 2 h. Absorbance at 450 nm was then measured, and cell viability was calculated. The half-maximal inhibitory concentration (IC50) of ZEA was also determined.
C e l l   s u r v i v a l   r a t e % = E x p e r i m e n t a l   g r o u p   O D − B l a n k   g r o u p   O D C o n t r o l   g r o u p   O D − B l a n k   g r o u p   O D × 100 %

2.4. Electron Microscopy Observation

After treatment with ZEA (0 μM, 20 μM) for 24 h, LCs were harvested following digestion with 0.25% trypsin. The cells were centrifuged to remove the supernatant (3 min, 800× g), and 1 mL of 2.5% glutaraldehyde was gently added for fixation at 4 °C for 24 h. Cells were then washed with pre-cooled PBS and dehydrated using graded ethanol solutions, followed by acetone treatment. Subsequently, cells were post-fixed in 1% osmium tetroxide for approximately 2 h. Embed the cell clusters with epoxy resin. During embedding, ensure that the key areas of the sample and the direction of the section are perpendicular. Then, the sections are successively stained with uranyl acetate (for 5 min) and lead citrate (for 15 min). Finally, the ultrastructure of the cells was examined using a transmission electron microscope (TEM) (ZEISS, GeminiSEM 450, Oberkochen, Germany).

2.5. Real-Time Quantitative PCR

After treatment with ZEA (0 μM, 20 μM) for 24 h, LCs were collected, the supernatant discarded, and washed with PBS. Total RNA was extracted from the cells using an RNA extraction kit (Yisen, Shanghai, China). Add 1 mL of lysis buffer LB to lyse the cells, and let it stand at room temperature for 5 min. Then add 0.2 mL of chloroform and perform centrifugation to obtain the supernatant (12,000× g, 4 °C, 10 min). Add 0.5 mL of anhydrous ethanol to the supernatant and mix well. The mixture is filtered through column A1 of RNA adsorption, and then 0.5 mL of protein removal solution PL and 0.5 mL of washing solution are added successively. Finally, 50 μL of RNase-free H2O is added. Centrifuge at 12,000× g for 1 min to obtain the RNA solution. RNA concentration was measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). First-strand cDNA was synthesized using the RevertAid First-Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). qRT-PCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) in a 10 µL reaction volume on a C1000 Touch Thermal Cycler (Thermo Fisher Scientific, Waltham, MA, USA). Each group included three biological replicates. Cycling conditions were: initial denaturation at 95 °C for 5 min, followed by 34 cycles of 95 °C for 30 s, annealing at 60 °C for 60 s, and extension at 72 °C for 60 s. β-actin was used as the reference gene, and relative gene expression was calculated using the 2−ΔΔCt method. Primer sequences for the target and reference genes are listed in Table 1.

2.6. Cells Healing Ability Test

LCs were treated with ZEA (0 μM, 20 μM) for 24 h. When cell confluence reached approximately 90%, a straight scratch was made in each well using a 10 µL pipette tip. Cells were then washed with PBS to remove debris, and 10% complete culture medium was added. Cell migration and wound closure were observed and photographed under a microscope 18 h later.
C e l l   m i g r a t i o n   r a t e % = I n i t i a l   a r e a − K e y   a r e a I n i t i a l   a r e a × 100 %

2.7. Assessment of Mitochondrial Membrane Potential Using JC-1 Assay

After treatment with ZEA (0 μM, 20 μM) for 24 h, LCs were washed twice with PBS and 1 mL of culture medium was added. Subsequently, 1 mL of JC-1 working solution was added, and the cells were gently mixed and incubated in the dark in a cell culture incubator for 20 min. The plate was gently shaken every 10 min to ensure even distribution of the probe. After incubation, the supernatant was removed, and the cells were washed twice with 1 × JC-1 staining buffer. Fluorescence images were then captured using a fluorescence microscope (Nikon Eclpse Ti5, Tokyo, Japan).
M e m b r a n e   p o t e n t i a l   l e v e l = R e d   f l u o r e s c e n c e   i n t e n s i t y G r e e n   f l u o r e s c e n c e   i n t e n s i t y

2.8. Flow Cytometric Cycle Assay

After treatment with ZEA (0 μM, 20 μM) for 24 h, LCs were digested with 0.25% trypsin and collected. The cells were centrifuged to remove the supernatant (3 min, 800× g), washed with PBS, and centrifuged again. The cell pellet was then fixed overnight at 4 °C in 2 mL of 70% ethanol. Centrifugation at 800× g for 5 min to remove the supernatant, cells were washed with PBS and the supernatant discarded, 500 μL of PI staining solution was added, gently blown and the cells were mixed, incubated at 37 °C in the dark for 30 min (Servicebio, Wuhan, China). Cell cycle distribution was measured using a flow cytometer (CytoFLEX, Beckman, Brea, CA, USA).

2.9. Targeted Metabolomics Analysis

LCs were treated with ZEA (0 μM, 20 μM) for 24 h and collected. For each 200 μL LC sample, 20 μL extraction solvent A, 200 μL methanol, and 200 μL ultrapure water were added, thoroughly mixed, and centrifuged. A 450 μL aliquot of the supernatant was applied to an activated SPE plate. Sequential washes were performed with 200 μL extraction solvent B and 200 μL n-hexane, followed by elution of the target compounds using 60 μL extraction solvent C. All eluates were collected in a 96-well plate, and 75 μL ultrapure water was added to each well. Samples were mixed and loaded into an autosampler for analysis. HPLC Conditions: Samples were separated using an ultra-high-performance liquid chromatography (UHPLC) system. The mobile phase consisted of solvent A (ammonium fluoride in water) and solvent B (methanol). Samples were maintained at 4 °C in the autosampler, with the column temperature set to 40 °C, a flow rate of 100 μL/s, and an injection volume of 25 μL. The mobile phase gradient was 45–95–45% B over 15 min. Low-, medium-, and high-concentration quality control (QC) samples were included to ensure system stability and reproducibility. MS Parameters: Mass spectrometric analysis was conducted in both positive and negative ion modes using an ESI source. Source temperature was set to 600 °C; Gas1 and Gas2 at 60 psi; curtain gas (CUR) at 35 psi; and ion spray voltage (ISVF) at −4500 V for negative ions and 5500 V for positive ions. Target ions were detected using multiple reaction monitoring (MRM) mode.

2.10. Untargeted Metabolomics Analysis

Cell samples were mixed with pre-cooled methanol/acetonitrile/water (2:2:1, v/v/v), vortexed, and subjected to low-temperature sonication for 30 min. After incubation at −20 °C for 10 min, the samples were centrifuged, and the supernatant was vacuum-dried. The dried residue was reconstituted in 100 μL acetonitrile/water (1:1, v/v), vortexed thoroughly, centrifuged, and the resulting supernatant was subjected to mass spectrometry analysis. UPLC Conditions: Separation was performed on a column maintained at 25 °C, with a flow rate of 500 μL/min and an injection volume of 2 μL. The mobile phase consisted of solvent A (water containing 25 mM ammonium acetate and 25 mM ammonia) and solvent B (acetonitrile). The gradient program was as follows: 0–30 s, 95% B; 30 s–7 min, 95–65% B; 7–8 min, 65–40% B; 8–9 min, 40% B; 9–9.1 min, 40–95% B; 9.1–12 min, 95% B. Samples were stored at 4 °C and injected in a randomized order to minimize signal variability. MS Conditions: Both MS1 and MS2 spectra were acquired in positive and negative electrospray ionization (ESI) modes. ESI source parameters were: source temperature 600 °C, Gas1 and Gas2 at 60 psi, curtain gas (CUR) 30 psi, and ion spray voltage (ISVF) ±5500 V. MS acquisition parameters were: MS1 scan range m/z 60–1000 (0.20 s per spectrum) and MS2 scan range m/z 25–1000 (0.05 s per spectrum). MS2 spectra were obtained using information-dependent acquisition (IDA) in high-sensitivity mode, with a declustering potential (DP) of ±60 V and collision energy of 35 ± 15 eV. IDA settings included exclusion of 4 Da isotopes and monitoring of 10 ions per cycle.

2.11. Statistical Analysis

Between-group comparisons were performed using SPSS 21.0 software (SPSS, Inc., Chicago, IL, USA), with one-way ANOVA followed by the least significant difference (LSD) post hoc test or independent samples t-test and further validated the results using Tukey’s honestly significant difference (HSD) test. Data are shown as mean ± SD from three independent experiments, each performed in technical triplicate (n = 3). Differences between the two groups are indicated by * for p < 0.05 (relative to the untreated cells) and ** for p < 0.01 (relative to the untreated cells).

3. Results

3.1. Cell Purity Identification

The purity of LCs was evaluated using an indirect immunofluorescence method. The results indicated that LCs emitted green fluorescence when bound to the secondary antibody (Goat anti-Rabbit IgG (H + L), Alexa Fluor 488), while unbound cells exhibited no fluorescence (Figure 1). The complete overlap of cytoplasmic and nuclear staining confirmed the identity of the cells as LCs.

3.2. Effects of ZEA on LCs Viability

Treatment of LCs with increasing concentrations of zearalenone (ZEA) resulted in a dose-dependent reduction in cell viability (Figure 2A). Compared with the control group (0 μM ZEA), all ZEA-treated groups showed a significant decrease in viability. Specifically, 10 μM ZEA caused a highly significant reduction (p < 0.01), 20 μM ZEA decreased viability by approximately 50%, and 30 μM ZEA led to near-complete cell death. The half-maximal inhibitory concentration (IC50) of ZEA was estimated to be 20 μM, which was subsequently used for further experiments.

3.3. Effects of ZEA on mRNA Expression of Genes Related to LCs

qRT-PCR was conducted to assess the mRNA expression levels of apoptosis-related genes (Bcl-2, Bax, and Caspase3) and key genes involved in testosterone biosynthesis (StAR, CYP17A1, CYP11A1, and 17β-HSD) in control and ZEA-treated groups. Compared with the control group, ZEA treatment significantly increased the mRNA expression of Bcl-2, Bax, and Caspase3 (p < 0.05) (Figure 2B). In contrast, the mRNA levels of StAR and CYP17A1 were significantly decreased (p < 0.05), whereas 17β-HSD mRNA expression was significantly increased (p < 0.05). No significant change was observed in CYP11A1 mRNA expression (Figure 2C). These results indicate that ZEA treatment promotes the expression of apoptosis-related genes in LCs and disrupts the expression of key components in the testosterone biosynthesis pathway, ultimately impairing testosterone production.

3.4. ZEA Affects the Ultrastructure of the LCs in Goats

In the control group, cells displayed a plump morphology with intact plasma membranes and well-defined nuclear envelopes. Mitochondrial cristae were neatly arranged, with no evidence of disorganization, swelling, or rupture. The mitochondrial structure remained stable, the endoplasmic reticulum (ER) was continuous without fragmentation, and chromatin was uniformly distributed. Owing to rapid cell proliferation and adherence, a few autophagosomes were occasionally observed. In contrast, ZEA-treated LCs exhibited pronounced organelle damage, including ER fragmentation, indistinct structural features, severe mitochondrial vacuolization, formation of autophagic vesicles, and chromatin condensation (Figure 2D).

3.5. ZEA Impairs the Wound-Healing Ability of LCs

The scratch assay results showed that cell migration was significantly inhibited (Figure 3). At 0 h, the scratch widths were similar between the control and ZEA-treated groups. After 12 h of incubation, control cells had nearly fused, reaching a wound-healing rate of approximately 50%, whereas ZEA-treated cells exhibited only about 20% healing. By 18 h, the control group achieved complete wound closure, while the ZEA group reached a healing rate of about 80% but did not fully close. These findings indicate that ZEA treatment markedly reduces the wound-healing capacity of LCs.

3.6. Effects of ZEA on Mitochondrial Membrane Potential in LCs

JC-1 staining revealed that mitochondria in the control group predominantly exhibited red fluorescence, indicating high polarization and membrane potential. Following ZEA treatment, red fluorescence decreased while green fluorescence increased markedly, indicating mitochondrial depolarization and a reduction in membrane potential (Figure 4).

3.7. ZEA Affects the Cell Cycle of Goat LCs

Flow cytometric analysis of cell cycle progression in LCs following ZEA treatment revealed (Figure 5). In the control group, 82.48% of cells were in G1 phase, 12.15% in S phase and 5.37% in G2 phase. After ZEA exposure, the proportions of cells in G1 and S phases decreased significantly (p < 0.05) to 11.13% and 5.58%, respectively, while the G2 phase population increased markedly (p < 0.05) to 82.39%. These results indicate that ZEA disrupts cell cycle progression in LCs, inducing cell cycle arrest at the G2 phase.

3.8. Targeted Metabolomics Study of ZEA Effects on Goat LCs

The total ion chromatograms (TICs) of steroid metabolite standards showed well-resolved peaks with sharp and symmetrical shapes, indicating that the method is suitable for the quantitative analysis of various steroid hormones (Figure 6). ZEA treatment altered the secretion levels of steroid hormones in goat LCs. Compared with the control group, treatment with ZEA (20 μM, 24 h) significantly increased the levels of 17α-hydroxyprogesterone, corticosterone, progesterone, 21-hydroxyprogesterone, androstenedione, and cortisone (p < 0.05). Aldosterone levels also increased, although the difference was not statistically significant. In contrast, dihydrotestosterone levels were significantly reduced (p < 0.05), while estradiol levels showed a slight but non-significant decrease (Table 2). These results indicate that ZEA disrupts steroid hormone metabolism in goat LCs.

3.9. Untargeted Metabolomic Investigation of ZEA Effects on Goat LCs

The TICs of QC samples showed overlapping peak response intensities and retention times, with well-resolved, sharp peaks, indicating stable instrument performance and minimal technical variation (Figure 7A,B). A total of 1005 metabolites were detected, including 627 in positive ion mode (ESI-) and 378 in negative ion mode (ESI-). Chemical classification analysis revealed that carboxylic acids and their derivatives accounted for the largest proportion (23.48%), followed by glycerophospholipids (12.14%), fatty acyls (7.66%), and unknown metabolites (10.85%) (Figure 7C). PCA results demonstrated good sample distribution and strong model performance (R2X > 0.75, PC1 + PC2 + PC3 > 75.3%) (Figure 8). OPLS-DA further highlighted intergroup differences, and seven-fold cross-validation confirmed model reliability (R2 > 0.5, Q2 > 0.8) (Figure 9). Using VIP > 1 and p < 0.05 as selection criteria, 52 significantly altered metabolites were identified, including 35 in positive ion mode (17 upregulated and 18 downregulated) and 17 in negative ion mode (15 upregulated and 2 downregulated) (Table 3, the top 20 differential metabolites are presented; Table 4). Hierarchical clustering analysis revealed clear group-specific clustering patterns for differential metabolites in both ion modes (Figure 10). KEGG pathway enrichment identified 26 significantly perturbed pathways, primarily involving nicotine metabolism, choline metabolism, glycerophospholipid metabolism, and neurotransmitter vesicle cycling (Figure 11), suggesting that these metabolic networks may participate in the cellular response to ZEA.

4. Discussion

The goat industry represents a vital component of animal husbandry, and the reproductive capacity of high-quality male breeding stock plays a crucial role in livestock production. Zearalenone, a non-steroidal mycotoxin widely present in animal feed, exhibits reproductive toxicity. Previous studies have demonstrated that ZEA can induce testicular and seminiferous tubule abnormalities, reduce sperm motility, and decrease testosterone secretion [28,29]. LCs are key reproductive cells involved in spermatogenesis and serve as the primary site of steroid hormone synthesis in male animals [30,31]; thus, any toxic effects on LCs may disrupt the spermatogenic process.
Studies have reported that the toxic effects of ZEA are both time- and dose-dependent; apoptosis rates in porcine intestinal epithelial cells (IECs) and goat granulosa cells (GCs) increase significantly with higher ZEA concentrations and prolonged exposure [21,32]. Apoptosis, as a characteristic form of programmed cell death, is critical for male reproductive function. In the present study, ZEA induced dose-dependent death in goat LCs, with a half-maximal inhibitory concentration (IC50) of 20 μM, which was subsequently used to explore ZEA-induced male reproductive toxicity. Previous research has shown that ZEA triggers apoptosis via endoplasmic reticulum (ER) stress pathways, upregulating Caspase-3 and Caspase-9 expression and increasing the Bax/Bcl-2 ratio; these cytotoxic effects can be attenuated by the ER stress inhibitor 4-phenylbutyric acid (4-PBA) in embryonic stem cells (ESCs) [19]. Xu et al. [33] reported that ZEA elevates reactive oxygen species (ROS) and cleaved poly ADP-ribose polymerase (PARP) in mouse Sertoli cells, thereby inducing oxidative stress and apoptosis. Consistently, in this study, ZEA treatment increased the expression of Bcl-2 and Caspase-3, and significantly upregulated Bax in goat LCs, indicating that ZEA induces apoptosis in testicular interstitial cells, in agreement with previous findings. Furthermore, decrease in mitochondrial membrane potential is an early hallmark of apoptosis. Xu et al. [34] demonstrated that treatment with 20 μM ZEA for 24 h significantly reduced mitochondrial membrane potential in mouse Sertoli cells, which aligns with the results observed here, suggesting that male reproductive cells across species exhibit conserved responses to ZEA toxicity. Additionally, cell cycle analysis and scratch assay results further confirmed the cytotoxic effects of ZEA on goat LCs.
Testosterone produced by LCs constitutes the primary source of androgens, which, as classical steroid hormones, play essential physiological roles [35]. Zearalenone and its derivatives have been reported to disrupt steroid hormone biosynthesis and alter the expression of key steroidogenic pathway components [36,37]. Steroidogenic acute regulatory protein (StAR), the rate-limiting enzyme in steroidogenesis, is inhibited by high ZEA concentrations in LCs, whereas low concentrations may enhance its expression [38]. In this study, ZEA (20 μM) significantly reduced StAR expression in goat LCs. CYP17A1, CYP11A1, and 17β-HSD are critical genes in the steroidogenic pathway, and changes in their expression can perturb hormone metabolism [39]. ZEA significantly downregulated CYP17A1, while CYP11A1 levels remained unchanged; given its mitochondrial localization, CYP11A1 stability may be associated with ZEA-induced mitochondrial damage. Notably, 17β-HSD expression was markedly upregulated. Targeted metabolomics of 18 steroid hormones revealed that ZEA significantly increased 17α-hydroxyprogesterone and corticosterone, markedly elevated progesterone, 21-hydroxyprogesterone, androstenedione, and cortisone, and significantly decreased dihydrotestosterone, with other hormones unchanged. Considering the interconversion of androstenedione and testosterone catalyzed by 17β-HSD, its upregulation may correlate with elevated androstenedione levels. Collectively, these results indicate that ZEA disrupts both the expression of key steroidogenic genes in goat LCs and steroid hormone synthesis. Given the pathway’s complexity and ZEA’s unique estrogenic activity, further studies are warranted to elucidate the molecular mechanisms underlying these hormonal alterations.
Previous studies have demonstrated that ZEA can induce metabolic disorders by disrupting lactate secretion, lipid synthesis, and other metabolic processes, thereby compromising systemic homeostasis [40,41]. We hypothesize that ZEA similarly affects LCs metabolism. Using untargeted metabolomics and an OPLS-DA model, this study identified 52 significantly altered metabolites, including 6-aminopenicillanic acid, short-chain acylcarnitines, and glycerophospholipids, mainly classified as carboxylic acids and derivatives, glycerophospholipids, and amino acids and derivatives. Pathway enrichment analysis indicated that ZEA primarily perturbs choline metabolism, glycerophospholipid metabolism, and neurotransmitter vesicle cycling in LCs. Glycerophospholipids, as key lipid metabolites, are essential for endocrine homeostasis, and their dysregulation can disrupt cellular physiology [42,43]. We observed that ZEA exposure significantly altered the levels of several glycerophospholipids, including phosphatidylcholine (PC) and phosphatidylethanolamine (PE). Because phospholipids are fundamental components of cellular membranes, their metabolic disturbances can affect the localization and activity of steroidogenic enzymes, thereby impairing the synthesis of steroid hormones such as testosterone [44,45].
This study further revealed significant alterations in multiple amino acid metabolites. Amino acids serve not only as the building blocks for protein synthesis but also participate in physiological processes such as signal transduction, carbohydrate and lipid metabolism, and apoptosis [46]. In particular, glutamate, citrulline, and D-aspartate were upregulated, suggesting that ZEA may disrupt the glutamine–glutamate cycle, potentially inducing neurotoxicity and apoptosis. Long et al. [47] reported that oral ZEA administration in male mice significantly increased alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities, resulting in suppressed hormone synthesis. KEGG enrichment of neurotransmitter vesicle metabolism supports this mechanism, as glutamate is involved in vesicle release, and its disruption may impair the endocrine function of LCs. Reduced lactate levels indicate that ZEA inhibits glycolysis, leading to decreased ATP production and compromised steroidogenesis. Similarly, in a rat Sertoli cell model, ZEA decreased lactate and pyruvate production and suppressed the expression of glycolytic genes and lactate-producing proteins [48]. KEGG pathway analysis also revealed prominent perturbations in choline metabolism and neurotransmitter vesicle cycling. Choline metabolism is closely linked to phospholipid biosynthesis and acetylcholine production, whereas disruption of neurotransmitter vesicle pathways suggests that ZEA may indirectly impair reproductive function via neuroendocrine mechanisms, consistent with observations in pigs and rats [49,50,51]. Collectively, these findings indicate that ZEA exerts toxic effects on goat LCs by disrupting metabolic pathways and impairing steroid hormone synthesis, corroborating the observed structural damage and hormonal alterations.

5. Conclusions

This study employed goat LCs as the experimental model. The results demonstrated that ZEA induces morphological alterations in LCs and damages subcellular structures, including mitochondria and the endoplasmic reticulum. ZEA also decreases mitochondrial membrane potential, arrests the cell cycle, and exerts cytotoxic effects by inducing oxidative stress, disrupting metabolic homeostasis, and impairing steroid hormone synthesis. Collectively, the above results all confirm that ZEA has multiple harmful effects on the reproductive cells of male goats.
However, this study only investigated the toxic effects of ZEA at the cellular level and did not conduct research at the animal level. In the future, research on ZEA in animals can be carried out, in addition, based on this study, economically effective natural antagonists of ZEA can be discovered to counteract its toxic effects.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani16020283/s1.

Author Contributions

Conceptualization, C.N. and Y.Y.; methodology, J.S.; software, Y.Z.; validation, H.X., Y.Y. and W.W.; formal analysis, C.N.; investigation, J.S.; resources, Y.Y.; data curation, Y.Z.; writing-original draft preparation, C.N.; writing-review and editing, J.S.; visualization, Y.Z.; supervision, H.X.; project administration, W.W.; funding acquisition, Y.Y. All authors have read and agreed to the published version of the manuscript.

Funding

The authors declare financial support was received for the research, authorship, and/or publication of this article. This research was funded by the Natural Science Foundation of China (No. 32002205 and 32260846), the Basic Research Program of Guizhou Provincial (No. QHKJC[2020]1Z028), the Science and Technology Project of Guizhou Province (No. QHKZC[2021]154), the Fund Project of Guizhou University (Guiyang, China; Grant No. GDRJCHZ[2020]73), and the National Ethnic Affairs Commission Key Open Laboratory of Traditional Chinese Veterinary Medicine (No. GJMWZSYZDSYS[2022]10).

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Ethics Committee of Guizhou University (protocol code EAE-GZU-2020-T064, 14 August 2020).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the articles as Supplementary Material. Further inquiries can be directed to the corresponding author.

Acknowledgments

The authors would like to thank all the reviewers who participated in the review and all the researchers helped in the process of writing this manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Gerald, T.; Raj, G. Testosterone and the androgen receptor. Urol. Clin. N. Am. 2022, 49, 603–614. [Google Scholar] [CrossRef] [Scilit]
  2. Sato, Y.; Garcia, T.M.S.; Low, J.S.; Bauer, C.M. Baseline testosterone levels peak during the inactive period in male degus (Octodon degus). Integr. Org. Biol. 2025, 7, obaf033. [Google Scholar] [CrossRef] [Scilit]
  3. Diala, E.D.; Arlt, W.; Merke, D.P. Congenital adrenal hyperplasia. Lancet 2017, 390, 2194–2210. [Google Scholar] [CrossRef] [Scilit]
  4. Auer, M.K.; Nordenström, A.; Lajic, S.; Reisch, N. Congenital adrenal hyperplasia. Lancet 2023, 401, 227–244. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Balló, A.; Busznyákné, S.K.; Czétány, P.; Márk, L.; Török, A.; Szántó, Á.; Máté, G. Estrogenic and non-estrogenic disruptor effect of zearalenone on Male reproduction: A review. Int. J. Mol. Sci. 2023, 24, 1578. [Google Scholar] [CrossRef] [Scilit]
  6. Bai, J.; Zhou, Y.; Luo, X.; Hai, J.; Si, X.; Li, J.; Fu, H.; Dai, Z.; Yang, Y.; Wu, Z. Roles of stress response-related signaling and its contribution to the toxicity of zearalenone in mammals. Compr. Rev. Food Sci. Food Saf. 2022, 21, 3326–3345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Abassi, H.; Ayed-Boussema, I.; Shirley, S.; Abid, S.; Bacha, H.; Micheau, O. The mycotoxin zearalenone enhances cell proliferation, colony formation and promotes cell migration in the human colon carcinoma cell line HCT116. Toxicol. Lett. 2016, 254, 1–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Zhang, R.-Q.; Sun, X.-F.; Wu, R.-Y.; Cheng, S.-F.; Zhang, G.-L.; Zhai, Q.-Y.; Liu, X.-L.; Zhao, Y.; Shen, W.; Li, L. Zearalenone exposure elevated the expression of tumorigenesis genes in mouse ovarian granulosa cells. Toxicol. Appl. Pharmacol. 2018, 356, 191–203. [Google Scholar] [CrossRef] [Scilit]
  9. Gao, D.; Cao, X.; Ren, H.; Wu, L.; Yan, Y.; Hua, R.; Xing, W.; Lei, M.; Liu, J. Immunotoxicity and uterine transcriptome analysis of the effect of zearalenone (ZEA) in sows during the embryo attachment period. Toxicol. Lett. 2022, 357, 33–42. [Google Scholar] [CrossRef] [Scilit]
  10. Chen, X.; Yang, C.; Huang, L.; Niu, Q.; Jiang, S.; Chi, F. Zearalenone Altered the Serum Hormones, Morphologic and Apoptotic Measurements of Genital Organs in Post-weaning Gilts. Asian-Australas. J. Anim. Sci. 2015, 28, 171–179. [Google Scholar] [CrossRef] [Scilit]
  11. Li, X.; Tian, Y.; Zuo, N.; Tang, J.; Cheng, S.; Li, L.; Tan, J.; Zhang, J.; Shen, W. Cyanidin-3-O-glucoside protects Zearalenone-induced in vitro maturation disorders of porcine oocytes by alleviating NOX4-dependent oxidative stress and endoplasmic reticulum stress in cumulus cells. Chemosphere 2024, 358, 142153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Rai, A.; Das, M.; Tripathi, A. Occurrence and toxicity of a fusarium mycotoxin, zearalenone. Crit. Rev. Food Sci. Nutr. 2020, 60, 2710–2729. [Google Scholar] [CrossRef] [Scilit]
  13. Tatay, E.; Espín, S.; García-Fernández, A.J.; Ruiz, M.J. Estrogenic activity of zearalenone, α-zearalenol and β-zearalenol assessed using the E-screen assay in MCF-7 cells. Toxicol. Mech. Methods 2018, 28, 239–242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Kovalsky Paris, M.P.; Schweiger, W.; Hametner, C.; Stückler, R.; Muehlbauer, G.J.; Varga, E.; Krska, R.; Berthiller, F.; Adam, G. Zearalenone-16-O-glucoside: A new masked mycotoxin. J. Agric. Food Chem. 2014, 62, 1181–1189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Jiang, S.Z.; Yang, Z.B.; Yang, W.R.; Gao, J.; Liu, F.X.; Broomhead, J.; Chi, F. Effects of purified zearalenone on growth performance, organ size, serum metabolites, and oxidative stress in postweaning gilts. J. Anim. Sci. 2011, 89, 3008–3015. [Google Scholar] [CrossRef] [Scilit]
  16. Zhou, J.; Zhao, L.; Huang, S.; Liu, Q.; Ao, X.; Lei, Y.; Ji, C.; Ma, Q. Zearalenone toxicosis on reproduction as estrogen receptor selective modulator and alleviation of zearalenone biodegradative agent in pregnant sows. J. Anim. Sci. Biotechnol. 2022, 13, 36. [Google Scholar] [CrossRef] [Scilit]
  17. Kordić, B.; Pribićević, S.; Muntanola-Cvetković, M.; Nikolić, P.; Nikolić, B. Experimental study of the effects of known quantities of zearalenone on swine reproduction. J. Environ. Pathol. Toxicol. Oncol. 1992, 11, 53–55. [Google Scholar]
  18. Althali, N.J.; Hassan, A.M.; Abdel-Wahhab, M.A. Effect of grape seed extract on maternal toxicity and in utero development in mice treated with zearalenone. Environ. Sci. Pollut. Res. Int. 2019, 26, 5990–5999. [Google Scholar] [CrossRef] [Scilit]
  19. Zhao, J.; Hai, S.; Chen, J.; Ma, L.; Rahman, S.U.; Zhao, C.; Feng, S.; Li, Y.; Wu, J.; Wang, X. Zearalenone Induces Apoptosis in Porcine Endometrial Stromal Cells through JNK Signaling Pathway Based on Endoplasmic Reticulum Stress. Toxins 2022, 14, 758. [Google Scholar] [CrossRef] [Scilit]
  20. Xie, H.; Wang, H.; Li, X.; Ji, H.; Xu, Y. ZEA exerts toxic effects on reproduction and development by mediating Dio3os in mouse endometrial stromal cells. J. Biochem. Mol. Toxicol. 2019, 33, e22310. [Google Scholar] [CrossRef] [Scilit]
  21. Liu, L.; Ma, J.; Wei, Z.; Yang, Y.; Li, D.; Wan, Y. Effects of Zearalenone on Apoptosis and Copper Accumulation of Goat Granulosa Cells In Vitro. Biology 2023, 12, 100. [Google Scholar] [CrossRef] [Scilit]
  22. Long, M.; Yang, S.; Zhang, Y.; Li, P.; Han, J.; Dong, S.; Chen, X.; He, J. Proanthocyanidin protects against acute zearalenone-induced testicular oxidative damage in male mice. Environ. Sci. Pollut. Res. Int. 2017, 24, 938–946. [Google Scholar] [CrossRef] [Scilit]
  23. Lin, X.; Zhu, L.; Gao, X.; Kong, L.; Huang, Y.; Zhao, H.; Chen, Y.; Wen, L.; Li, R.; Wu, J.; et al. Ameliorative effect of betulinic acid against zearalenone exposure triggers testicular dysfunction and oxidative stress in mice via p38/ERK MAPK inhibition and Nrf2-mediated antioxidant defense activation. Ecotoxicol. Environ. Saf. 2022, 238, 113561. [Google Scholar] [CrossRef] [Scilit]
  24. Boeira, S.P.; Funck, V.R.; Filho, C.B.; Del’fabbro, L.; de Gomes, M.G.; Donato, F.; Royes, L.F.F.; Oliveira, M.S.; Jesse, C.R.; Furian, A.F. Lycopene protects against acute zearalenone-induced oxidative, endocrine, inflammatory and reproductive damages in male mice. Chem. Biol. Interact. 2015, 230, 50–57. [Google Scholar] [CrossRef] [Scilit]
  25. Yan, R.; Wang, H.; Zhu, J.; Wang, T.; Nepovimova, E.; Long, M.; Li, P.; Kuca, K.; Wu, W. Procyanidins inhibit zearalenone-induced apoptosis and oxidative stress of porcine testis cells through activation of Nrf2 signaling pathway. Food Chem. Toxicol. 2022, 165, 113061. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Liu, X.; Xi, H.; Han, S.; Zhang, H.; Hu, J. Zearalenone induces oxidative stress and autophagy in goat Sertoli cells. Ecotoxicol. Environ. Saf. 2023, 252, 114571. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Zhou, Y.; Zhang, D.; Sun, D.; Cui, S. Zearalenone affects reproductive functions of male offspring via transgenerational cytotoxicity on spermatogonia in mouse. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2020, 234, 108766. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Adibnia, E.; Razi, M.; Malekinejad, H. Zearalenone and 17 β-estradiol induced damages in male rats reproduction potential: Evidence for ERα and ERβ receptors expression and steroidogenesis. Toxicon 2016, 120, 133–146. [Google Scholar] [CrossRef] [Scilit]
  29. Yousef, M.S.; Rezk, W.R.; El-Naby, A.-S.A.-H.; Mahmoud, K.G.; Takagi, M.; Miyamoto, A.; Megahed, G.A. In vitro effect of zearalenone on sperm parameters, oocyte maturation and embryonic development in buffalo. Reprod. Biol. 2023, 23, 100732. [Google Scholar] [CrossRef] [Scilit]
  30. Wang, X.; Pan, L.; Zou, Z.; Wang, D.; Lu, Y.; Dong, Z.; Zhu, L. Hypoxia reduces testosterone synthesis in mouse Leydig cells by inhibiting NRF1-activated StAR expression. Oncotarget 2017, 8, 16401–16413. [Google Scholar] [CrossRef] [Scilit]
  31. Brown, P.R.; Estermann, M.A.; Gruzdev, A.; Scott, G.J.; Hagler, T.B.; Ray, M.K.; Yao, H.H.-C. Generation of a Nr2f2-driven inducible Cre mouse to target interstitial cells in the reproductive system. Biol. Reprod. 2025, 113, 220–230. [Google Scholar] [CrossRef] [Scilit]
  32. Cheng, Q.; Jiang, S.; Huang, L.; Wang, Y.; Yang, W. Zearalenone exposure affects the Keap1-Nrf2 signaling pathway and glucose nutrient absorption related genes of porcine jejunal epithelial cells. Toxins 2022, 14, 793. [Google Scholar] [CrossRef] [Scilit]
  33. Xu, W.; Zheng, H.; Fu, Y.; Gu, Y.; Zou, H.; Yuan, Y.; Gu, J.; Liu, Z.; Bian, J. Role of PI3K/Akt-mediated Nrf2/HO-1 signaling pathway in resveratrol aleviation of zearalenone induced oxidative stress and apoptosis in TM4 cells. Toxins 2022, 14, 733. [Google Scholar] [CrossRef] [Scilit]
  34. Xu, R.; Wang, F.; Zhang, Z.; Zhang, Y.; Tang, Y.; Bi, J.; Shi, C.; Wang, D.; Yang, H.; Wang, Z.; et al. Diabetes induced autophagy dysregulation engenders testicular impairment via oxidative stress. Oxid. Med. Cell. Longev. 2023, 3, 4365895. [Google Scholar] [CrossRef] [Scilit]
  35. Yilmaz, B.O.; Aydin, Y. New insights into the mechanisms underlying 5-hydroxymethylfurfural-induced suppression of testosterone biosynthesis in vivo and in vitro. Toxicol. Appl. Pharmacol. 2024, 493, 117142. [Google Scholar] [CrossRef] [Scilit]
  36. Pizzo, F.; Caloni, F.; Schreiber, N.; Cortinovis, C.; Spicer, L. In vitro effects of deoxynivalenol and zearalenone major metabolites alone and combined, on cell proliferation, steroid production and gene expression in bovine small follicle granulosa cells. Toxicon 2016, 109, 70–83. [Google Scholar] [CrossRef] [Scilit]
  37. Wang, D.; Zhang, N.; Peng, Y.; Qi, D. Interaction of zearalenone and soybean isoflavone on the development of reproductive organs, reproductive hormones and estrogen receptor expression in prepubertal gilts. Anim. Reprod. Sci. 2010, 122, 317–323. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Liu, Q.; Wang, Y.; Gu, J.; Yuan, Y.; Liu, X.; Zheng, W.; Huang, Q.; Liu, Z.; Bian, J. Zearalenone inhibits testosterone biosynthesis in mouse Leydig cells via the crosstalk of estrogen receptor signaling and orphan nuclear receptor Nur77 expression. Toxicol. In Vitro 2014, 28, 647–656. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Ding, M.; Han, L.; Miao, J.; Wang, X.; Wang, L.; Pan, L. Estrogen receptor knockdown suggests its role in gonadal development regulation in Manila clam Ruditapes philippinarum. J. Steroid Biochem. Mol. Biol. 2024, 243, 106594. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Yang, D.; Jiang, X.; Sun, J.; Li, X.; Li, X.; Jiao, R.; Peng, Z.; Li, Y.; Bai, W. Toxic effects of zearalenone on gametogenesis and embryonic development: A molecular point of review. Food Chem. Toxicol. 2018, 119, 24–30. [Google Scholar] [CrossRef] [Scilit]
  41. Han, X.; Huangfu, B.; Xu, T.; Huang, K.; He, X. Zearalenone exacerbates lipid metabolism disorders by promoting liver lipid droplet formation and disrupting gut microbiota. Ecotoxicol. Environ. Saf. 2025, 289, 117664. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Elmihi, K.A.; Leonard, K.A.; Nelson, R.; Thiesen, A.; Clugston, R.D.; Jacobs, R.L. The emerging role of ethanolamine phosphate phospholyase in regulating hepatic phosphatidylethanolamine and plasma lipoprotein metabolism in mice. FASEB J. 2024, 38, e70063. [Google Scholar] [CrossRef] [Scilit]
  43. Holdaway, C.M.; Leonard, K.-A.; Nelson, R.; van der Veen, J.; Das, C.; Watts, R.; Clugston, R.D.; Lehner, R.; Jacobs, R.L. Alterations in phosphatidylethanolamine metabolism impacts hepatocellular lipid storage, energy homeostasis, and proliferation. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2025, 1870, 159608. [Google Scholar] [CrossRef] [Scilit]
  44. Zheng, W.; Wang, B.; Si, M.; Zou, H.; Song, R.; Gu, J.; Yuan, Y.; Liu, X.; Zhu, G.; Bai, J.; et al. Zearalenone altered the cytoskeletal structure via ER stress-autophagy-oxidative stress pathway in mouse TM4 Sertoli cells. Sci. Rep. 2018, 8, 3320. [Google Scholar] [CrossRef] [Scilit]
  45. Ma, L.; Chen, C.; Hai, S.; Wang, C.; Rahman, S.U.; Huang, W.; Zhao, C.; Feng, S.; Wang, X. Inhibition of mitochondrial fission alleviates zearalenone-induced mitochondria-associated endoplasmic reticulum membrane dysfunction in piglet sertoli cells. Toxins 2023, 15, 253. [Google Scholar]
  46. Holeček, M. Branched chain amino acids in health and disease: Metabolism, alterations in blood plasma, and as supplements. Nutr. Metab. 2018, 15, 33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Long, M.; Yang, S.; Zhang, W.; Zhang, Y.; Li, P.; Guo, Y.; Wang, Y.; Chen, X.; He, J. The influence of selenium yeast on hematological, biochemical and reproductive hormone level changes in kunming mice following acute exposure to zearalenone. Biol. Trace Elem. Res. 2016, 174, 362–368. [Google Scholar] [CrossRef] [Scilit]
  48. Cai, P.; Feng, N.; Zheng, W.; Zheng, H.; Zou, H.; Yuan, Y.; Liu, X.; Liu, Z.; Gu, J.; Bian, J. Treatment with, resveratrol, a SIRT1 activator, prevents zearalenone-induced lactic acid metabolism disorder in rat sertoli cells. Molecules 2019, 24, 2474. [Google Scholar] [CrossRef] [Scilit]
  49. Yang, R.; Wang, Y.; Zhang, L.; Zhao, Z.; Zhao, J.; Peng, S. Prepubertal exposure to an oestrogenic mycotoxin zearalenone induces central precocious puberty in immature female rats through the mechanism of premature activation of hypothalamic kisspeptin-GPR54 signaling. Mol. Cell Endocrinol. 2016, 437, 62–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Wu, F.; Gao, L.; Li, F.; Cui, J.; Yang, X.; Liu, Y.; Chen, S.; Chen, B. Effects of zearalenone on ovarian development of prepubertal gilts through growth hormone axis. Front. Vet. Sci. 2022, 9, 950063. [Google Scholar]
  51. Gajęcka, M.; Zielonka, Ł.; Babuchowski, A.; Gajęcki, M.T. Exposure to low zearalenone doses and changes in the homeostasis and concentrations of endogenous hormones in selected steroid-sensitive tissues in pre-pubertal gilts. Toxins 2022, 14, 790. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Identification of LCs. Indirect immunofluorescence was used to detect the degree of binding of LCs to anti-Alexa Fluor488 (Green, 1:500, Suzhou, China); nuclei were stained with DAPI (Blue). Note: Bar = 100 μm. n = 3.
Figure 1. Identification of LCs. Indirect immunofluorescence was used to detect the degree of binding of LCs to anti-Alexa Fluor488 (Green, 1:500, Suzhou, China); nuclei were stained with DAPI (Blue). Note: Bar = 100 μm. n = 3.
Animals 16 00283 g001
Figure 2. The effect of ZEA on goat LCs. (A) Viability changes in LCs after treated with increasing concentrations of ZEA. (B) The effect of ZEA on the LCs apoptosis genes; (C) The influence of ZEA on the LCs testosterone synthesis genes; (D) The influence of ZEA on the ultrastructure of LCs (The picture on the right is the enlarged red box in the left picture. The blue arrows indicate the endoplasmic reticulum, and the red arrows indicate the mitochondria). Note: Bars represent mean ± SD (n = 3). CK: Control check; ZEA: Zearalenone. The same below. * for p < 0.05 (relative to the CK) and ** for p < 0.01 (relative to the CK).
Figure 2. The effect of ZEA on goat LCs. (A) Viability changes in LCs after treated with increasing concentrations of ZEA. (B) The effect of ZEA on the LCs apoptosis genes; (C) The influence of ZEA on the LCs testosterone synthesis genes; (D) The influence of ZEA on the ultrastructure of LCs (The picture on the right is the enlarged red box in the left picture. The blue arrows indicate the endoplasmic reticulum, and the red arrows indicate the mitochondria). Note: Bars represent mean ± SD (n = 3). CK: Control check; ZEA: Zearalenone. The same below. * for p < 0.05 (relative to the CK) and ** for p < 0.01 (relative to the CK).
Animals 16 00283 g002
Figure 3. Effect of ZEA treatment on the healing ability of LCs. (A) Representative photomicrographs of the cells and impact on gap width; (B) Cell migration rate. Note: Bar = 100 μm. ** for p < 0.01 (relative to the CK).
Figure 3. Effect of ZEA treatment on the healing ability of LCs. (A) Representative photomicrographs of the cells and impact on gap width; (B) Cell migration rate. Note: Bar = 100 μm. ** for p < 0.01 (relative to the CK).
Animals 16 00283 g003
Figure 4. Effect of ZEA treatment on the mitochondrial membrane potential level of LCs. (A) The luminescence of mitochondrial membrane potential; (B) Membrane potential level (The mitochondrial membrane potential level is represented by the ratio of red to green fluorescence). Note: Bar = 100 μm. Bars represent mean ± SD (n = 3). ** for p < 0.01 (relative to the CK).
Figure 4. Effect of ZEA treatment on the mitochondrial membrane potential level of LCs. (A) The luminescence of mitochondrial membrane potential; (B) Membrane potential level (The mitochondrial membrane potential level is represented by the ratio of red to green fluorescence). Note: Bar = 100 μm. Bars represent mean ± SD (n = 3). ** for p < 0.01 (relative to the CK).
Animals 16 00283 g004
Figure 5. Effect of ZEA on cell cycle progression of LCs. (A) Cell Cycle; (B) Cell cycle ratio. G1: Early stage of DNA synthesis; S: DNA synthesis phase; G2: Late stage of DNA synthesis. Note: Bars represent mean ± SD (n = 3).
Figure 5. Effect of ZEA on cell cycle progression of LCs. (A) Cell Cycle; (B) Cell cycle ratio. G1: Early stage of DNA synthesis; S: DNA synthesis phase; G2: Late stage of DNA synthesis. Note: Bars represent mean ± SD (n = 3).
Animals 16 00283 g005
Figure 6. Total ion chromatograms (TIC) diagram of the steroid standard mixture.
Figure 6. Total ion chromatograms (TIC) diagram of the steroid standard mixture.
Animals 16 00283 g006
Figure 7. Total ion chromatogram (TIC) and metabolite classification. (A) Positive ion chromatogram; (B) Negative ion chromatogram; (C) Ratio of metabolite quantities. Note: The horizontal axis represents the retention time of each chromatographic peak, while the vertical axis indicates the intensity value of the peak.
Figure 7. Total ion chromatogram (TIC) and metabolite classification. (A) Positive ion chromatogram; (B) Negative ion chromatogram; (C) Ratio of metabolite quantities. Note: The horizontal axis represents the retention time of each chromatographic peak, while the vertical axis indicates the intensity value of the peak.
Animals 16 00283 g007aAnimals 16 00283 g007b
Figure 8. Principal component analysis (PCA) score map of samples.
Figure 8. Principal component analysis (PCA) score map of samples.
Animals 16 00283 g008
Figure 9. Orthogonal partial least squares discriminant analysis (OPLS-DA) score map.
Figure 9. Orthogonal partial least squares discriminant analysis (OPLS-DA) score map.
Animals 16 00283 g009
Figure 10. Heat map clustering of significant metabolite on positive and negative ion modes. (A) Positive ion heatmap; (B) Negative ion heatmap.
Figure 10. Heat map clustering of significant metabolite on positive and negative ion modes. (A) Positive ion heatmap; (B) Negative ion heatmap.
Animals 16 00283 g010
Figure 11. KEGG enrichment pathway of differential metabolites.
Figure 11. KEGG enrichment pathway of differential metabolites.
Animals 16 00283 g011
Table 1. Primer information.
Table 1. Primer information.
GenePrime SequenceSize (bp)Tm (°C)
Bcl-2F: ATGTGTGTGGAGAGCGTCA
R: AGAGACAGCCAGGAGAAATC
18260
BaxF: CATCGGAGATGAATTGGACAGTAA
R: GGCCTTGAGCACCAGTTTGC
17860
Caspase 3F: CATTATTCAGGCCTGCCGAG
R: CTCGAGCTTGTGAGCGTACT
22058
StARF: GCGACCAAGAGCTTGCCTATATCC
R: CTCTCCTTCTTCCAGCCCTCCTG
9457
CYP17A1F: GGCCCAAGACCAAGCACTC
R: GGAACCCAAACGAAAGGAATAG
16160
CYP11A1F: ATGGCTCCAGAGGCAATAAA
R: AAGGCAAAGTGAAACAGGTC
14656
17β-HSDF: GGCGGTCCTCGTGGTCCTATAC
R: TGGTTCCCGAAGCCTGAGTCAC
11758
β-actinF: CTGAGCGCAAGTACTCCGTGT
R: GCATTTGCGGTGGACGAT
12560
Note: F stands for upstream primer, and R stands for downstream primer.
Table 2. Effect of ZEA on steroid hormone content.
Table 2. Effect of ZEA on steroid hormone content.
NameStandard Curve EquationCKZEASEMp
17α-Hydroxyprogesterone (pg/mL)y = 0.9x − 0.0003962.53 b5.10 a0.0007<0.05
Corticosterone (pg/mL)y = 0.452x − 0.0067619.07 b24.10 a0.0018<0.05
5-α-Dihydrotestosterone (pg/mL)y = 0.246x − 0.0017216.40 a13.27 b0.0005<0.05
Pregnenolone (pg/mL)y = 0.105x − 0.00089510.8711.370.0029>0.05
Progesterone (pg/mL)y = 0.384x − 0.0009544.00 b5.50 a0.0003<0.05
11-Deoxycortisol (pg/mL)y = 0.77x − 0.0003551.572.270.0003>0.05
11-Deoxycorticosterone (pg/mL)y = 0.995x + 0.000390.06 b0.57 a0.0001<0.05
Androstenedione (pg/mL)y = 1.06x + 0.000616.70 b27.20 a0.0014<0.05
Cortisone (pg/mL)y = 0.649x − 0.0003192.81 b4.40 a0.0001<0.05
Testosterone (pg/mL)y = 0.584x + 0.0001572.112.000.0002>0.05
Cortisol (pg/mL)y = 0.465x + 0.0006287.8320.100.0091>0.05
Dehydroepisndrosterone (pg/mL)y = 0.243x + 0.0026434.8540.370.0065>0.05
Estradiol (pg/mL)y = 0.852x − 0.002855.053.730.0006>0.05
Aldosterone (pg/mL)y = 0.271x + 0.001090.00020.00360.0013>0.05
Estriol (pg/mL)y = 0.628x + 0.0005942.462.730.0021>0.05
Estrone (pg/mL)y = 0.663x + 5.210.310.370.00004>0.05
17A-Hydroxypregnenolone (pg/mL)y = 0.256x + 0.001463.431.570.0001>0.05
Dehydroepiandrosterone Sulfate (ng/mL)y = 0.011x − 0.01161.161.170.0065>0.05
Note: Different lowercase letters within a row indicate significant differences among steroid hormone content in goat LCs. (a,b)—significant differences (p < 0.05) relative to the untreated cells.
Table 3. Significant metabolites on positive ion mode.
Table 3. Significant metabolites on positive ion mode.
NumberNameFold ChangepVIP
1(+)-6-aminopenicillanic acid0.840.044.42
2(r)-butyrylcarnitine0.290.003.25
31-(1z-hexadecenyl)-sn-glycero-3-
2-phosphocholine
0.410.031.24
41-(1z-octadecenyl)-2-(9z-octadecenoyl)-
2-sn-glycero-3-phosphocholine (18:0/18:1)
1.260.014.16
51-hexadecanoyl-2-octadecadienoyl-sn-
2-glycero-3-phosphocholine (16:0/16:2)
1.220.005.31
61-hexadecyl-2-(8z,11z,14z-eicosatrienoyl)-sn-glycero-3-phosphocholine (16:0/20:3)1.240.002.93
71-hexadecyl-2-(9z-octadecenoyl)-sn-
2-glycero-3-phosphocholine (16:0/18:1)
1.180.017.22
81-hexadecyl-sn-glycero-3-phosphocholine (O-16:0/0:0)0.360.053.22
91-oleoyl-2-palmitoyl-sn-glycero-3-
2-phosphocholine (18:1/16:0)
0.920.044.71
101-palmitoyl-2-lauroyl-sn-glycero-3-
phosphorylcholine
1.340.001.99
111,2-dihexadecanoyl-sn-glycero-3-
Phosphocholine (16:0/16:0)
0.800.005.33
121,2-dipalmitoleoyl-sn-glycero-3-
Phosphocholine (16:1/16:1)
1.410.002.57
1318-β-glycyrrhetic acid methyl ester0.170.002.25
144-hydroxy-1-(2-hydroxyethyl)-2,2,6,6-
tetramethylpiperidine
0.210.0013.03
157-α-hydroxy-4-cholesten-3-one2.740.002.60
16Acetylcholine0.540.001.43
17Citrulline2.000.051.04
18Diethanolamine0.420.011.75
19Dimethyl phthalate0.600.021.21
20Glutamic acid1.160.001.16
Table 4. Significant metabolites on negative ion mode.
Table 4. Significant metabolites on negative ion mode.
NumberNameFold ChangepVIP
11-palmitoyl-2-linoleoyl-sn-glycero-3-phospho-(1′-rac-glycerol) (16:0/18:2)1.850.001.51
21-stearoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine (18:0/18:2)1.270.011.57
32,4-di-tert-butylphenol1.230.042.43
46-Hydroxydopamine1.450.001.07
5Cis-7,10,13,16-docosatetraenoic acid0.630.021.91
6Cis-9-palmitoleic acid1.480.012.85
7D-aspartic acid2.250.001.06
8Lactate acid0.440.001.97
9Glutamic acid1.300.011.44
10Linoleic acid1.150.011.32
11N-benzyloxycarbonylglycine1.320.032.79
12Pantothenate1.780.003.97
13PC (18:1/9)1.140.031.37
14PG (36:2)2.030.004.82
15PG (36:3)1.620.011.98
16Taurine1.910.011.48
17Zearalenone55.250.004.80
Note: “Name” represents the name of the metabolite; “VIP” represents the variable projection importance. The larger the value, the more important the variable is.; “Fold change” indicates the difference ratio. A fold change greater than 1 indicates an increase, while a fold change less than 1 indicates a decrease.; “p” represents significance analysis. The smaller the “p” value, the more significant the difference.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ning, C.; Sun, J.; Zhao, Y.; Xu, H.; Wu, W.; Yang, Y. Integrated Targeted and Untargeted Metabolomics Reveals the Toxic Mechanisms of Zearalenone in Goat Leydig Cells. Animals 2026, 16, 283. https://doi.org/10.3390/ani16020283

AMA Style

Ning C, Sun J, Zhao Y, Xu H, Wu W, Yang Y. Integrated Targeted and Untargeted Metabolomics Reveals the Toxic Mechanisms of Zearalenone in Goat Leydig Cells. Animals. 2026; 16(2):283. https://doi.org/10.3390/ani16020283

Chicago/Turabian Style

Ning, Chunmei, Jinkui Sun, Ying Zhao, Houqiang Xu, Wenxuan Wu, and Yi Yang. 2026. "Integrated Targeted and Untargeted Metabolomics Reveals the Toxic Mechanisms of Zearalenone in Goat Leydig Cells" Animals 16, no. 2: 283. https://doi.org/10.3390/ani16020283

APA Style

Ning, C., Sun, J., Zhao, Y., Xu, H., Wu, W., & Yang, Y. (2026). Integrated Targeted and Untargeted Metabolomics Reveals the Toxic Mechanisms of Zearalenone in Goat Leydig Cells. Animals, 16(2), 283. https://doi.org/10.3390/ani16020283

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop