Next Article in Journal
Preference of Ligneous Forages by Sheep in South-East Mali
Previous Article in Journal
Maternal Social Hierarchy, Morphometric Traits, Live Weight, and Metabolic Status as Related to the Offspring Pre-Weaning Growth in Crossbred Dairy Goats
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 15
Issue 8
10.3390/ani15081101
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Tissue-Specific Expression of the Porcine DHRS3 Gene and Its Impact on the Proliferation and Differentiation of Myogenic Cells

by
Jifeng Li
1,2,
Yong Ruan
1,2,
Chuanmei Jiang
1,2,
Jinkui Sun
1,2,
Dongwei An
1,2,
Bo Zhou
1,2,
Huan Liu
1,2,
Ziyang Li
1,2 and
Houqiang Xu
1,2,*
1
Key Laboratory of Animal Genetics, Breeding and Reproduction in the Plateau Mountainous Region, Ministry of Education, Guizhou University, Guiyang 550025, China
2
College of Animal Science, Guizhou University, Guiyang 550025, China
*
Author to whom correspondence should be addressed.
Animals 2025, 15(8), 1101; https://doi.org/10.3390/ani15081101
Submission received: 27 March 2025 / Revised: 8 April 2025 / Accepted: 8 April 2025 / Published: 10 April 2025
(This article belongs to the Special Issue Better Fattening Performance, Better Pig Meat Quality)
Browse Figures
Versions Notes

Simple Summary

Dehydrogenase/reductase (SDR) family member 3 (DHRS3) is involved in various metabolic processes in animals. During porcine growth and development, DHRS3 is broadly expressed across multiple tissues, with particularly high levels in the liver and kidneys, suggesting a crucial role in metabolism. Studies on porcine myoblasts indicate that DHRS3 suppresses myoblast proliferation and differentiation but promotes apoptosis, highlighting its potential regulatory function in muscle development and overall growth.

Abstract

The DHRS3 gene, a member of the short-chain dehydrogenase/reductase (SDR) family, is involved in critical metabolic processes in animals. This study investigated the expression patterns of DHRS3 across various tissues of developmental stages in pigs and preliminarily evaluated its effects on myoblast proliferation, apoptosis, and differentiation. RT-qPCR (real-time quantitative PCR) was employed to analyze DHRS3 expression in the heart, liver, spleen, lungs, kidneys, longissimus dorsi, foreleg, and hind leg of pigs at 3 days, 6 months, and 12 months of age. Cell proliferation was analyzed using EdU (5-ethynyl-2′-deoxyuridine) assays, RT-qPCR, and flow cytometry, while the expression changes of proliferation-, apoptosis-, and differentiation-related genes were assessed via RT-qPCR. The results indicated that DHRS3 was expressed in all eight tissues at all three developmental stages. At 3 days, DHRS3 expression was the highest in the kidneys; at 6 months, it peaked in the liver; and at 12 months, it was again the highest in the kidneys. Across all stages, the liver and kidneys exhibited the highest DHRS3 expression levels. Functional studies revealed that DHRS3 overexpression suppressed myoblast proliferation and differentiation while promoting apoptosis. In contrast, DHRS3 inhibition enhanced myoblast proliferation and differentiation and reduced apoptosis. These findings underscore the regulatory role of DHRS3 in myogenesis and provide insights into its metabolic and developmental functions in pigs.

1. Introduction

Skeletal muscle, one of the most abundant tissues in animals, plays a vital role in energy metabolism, locomotion, and respiration. It is also a major determinant of meat yield and quality in livestock and poultry [1,2]. The development and maturation of skeletal muscle constitute a complex biological process where myogenesis critically influences the rate and extent of postnatal muscle growth [3]. Muscle fiber maturation occurs in four stages: myoblast progenitor cells, myoblasts, myotubes, and muscle fibers. The myogenic regulatory factor (MRF) family plays a central role in this process [4,5]. During embryonic development and postnatal growth, myoblasts undergo continuous proliferation and differentiation into myotubes, which subsequently mature into skeletal muscle fibers, forming the functional and structural foundation of skeletal muscle [6].
The short-chain dehydrogenase/reductase (SDR) family constitutes an ancient and extensive group of enzymes that are highly conserved throughout biological evolution and broadly distributed among diverse organisms [7,8,9]. Members of the SDR family share common structural features and play essential roles in various metabolic processes within cells. These processes include carbohydrate, lipid, and steroid metabolism, as well as the maintenance of redox homeostasis—functions closely linked to animal growth, development, and economically significant traits such as reproductive performance [10,11,12]. By facilitating intracellular energy metabolism and biosynthetic pathways, SDR family enzymes exert substantial influence on the development of muscle and skeletal tissues. Their involvement in these critical biological processes highlights the importance of this enzyme family in both fundamental research and practical applications related to animal physiology and productivity [13,14].
Dehydrogenase/reductase SDR family member 3 (DHRS3), also known as Rsdr1 and retSDR1, is a highly conserved member of the short-chain alcohol dehydrogenase/reductase (SDR) superfamily, specifically classified within the SDR16C family. DHRS3 plays a key role in vitamin A (VA) metabolism and regulates various biological processes, including cell proliferation and differentiation [15,16]. In cellular metabolism and redox regulation, DHRS3 has been shown to participate in intracellular redox reactions. It catalyzes the oxidation–reduction reactions of retinol and steroids, thereby contributing to lipid metabolism and maintaining redox homeostasis [17,18]. Furthermore, studies indicate that the DHRS3 gene influences myoblast proliferation and differentiation in mice, implicating its role in tissue development and cellular differentiation [19]. In the context of liver development and hepatocyte function, DHRS3 is expressed in liver tissues where it potentially regulates lipid metabolism and redox balance in hepatocytes. However, the precise molecular mechanisms involved remain unclear and warrant further investigation [20,21].
Skeletal muscle myogenesis is a complex biological process involving distinct stages, including satellite cell activation, myoblast proliferation, and terminal differentiation. This process is regulated by multiple factors [22]. The DHRS3 gene, which encodes a functional protein, is known to modulate various biological processes by regulating gene expression. However, its specific role and underlying mechanisms in porcine skeletal muscle myogenesis remain poorly understood. This study investigates the expression levels of DHRS3 in various porcine tissues and examines its potential effects on the proliferation, differentiation, and apoptosis of porcine skeletal muscle myoblasts at the cellular level. By advancing the theoretical understanding of the regulatory mechanisms involved in porcine muscle growth and development, this research provides a basis for elucidating the role of DHRS3 in muscle proliferation and differentiation.

2. Materials and Methods

2.1. Animal Sample Collection

The experimental animals were obtained from the Guizhou University Breeding Pig Farm. A total of nine Xiangsu hybrid pigs—three each at 3 days, 6 months, and 12 months of age—were randomly selected under identical feeding conditions and slaughtered. After slaughter, tissue samples were collected from the heart, liver, spleen, lungs, kidneys, longissimus dorsi, foreleg, and hind leg. The samples were immediately frozen in liquid nitrogen and subsequently stored at −80 °C in the laboratory for RNA extraction. In addition, longissimus dorsi samples from 3-day-old pigs were promptly transported to the laboratory for the isolation and culture of myoblasts for further experimentation. The use of experimental animals in this study was approved by the Laboratory Animal Ethics of Guizhou University (EAE-GZU-2022-E047).

2.2. RNA Extraction and cDNA Synthesis from Tissue Samples

RNA extraction was conducted using the TRIzol reagent kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. RNA concentration (ng/µL) and OD260/280 ratio were measured with a microvolume UV spectrophotometer (NanoDrop 2000, Thermo Fisher Scientific, USA), and RNA integrity was evaluated using 1% agarose gel electrophoresis. The purified RNA was reverse-transcribed into cDNA using the StarScript III Reverse Transcriptase Kit (Genstar, Beijing, China) following the manufacturer’s instructions. To ensure accuracy and prevent contamination, enzyme-free pipette tips, RNAse-free reagents, and sterilized equipment were utilized throughout the process. All procedures were carried out in a laminar flow hood sterilized with ultraviolet light for 30 min.

2.3. Primer Design, PCR Amplification, and Sequencing

Primers for real-time quantitative PCR were designed based on the mRNA reference sequences of the pig DHRS3 gene, along with genes involved in proliferation, apoptosis, and myogenic differentiation, as provided by the NCBI database. Primer design was performed using Primer Premier 5.0 (Table 1), and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. (Beijing, China) and stored at 4 °C. For PCR amplification, the reaction mixture was prepared in a total volume of 30.0 µL, consisting of 15.0 µL of 2× Hieff® PCR Master Mix, 1.5 µL of each forward and reverse primer, 1.5 µL of cDNA, and 10.5 µL of ddH2O. The PCR program included an initial denaturation step at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 55–62 °C for 30 s, and extension at 72 °C for 30 s. A final extension was performed at 72 °C for 10 min. PCR products were analyzed using 1.5% agarose gel electrophoresis. Finally, the amplified products were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing.

2.4. RT-qPCR

RT-qPCR was conducted according to the instructions provided with the Real-Time Fluorescent Quantitative PCR Kit (StarScript III, Genstar, China), using GAPDH as an internal reference gene to assess the relative expression of target genes. The RT-qPCR reaction mixture (20 µL) consisted of 10 µL of 2× RealStar Fast SYBR RT-qPCR Mix, 3.2 µL of sterile water, 0.2 µL of each forward and reverse primer, and 0.4 µL of cDNA. The PCR cycling program included an initial denaturation at 95 °C for 2 min, followed by 40 cycles consisting of denaturation at 95 °C for 15 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s.

2.5. Isolation, Culture, and Induced Differentiation of Porcine Myoblasts

The longissimus dorsi muscle from 3-day-old pigs was dissected, washed twice with 75% ethanol and PBS containing 10% penicillin/streptomycin, and then minced using scissors. The tissue was subsequently placed in DMEM/F12 (Gibco, San Diego, CA, USA) medium supplemented with 1 mg/mL of type II collagenase for digestion. The digestion was carried out in a shaking incubator at 37 °C for 1 to 1.5 h. After digestion, the reaction was terminated by adding an equal volume of a complete medium. The resulting cell suspension was filtered through 100 µm and 70 µm cell strainers and centrifuged at 1500 rpm for 10 min to collect the cells. The cells were washed twice with PBS containing 1% penicillin/streptomycin and resuspended in a complete medium. The suspension was transferred to culture flasks and incubated at 37 °C in a 5% CO2 incubator. Two hours later, the cells were purified by differential adhesion [23,24]. During myogenic differentiation, once porcine myoblasts reached confluence, they were induced to differentiate in a differentiation medium containing DMEM/F12 and 2% horse serum for 5 days.

2.6. Overexpression Plasmid, shRNA, and Transfection

The coding sequence (CDS) of the pig DHRS3 gene (GenBank: NM_001105617.2) was amplified based on its sequence available in the NCBI database and subsequently inserted into the pEGFP-C1 vector to construct the overexpression plasmid. Multiple pairs of shRNA targeting DHRS3 were designed according to the established design principles and synthesized by GEMA Ltd. (Shanghai, China). The interference efficiency was evaluated by RT-qPCR, with the specific shRNA target sequences provided in Table 2. When the cell confluence in a 6-well plate reached 60–80%, 2.5 μg of plasmid DNA or shRNA was transfected into each well. All transfection procedures were carried out following the manufacturer’s instructions for the Lipofectamine™ 3000 reagent (Thermo Fisher Scientific, Waltham, MA, USA). The medium was replaced 6 h post-transfection.

2.7. EdU Assay

Cells were seeded into a 96-well plate at a density of 6 × 103 cells per well. After 24 h, plasmids were transfected, and 48 h post-transfection, cells were labeled with EdU working solution and incubated for an additional 2 h. Following the protocol provided with the EdU assay kit (Beyotime, Shanghai, China), cells were then observed and imaged using a fluorescence microscope (Thermo Fisher Scientific).

2.8. Flow Cytometry

Following 48 h of transfection, cells were digested with trypsin (Gibco, San Diego, CA, USA) and collected. The cells were then washed twice with PBS by pipetting, and the supernatant was discarded. Next, 1.5 mL of pre-cooled 70% ethanol was added to resuspend the cells, which were then incubated overnight at 4 °C. Fixed cells were centrifuged at 1200 rpm for 5 min, and the supernatant was removed. The cell pellet was resuspended in 2 mL of PBS, followed by centrifugation at 1200 rpm for 5 min and supernatant removal. Cells were then resuspended in 100 μL of RNase A (Beyotime, Shanghai, China) solution. The suspension was incubated in a 37 °C water bath for 30 min. Afterward, 500 μL of propidium iodide (PI) (Beyotime, Shanghai, China) staining solution was added, and the samples were incubated in the dark at 4 °C for 30 min. Finally, cell cycle distribution was analyzed using a flow cytometer (Thermo Fisher Scientific).

2.9. Statistical Analysis

Statistical analysis was conducted using SPSS software (version 25.0). In this study, Levene’s test was conducted to assess the homogeneity of variance, and the Shapiro–Wilk test was also employed to evaluate the normal distribution of the data. Differences between the two groups were assessed using the independent samples t-test, while one-way analysis of variance (ANOVA) was employed for comparisons involving three or more groups. Data are expressed as means ± standard deviation, with a p < 0.05 considered statistically significant. Graphical representations were generated using GraphPad Prism (version 8.0.1).

3. Results

3.1. Tissue-Specific Expression Analysis of DHRS3 in Pigs

The relative expression levels of the DHRS3 gene in tissues from pigs at 3 days, 6 months, and 12 months of age were assessed by RT-qPCR. At 3 days of age, DHRS3 expression was the highest in the kidneys, followed by the liver and lungs, with the lowest expression observed in the longissimus dorsi muscle (Figure 1a). At 6 months, the highest expression was found in the liver, followed by the spleen, while the lowest expression was observed in the hind legs (Figure 1b). At 12 months, DHRS3 expression was again the highest in the kidneys, followed by the liver, with the lowest expression in the hind legs (Figure 1c). Across all age groups, DHRS3 expression was consistently higher in the liver and kidneys, whereas expression in the longissimus dorsi and forelegs increased with age (Figure 1d).

3.2. Transfection Efficiency Assessment

The overexpression efficiency of the DHRS3 gene was evaluated using RT-qPCR, and the most effective shRNA for gene silencing was identified. The results demonstrated that, compared to the control group (pEGFP-C1), the pEGFP-DHRS3 plasmid significantly enhanced DHRS3 gene expression (p < 0.01) (Figure 2a). Among the four interference sequences tested, all markedly reduced DHRS3 expression, with sh1 exhibiting the strongest inhibitory effect, making it the candidate for further experiments (p < 0.001) (Figure 2b).

3.3. DHRS3 Gene Inhibits Proliferation of Porcine Myoblasts

To ascertain the influence of the DHRS3 gene on the development of porcine myoblasts, porcine myoblasts were separately transfected with overexpression and interference plasmids of the DHRS3 gene. Forty-eight hours subsequent to transfection, the impact of the DHRS3 gene on myoblast proliferation was evaluated through 5-ethynyl-2′-deoxyuridine (EdU) incorporation assay and quantitative real-time polymerase chain reaction (RT-qPCR). EdU staining analysis indicated that overexpression of the DHRS3 gene notably decreased the quantity of EdU-positive cells (p < 0.001) (Figure 3a,b). In contrast, interference with the DHRS3 gene significantly augmented the number of EdU-positive cells (p < 0.01) (Figure 3c,d). RT-qPCR analysis demonstrated that transfection with the pEGFP-DHRS3 plasmid significantly suppressed the mRNA levels of proliferating cell nuclear antigen (PCNA), cyclin B1 (CCNB1), cyclin D1 (CCND1), and cyclin-dependent kinase 1 (CDK1) (p < 0.001) (Figure 3e). Conversely, treatment with the sh1 interfering RNA significantly elevated the mRNA levels of PCNA, CCNB1, CCND1, and CDK1 (p < 0.001) (Figure 3f). Flow cytometry was used to examine the cell cycle characteristics of cells transfected with pEGFP-C1, pEGFP-DHRS3, NC (negative control), and sh1 (DHRS3-targeting shRNA). Compared with the pEGFP-C1 group, the pEGFP-DHRS3 group showed a significantly higher proportion of myoblasts arrested in the G1 phase (p < 0.05), while no significant difference in S-phase cell proportion was observed relative to the pEGFP-C1 control (Figure 3g). Conversely, DHRS3 knockdown (sh1) led to the opposite trend: a marked decrease in G1-phase cells and significant increases in G2-and S-phase populations (Figure 3h). These results indicate that DHRS3 knockdown shortens the G1-S transition and promotes cell proliferation, whereas overexpression exerts the opposite effect.

3.4. Effects of the DHRS3 Gene on Apoptosis-Related Genes

To further explore the impact of the DHRS3 gene on apoptosis in porcine myoblasts, reverse-transcription quantitative polymerase chain reaction (RT-qPCR) was carried out. The results indicated that overexpression of the DHRS3 gene significantly upregulated the relative mRNA expression levels of apoptosis-associated markers, namely, BCL2-associated X protein (BAX), Caspase 3, and Caspase 8 (p < 0.001). Concurrently, it downregulated the relative mRNA expression level of the anti-apoptosis gene B-cell lymphoma 2 (BCL2) (p < 0.001) (Figure 4a). Conversely, when the DHRS3 gene was interfered with, the relative mRNA expression level of the apoptosis marker BAX was significantly downregulated (p < 0.05), while that of the anti-apoptosis gene BCL2 was highly upregulated (p < 0.001) (Figure 4b).

3.5. The DHRS3 Gene Affects Myoblast Differentiation

To explore the role of the DHRS3 gene in porcine myoblast differentiation, quantitative real-time polymerase chain reaction (RT-qPCR) experiments were conducted. Porcine myoblasts were transfected with DHRS3 overexpression and suppression plasmids. The results indicated that overexpression of the DHRS3 gene significantly suppressed the mRNA expression levels of myogenin (MYOG), myosin heavy chain 7 (MYH7), and myogenic factor 5 (MYF5) (p < 0.001) (Figure 5a). Conversely, when the DHRS3 gene was inhibited, the mRNA expression levels of MYOG, myosin heavy chain 3 (MYH3), MYH7, and MYF5 were highly significantly upregulated (p < 0.001) (Figure 5b). Upon replacing the growth medium with differentiation medium to induce myoblast differentiation, we found that DHRS3 and MYF5 expression was significantly decreased after 5 days of differentiation (5DM) compared to Day 0 (0DM), whereas MYOG and MYH3 expression was significantly increased (Figure 5c).

4. Discussion

Gene expression in various animal tissues reflects the activity of genes within those tissues, providing insights into their physiological functions across different organs [25]. Regulation of gene expression is integral to metabolic pathways as distinct tissues exhibit unique metabolic profiles. Studying gene expression in metabolically active tissues offers valuable information on the tissue-specific regulation of these pathways. Furthermore, analyzing gene expression at different developmental stages helps uncover the molecular mechanisms involved in tissue differentiation and organ formation. Previous research in rats has shown that DHRS3 is expressed in most tissues, with particularly high levels in the adrenal glands, liver, and ovaries, and moderate levels in the kidneys and lungs. Additionally, other studies have suggested that DHRS3 in the liver affects vitamin A metabolism and inflammatory responses [26]. In our study, we observed high expression of DHRS3 in the liver and kidneys of pigs at various ages, indicating that DHRS3 may play a role in regulating metabolic functions in pigs, which aligns with previous findings.
Muscle formation primarily relies on the proliferation and differentiation of myoblasts. Investigating the proliferation, apoptosis, and differentiation of myoblasts can provide valuable insights into muscle growth and development. To further explore the role of DHRS3 in porcine muscle development, we assessed the effects of DHRS3 overexpression and interference on myoblast proliferation, apoptosis, and differentiation.
PCNA (Proliferating Cell Nuclear Antigen) is a key marker of cell proliferation, as it promotes cell division by participating in DNA replication and repair [27,28]. Cyclins CCNB1, CCND1, and the Ser/Thr kinase family member CDK1 regulate cell proliferation through their roles in the cell cycle [29,30,31]. Specifically, CCNB1 expression increases during the G2 phase where it forms a complex with CDK1 to regulate early mitosis [32]. CCND1 expression is controlled by growth factors and extracellular signals, facilitating the transition from the G1 to the S phase and promoting cell cycle progression [33,34,35]. Previous studies have shown that DHRS3 inhibits cell proliferation and migration in GC cells, induces G1-phase cell cycle arrest, and promotes apoptosis [36]. In a manganese-induced N27 cell apoptosis model, DHRS3 expression was downregulated, while miRNA-nov-1 expression was upregulated [37]. Additionally, studies on Circ_DHRS3 have demonstrated that the knockout of Circ_DHRS3 enhances cell proliferation and suppresses IL-1β-induced chondrocyte apoptosis [38]. Our results from the EdU assay revealed that DHRS3 overexpression significantly reduced the number of proliferating cells, while DHRS3 interference had the opposite effect. Furthermore, overexpression of DHRS3 led to significantly reduced mRNA levels of proliferation-related genes PCNA, CCNB1, CCND1, and CDK1, and a notable increase in the mRNA levels of pro-apoptotic genes BAX, Caspase3, and Caspase8. The mRNA expression of the anti-apoptotic gene BCL2 was significantly decreased, and these effects were reversed following DHRS3 interference. These findings are consistent with previous research, suggesting that DHRS3 inhibits porcine myoblast proliferation and promotes apoptosis.
During myoblast differentiation, the dynamic expression changes of myogenic-specific genes MYOG, MYF5, MYH3, and MYH7 play crucial regulatory roles in reflecting distinct stages of muscle development. MYOG (myogenin), a master regulator of skeletal muscle differentiation, exhibits upregulated expression during early differentiation phase [39]. This elevation activates downstream muscle-specific genes and facilitates the transition from myoblasts to multinucleated myotubes. MYH3 (myosin heavy chain 3), also known as embryonic myosin heavy chain, predominantly expresses during embryogenesis and participates in early myofiber formation [40]. Its expression typically peaks at initial differentiation stages before being gradually replaced by other myosin isoforms. In contrast, MYH7 (β-myosin heavy chain) represents the predominant isoform in adult skeletal and cardiac muscles whose expression progressively increases during late differentiation stages, indicating maturation of muscle fibers [41]. MYF5, as the earliest expressed myogenic regulatory factor (MRF) in skeletal muscle lineage determination, shows critical involvement in myoblast commitment [42]. In our study, DHRS3 overexpression significantly upregulated mRNA levels of myogenic markers (MYOG, MYH3, MYH7, and MYF5), while gene interference yielded opposite results. This paradoxical observation suggests a potential negative regulatory role of DHRS3 in myogenic differentiation. Notably, during differentiation induction experiments, both DHRS3 and MYF5 expressions exhibited significant downregulation by Day 5 compared to initial stages (p < 0.05), whereas MYOG and MYH3 showed marked elevation. This temporal expression pattern implies that DHRS3 may exert its regulatory function primarily during early differentiation phases, with subsequent downregulation facilitating the progression of myogenic programs. The observed expression dynamics parallel those reported in retinoic acid (RA) signaling pathway-related genes, suggesting DHRS3 might participate in myogenic regulation through RA metabolic modulation. These findings align with previous studies demonstrating the temporal hierarchy of MRFs in muscle development [43,44].
In this study, we observed that DHRS3 is expressed in various tissues of pigs, with particularly high expression levels in the liver and kidneys. As the primary metabolic organ and key excretory organs, the liver and kidneys suggest that DHRS3 may play a crucial role in porcine growth and development. The growth and development of animals rely on the proliferation and differentiation of myoblasts. Through experiments involving DHRS3 overexpression and interference, we examined its effects on myoblast proliferation and differentiation. Our findings suggest that DHRS3 may inhibit porcine myoblast proliferation, promote apoptosis, and suppress differentiation. However, the exact mechanisms underlying these effects warrant further investigation.

5. Conclusions

In conclusion, this study confirms that the DHRS3 gene is expressed across various tissues in pigs, with particularly high levels in the liver and kidneys. Cellular experiments revealed that DHRS3 inhibits porcine myoblast proliferation and differentiation while promoting apoptosis. These findings lay a theoretical foundation for further investigation into the molecular mechanisms regulating myoblast proliferation and differentiation in pigs.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani15081101/s1, Figure S1: Agarose gel electrophoresis pattern of the CDS region of the porcine DHRS3 gene (a) PCR product of DHRS3 gene in pig; (b) The results of bacterial liquid PCR amplification of the DHRS3 gene. F: TGCCCGACAACCACTACCTGAGC; R: TTGTGAAATTTGTGATGCTATTGC.

Author Contributions

Conceptualization, J.L., Y.R. and C.J.; methodology, J.L., Y.R., C.J. and H.X.; software, J.L., Y.R., C.J. and J.S.; validation, J.L., D.A. and B.Z.; formal analysis, J.L., H.L. and Z.L.; data curation, J.L.; writing—original draft preparation, J.L.; writing—review and editing, J.L., Y.R. and H.X.; supervision, J.L., Y.R. and H.X.; funding acquisition, H.X. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Guizhou Provincial Science and Technology Engineering Project [QKHFQ-2018,4007, (002)] and the Guizhou Provincial Agricultural Major Industry Scientific Research Engineering Project (QKHKYZ-2019,011).

Institutional Review Board Statement

The animal study was approved by the Animal Welfare Committee of Guizhou University (EAE-GZU-2022-E047, Guiyang, China; 30 October 2022). The study was conducted in accordance with the local legislation and institutional requirements.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author(s).

Conflicts of Interest

The authors declare that there are no conflicts of interest that biased or influenced this study.

References

  1. Shahriyari, M.; Islam, M.R.; Sakib, S.M.; Rin, M.; Rika, A.; Krüger, D.; Kaurani, L.; Gisa, V.; Winterhoff, M.; Anandakumar, H.; et al. Engineered skeletal muscle recapitulates human muscle development, regeneration and dystrophy. J. Cachexia Sarcopenia Muscle 2022, 13, 3106–3121. [Google Scholar] [CrossRef]
  2. Frontera, W.R.; Ochala, J. Skeletal muscle: A brief review of structure and function. Calcif. Tissue Int. 2014, 96, 183–195. [Google Scholar] [CrossRef]
  3. Kim, C.J.; Hadjiargyrou, M. Mustn1 in Skeletal Muscle: A Novel Regulator? Genes 2024, 15, 829. [Google Scholar] [CrossRef] [PubMed]
  4. Lu, H.; Ege, D.; Salehi, S.; Boccaccini, A.R. Ionic medicine: Exploiting metallic ions to stimulate skeletal muscle tissue regeneration. Acta Biomater. 2024, 190, 1–23. [Google Scholar] [CrossRef]
  5. Morozzi, G.; Beccafico, S.; Bianchi, R.; Riuzzi, F.; Bellezza, I.; Giambanco, I.; Arcuri, C.; Minelli, A.; Donato, R. Oxidative stress-induced S100B accumulation converts myoblasts into brown adipocytes via an NF-κB/YY1/miR-133 axis and NF-κB/YY1/BMP-7 axis. Cell Death Differ. 2017, 24, 2077–2088. [Google Scholar] [CrossRef]
  6. Brown, L.D. Endocrine regulation of fetal skeletal muscle growth: Impact on future metabolic health. J. Endocrinol. 2014, 221, R13–R29. [Google Scholar] [CrossRef]
  7. Kallberg, Y.; Oppermann, U.; Jörnvall, H.; Persson, B. Short-chain dehydrogenases/reductases (SDRs). Eur. J. Biochem. 2002, 269, 4409–4417. [Google Scholar] [CrossRef]
  8. Kramm, A.; Kisiela, M.; Schulz, R.; Maser, E. Short-chain dehydrogenases/reductases in cyanobacteria. FEBS J. 2012, 279, 1030–1043. [Google Scholar] [CrossRef]
  9. Franco, G.; Marco, A.; Sergio, T. Gene Structure Evolution of the Short-Chain Dehydrogenase/Reductase (SDR) Family. Genes 2023, 14, 110. [Google Scholar] [CrossRef]
  10. Da Costa, M.; Gevaert, O.; Van Overtveldt, S.; Lange, J.; Joosten, H.; Desmet, T.; Beerens, K. Structure-function relationships in NDP-sugar active SDR enzymes: Fingerprints for functional annotation and enzyme engineering. Biotechnol. Adv. 2021, 48, 107705. [Google Scholar] [CrossRef]
  11. Li, Z.; Tan, Y.; Li, X.; Quan, J.; Bode, A.M.; Cao, Y.; Luo, X. DHRS2 inhibits cell growth and metastasis in ovarian cancer by downregulation of CHKα to disrupt choline metabolism. Cell Death Dis. 2022, 13, 845. [Google Scholar] [CrossRef] [PubMed]
  12. Oppermann, U.; Filling, C.; Jörnvall, H. Forms and functions of human SDR enzymes. Chem. Biol. Interact. 2001, 130–132, 699–705. [Google Scholar] [CrossRef] [PubMed]
  13. Adams, M.K.; Lee, S.; Belyaeva, O.V.; Wu, L.; Kedishvili, N.Y. Characterization of human short chain dehydrogenase/reductase SDR16C family members related to retinol dehydrogenase 10. Chem. Biol. Interact. 2017, 276, 88–94. [Google Scholar] [CrossRef] [PubMed]
  14. Zhang, S.; Liu, Y.; Zheng, Z.; Zeng, X.; Liu, D.; Wang, C.; Ting, K. MicroRNA-223 Suppresses Osteoblast Differentiation by Inhibiting DHRS3. Cell Physiol. Biochem. 2018, 47, 667–679. [Google Scholar] [CrossRef]
  15. Lundová, T.; Zemanová, L.; Malčeková, B.; Skarka, A.; Štambergová, H.; Havránková, J.; Šafr, M.; Wsól, V. Molecular and biochemical characterisation of human short-chain dehydrogenase/reductase member 3 (DHRS3). Chem. Biol. Interact. 2015, 234, 178–187. [Google Scholar] [CrossRef]
  16. Kirschner, R.D.; Rother, K.; Müller, G.A.; Engeland, K. The retinal dehydrogenase/reductase retSDR1/DHRS3 gene is activated by p53 and p63 but not by mutants derived from tumors or EEC/ADULT malformation syndromes. Cell Cycle 2010, 9, 2177–2188. [Google Scholar] [CrossRef]
  17. Adams, M.K.; Belyaeva, O.V.; Wu, L.; Chaple, I.F.; Dunigan-Russell, K.; Popov, K.M.; Kedishvili, N.Y. Characterization of subunit interactions in the hetero-oligomeric retinoid oxidoreductase complex. Biochem. J. 2021, 478, 3597–3611. [Google Scholar] [CrossRef]
  18. Johns, E.; Ma, Y.; Louphrasitthiphol, P.; Peralta, C.; Hunter, M.V.; Raymond, J.H.; Molina, H.; Goding, C.R.; White, R.M. The Lipid Droplet Protein DHRS3 Is a Regulator of Melanoma Cell State. Pigment Cell Melanoma Res. 2024, 38, e13208. [Google Scholar] [CrossRef]
  19. Zhang, W.; Xu, J.; Zhang, C.; Tong, H.; Li, S.; Yan, Y. Effects of DHRS3 in C2C12 Myoblast Differentiation and Mouse Skeletal Muscle Injury. J. Northeast. Agric. Univ. (Engl. Ed.) 2021, 28, 10. Available online: https://kns.cnki.net/kcms2/article/abstract?v=_mP9DtK6WVcW4V6VjYPckVfIvpj2sWL6HvctjmIZd8Zk3UaEwhg1aPZj8WK8xB51Zksfq6BRjiKES2BIgbNYdaBxSB0qPDXat_595x9Pd2zCSvko5G9cjsWcg5E6YZHgvlEti9E0Cvjrsne-hFJUH8zdLbJekGwn4SYtMYZmLWv4IJBw1PYalDR4yH-rpKjh&uniplatform=NZKPT&language=CHS (accessed on 19 October 2021).
  20. Tian, J.; Du, Y.; Wang, B.; Ji, M.; Li, H.; Xia, Y.; Zhang, K.; Li, Z.; Xie, W.; Gong, W.; et al. Hif1α/DHRS3a Pathway Participates in Lipid Droplet Accumulation via Retinol and Ppar-γ in Fish Hepatocytes. Int. J. Mol. Sci. 2023, 24, 10236. [Google Scholar] [CrossRef]
  21. Deisenroth, C.; Itahana, Y.; Tollini, L.; Jin, A.; Zhang, Y. p53-inducible DHRS3 Is an Endoplasmic Reticulum Protein Associated with Lipid Droplet Accumulation. J. Biol. Chem. 2011, 286, 28343–28356. [Google Scholar] [CrossRef] [PubMed]
  22. Forcina, L.; Miano, C.; Pelosi, L.; Musarò, A. An Overview About the Biology of Skeletal Muscle Satellite Cells. Curr. Genomics 2019, 20, 24–37. [Google Scholar] [CrossRef]
  23. Wang, Y.; Yang, W.; Li, P.; Wang, H.; Zhang, Y.; Zan, L. Myocyte enhancer factor 2A promotes proliferation and its inhibition attenuates myogenic differentiation via myozenin 2 in bovine skeletal muscle myoblast. PLoS ONE 2018, 13, e196255. [Google Scholar] [CrossRef] [PubMed]
  24. Zhang, S.; Chen, X.; Huang, Z.; Chen, D.; Yu, B.; Chen, H.; Luo, J.; He, J.; Zheng, P.; Yu, J. Leucine promotes differentiation of porcine myoblasts through the protein kinase B (Akt)/Forkhead box O1 signalling pathway. Br. J. Nutr. 2018, 119, 727–733. [Google Scholar] [CrossRef]
  25. Reynhout, S.; Janssens, V. Physiologic functions of PP2A: Lessons from genetically modified mice. Biochim. Biophys. Acta Mol. Cell Res. 2019, 1866, 31–50. [Google Scholar] [CrossRef]
  26. Reza, Z.; Qiuyan, C.; A Catharine, R. DHRS3, a retinal reductase, is differentially regulated by retinoic acid and lipopolysaccharide-induced inflammation in THP-1 cells and rat liver. Am. J. Physiol.-Gastroint. Liver Physiol. 2012, 303, G578–G588. [Google Scholar] [CrossRef]
  27. Hardebeck, S.; Schreiber, S.; Adick, A.; Langer, K.; Jose, J. A FRET-Based Assay for the Identification of PCNA Inhibitors. Int. J. Mol. Sci. 2023, 24, 11858. [Google Scholar] [CrossRef]
  28. Røst, L.M.; Ræder, S.B.; Olaisen, C.; Søgaard, C.K.; Sharma, A.; Bruheim, P.; Otterlei, M. PCNA regulates primary metabolism by scaffolding metabolic enzymes. Oncogene 2023, 42, 613–624. [Google Scholar] [CrossRef]
  29. Herrera, M.C.; Chymkowitch, P.; Robertson, J.M.; Eriksson, J.; Bøe, S.O.; Alseth, I.; Enserink, J.M. Cdk1 gates cell cycle-dependent tRNA synthesis by regulating RNA polymerase III activity. Nucleic Acids Res. 2018, 46, 11698–11711. [Google Scholar] [CrossRef]
  30. Tyagi, N.; Deshmukh, S.K.; Srivastava, S.K.; Azim, S.; Ahmad, A.; AL-Ghadhban, A.; Singh, A.P.; Carter, J.E.; Wang, B.; Singh, S. ETV4 Facilitates Cell-Cycle Progression in Pancreatic Cells through Transcriptional Regulation of Cyclin D1. Mol. Cancer Res. 2018, 16, 187–196. [Google Scholar] [CrossRef]
  31. Vermeulen, K.; Berneman, Z.N.; Van Bockstaele, D.R. Cell cycle and apoptosis. Cell Prolif. 2003, 36, 113–175. [Google Scholar] [CrossRef] [PubMed]
  32. Huang, R.; Gao, S.; Han, Y.; Ning, H.; Zhou, Y.; Guan, H.; Liu, X.; Yan, S.; Zhou, P. BECN1 promotes radiation-induced G2/M arrest through regulation CDK1 activity: A potential role for autophagy in G2/M checkpoint. Cell Death Discov. 2020, 6, 70. [Google Scholar] [CrossRef] [PubMed]
  33. Cai, F.; Chen, P.; Chen, L.; Biskup, E.; Liu, Y.; Chen, P.; Chang, J.; Jiang, W.; Jing, Y.; Chen, Y.; et al. Human RAD6 promotes G1-S transition and cell proliferation through upregulation of cyclin D1 expression. PLoS ONE 2014, 11, e113727. [Google Scholar] [CrossRef] [PubMed]
  34. Li, N.; Zeng, J.; Sun, F.; Tong, X.; Meng, G.; Wu, C.; Ding, X.; Liu, L.; Han, M.; Lu, C.; et al. p27 inhibits CDK6/CCND1 complex formation resulting in cell cycle arrest and inhibition of cell proliferation. Cell Cycle 2018, 17, 2335–2348. [Google Scholar] [CrossRef]
  35. Gennaro, V.J.; Stanek, T.J.; Peck, A.R.; Sun, Y.; Wang, F.; Qie, S.; Knudsen, K.E.; Rui, H.; Butt, T.; Diehl, J.A.; et al. Control of CCND1 ubiquitylation by the catalytic SAGA subunit USP22 is essential for cell cycle progression through G1 in cancer cells. Proc. Natl. Acad. Sci. USA 2018, 115, E9298–E9307. [Google Scholar] [CrossRef]
  36. Sha, S.; Kong, X.; Chen, F.; Sun, X.; Hu, S.; Bai, B.; Shi, X.; Tu, Y.; Wu, K.; Zhao, Q.; et al. Hypermethylation of DHRS3 as a Novel Tumor Suppressor Involved in Tumor Growth and Prognosis in Gastric Cancer. Front. Cell Dev. Biol. 2021, 9, 624871. [Google Scholar] [CrossRef]
  37. Wang, L.; Su, L.; Cen, Y.; Li, J.; Yang, J.; Li, Y. Overexpressed miRNA-nov-1 promotes manganese-induced apoptosis in N27 cells by regulating DHRS3 to activate mTOR signaling pathway. Toxicology 2023, 489, 153472. [Google Scholar] [CrossRef]
  38. Jiang, R.; Gao, H.; Cong, F.; Zhang, W.; Song, T.; Yu, Z. Circ_DHRS3 positively regulates GREM1 expression by competitively targeting miR-183-5p to modulate IL-1β-administered chondrocyte proliferation, apoptosis and ECM degradation. Int. Immunopharmacol. 2021, 91, 107293. [Google Scholar] [CrossRef]
  39. Yi, C.; Roshan, M.K.; Bennett, H.P.; Charlotte, A.B.; Charles, K.; Laurie, A.B.; Richard, A.Y.; Stephen, J.T. Global and gene-specific analyses show distinct roles for Myod and Myog at a common set of promoters. EMBO J. 2006, 25, 502–511. [Google Scholar] [CrossRef]
  40. Tang, J.; Yang, B.; Song, G.; Zhang, X.; Wang, Z.; Mo, Z.; Zan, L.; Wang, H. Effect of bovine myosin heavy chain 3 on proliferation and differentiation of myoblast. Anim. Biotechnol. 2022, 34, 4337–4346. [Google Scholar] [CrossRef]
  41. Wang, H.; Dou, M.; Li, J.; Cao, P.; Li, J.; Guo, T.; Zhao, D.; Khan, A.; Li, Y.; Li, B.; et al. Expression patterns and correlation analyses of muscle-specific genes in the process of sheep myoblast differentiation. In Vitro Cell Dev. Biol. 2022, 58, 798–809. [Google Scholar] [CrossRef] [PubMed]
  42. Francetic, T.; Le May, M.; Hamed, M.; Mach, H.; Meyers, D.; Cole, P.A.; Chen, J.; Li, Q. Regulation of Myf5 Early Enhancer by Histone Acetyltransferase P300 during Stem Cell Differentiation. Mol. Biol. 2012, 1, 1000103. [Google Scholar] [CrossRef]
  43. Jihong, C.; Qiao, L. Implication of retinoic acid receptor selective signaling in myogenic differentiation. Sci. Rep. 2016, 6, 18856. [Google Scholar] [CrossRef]
  44. Moreno-Oñate, M.; Gallardo-Fuentes, L.; Martínez-García, P.M.; Naranjo, S.; Jiménez-Gancedo, S.; Tena, J.J.; Santos-Pereira, J.M. Rewiring of the epigenome and chromatin architecture by exogenously induced retinoic acid signaling during zebrafish embryonic development. Nucleic Acids Res. 2024, 52, 3682–3701. [Google Scholar] [CrossRef]
Animals 15 01101 g001
Figure 1. Expression of the DHRS3 gene in tissues of pigs at different ages. (a) Expression of DHRS3 in different tissues at 0 months of age (3 days); (b) expression of DHRS3 in different tissues at 6 months of age; (c) expression of DHRS3 in different tissues at 12 months of age; (d) expression of DHRS3 in different tissues at different months of age. The data are expressed as mean ± SEM, n = 3, Different letters indicate significant differences, and the same letter indicates no significant difference (Tukey’s test).
Figure 1. Expression of the DHRS3 gene in tissues of pigs at different ages. (a) Expression of DHRS3 in different tissues at 0 months of age (3 days); (b) expression of DHRS3 in different tissues at 6 months of age; (c) expression of DHRS3 in different tissues at 12 months of age; (d) expression of DHRS3 in different tissues at different months of age. The data are expressed as mean ± SEM, n = 3, Different letters indicate significant differences, and the same letter indicates no significant difference (Tukey’s test).
Animals 15 01101 g001
Animals 15 01101 g002
Figure 2. DHRS3 overexpression and interference efficiency assay. (a) The expression level of DHRS3 after transfection with pEGFP-C1 and pEGFP- DHRS3 for 48 h; (b) the expression level of DHRS3 after transfection with shNC, sh1, sh2, sh3, and sh4 for 48 h. The data are expressed as mean ± SEM, n = 3, ** p < 0.01, *** p < 0.001 (Dunnett’s test).
Figure 2. DHRS3 overexpression and interference efficiency assay. (a) The expression level of DHRS3 after transfection with pEGFP-C1 and pEGFP- DHRS3 for 48 h; (b) the expression level of DHRS3 after transfection with shNC, sh1, sh2, sh3, and sh4 for 48 h. The data are expressed as mean ± SEM, n = 3, ** p < 0.01, *** p < 0.001 (Dunnett’s test).
Animals 15 01101 g002
Animals 15 01101 g003
Figure 3. DHRS3 inhibits pig myoblasts’ proliferation. (a–d) The EdU results of cell proliferation after transfection with pEGFP-DHRS3 and sh1 for 48 h; (e,f) the relative expression of PCNA, CCNB1, CCND1, and CDK1 after transfection of pEGFP- DHRS3 and sh1. Flow cytometry was used to examine cell cycle progression following pEGFP-DHRS3 and sh1. (g,h) Effects of DHRS3 on myoblast cell cycle. The data are expressed as mean ± SEM, n = 3, * p < 0.05, ** p < 0.01, *** p < 0.001 (scale bar, 100 μm).
Figure 3. DHRS3 inhibits pig myoblasts’ proliferation. (a–d) The EdU results of cell proliferation after transfection with pEGFP-DHRS3 and sh1 for 48 h; (e,f) the relative expression of PCNA, CCNB1, CCND1, and CDK1 after transfection of pEGFP- DHRS3 and sh1. Flow cytometry was used to examine cell cycle progression following pEGFP-DHRS3 and sh1. (g,h) Effects of DHRS3 on myoblast cell cycle. The data are expressed as mean ± SEM, n = 3, * p < 0.05, ** p < 0.01, *** p < 0.001 (scale bar, 100 μm).
Animals 15 01101 g003
Animals 15 01101 g004
Figure 4. DHRS3 promotes pig myoblasts’ apoptosis. (a,b) The relative expression of BAX, BCL2, Caspase3, and Caspase8 after transfection of pEGFP-DHRS3 and sh1. The data are expressed as mean ± SEM, n = 3, ** p < 0.01, *** p < 0.001.
Figure 4. DHRS3 promotes pig myoblasts’ apoptosis. (a,b) The relative expression of BAX, BCL2, Caspase3, and Caspase8 after transfection of pEGFP-DHRS3 and sh1. The data are expressed as mean ± SEM, n = 3, ** p < 0.01, *** p < 0.001.
Animals 15 01101 g004
Animals 15 01101 g005
Figure 5. DHRS3 inhibits pig myoblasts’ differentiation. (a,b) The relative expression of MYOG, MYH3, MYH7, and MYF5 after transfection of pEGFP-DHRS3 and sh1. (c) Relative expression levels of DHRS3, MYOG, MYH3, and MYF5 on Day 0 and Day 5 of induced differentiation. The data are expressed as mean ± SEM, n = 3, * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 5. DHRS3 inhibits pig myoblasts’ differentiation. (a,b) The relative expression of MYOG, MYH3, MYH7, and MYF5 after transfection of pEGFP-DHRS3 and sh1. (c) Relative expression levels of DHRS3, MYOG, MYH3, and MYF5 on Day 0 and Day 5 of induced differentiation. The data are expressed as mean ± SEM, n = 3, * p < 0.05, ** p < 0.01, *** p < 0.001.
Animals 15 01101 g005
Table 1. Gene primers used for RT-qPCR.
Table 1. Gene primers used for RT-qPCR.
GenePrimer Sequence (5′-3′)Product Size (bp)Annealing Temperature (°C)
DHRS3F:AGCACCGAGATGTTTCAGGG11360
R:AGGGTCTGATTGAGCTGCAC
GAPDHF:TTTGTGATGGGCGTGAACC17160
R:AGTCTTCTGGGTGGCAGTGAT
PCNAF:AAGTGGAGAACTCGGAAATGGAA16160
R:CTGTAGGAGAGAGTGGAGTGGCTTT
CCNB1F:GACTGGCTAGTGCAGGTTCAGATG13760
R:ATGGCAGTGACACCAACCAGTTG
CCND1F:TGACCTGCCTTAGACCTTA14060
R:GCTGCTGTTACTGACTATATC
CDK1F:GAGCGACGCTGACGTGGTA7262
R:TGGATGTGGTAGATCCCAGCTT
BAXF:TGACGGCAACTTCAACTGGG14455
R:AGCAGCCGATCTCGAAGGAA
BCL2F:CAGAGGGGCTACGAGTGGGATG8962
R:CCGGGCTGGGAGGAGAAGATG
Caspase3F:AGAAGACCATAGCAAAAGGAGCAG15560
R:GTTTGGGTTTGCCAGTTAGAGTTC
Caspase8F:CTGACCTCTTATTTCACTGGTTCGA9762
R:CTTTCTGGTATTTATCCCCTTGACA
MYOGF:TGCCCAGTGAATGCAGTTCC16460
R:ATCCTCCACTGTGATGCTGTCC
MYH3F:ACAGCGGAAAGAAGAAAGTTGC15755
R:CCTGGGGTTTTGGTTTCATT
MYH7F:GATGCGGAGATGGCCGCATT17160
R:GACTTTGCCACCCTCTCGAGACA
MYF5F:TGCCAGTTCTCGCCTTCTGAGTA22162
R:GTGGATTTCCTCTTGCACGCTTT
Note: F stands for upstream primer and R stands for downstream primer.
Table 2. The specific shRNA sequences.
Table 2. The specific shRNA sequences.
shRNA NameSequences (5′-3′)
shRNA1GGACCATGCATGTCCTCATTA
shRNA2TGATCTATCTGGTGGTGAAAG
shRNA3CCTTCTCAAGTCCCAGCATAT
shRNA4ACACCAGCACCGAGATGTTTC
shNCGTTCTCCGAACGTGTCACGT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, J.; Ruan, Y.; Jiang, C.; Sun, J.; An, D.; Zhou, B.; Liu, H.; Li, Z.; Xu, H. Tissue-Specific Expression of the Porcine DHRS3 Gene and Its Impact on the Proliferation and Differentiation of Myogenic Cells. Animals 2025, 15, 1101. https://doi.org/10.3390/ani15081101

AMA Style

Li J, Ruan Y, Jiang C, Sun J, An D, Zhou B, Liu H, Li Z, Xu H. Tissue-Specific Expression of the Porcine DHRS3 Gene and Its Impact on the Proliferation and Differentiation of Myogenic Cells. Animals. 2025; 15(8):1101. https://doi.org/10.3390/ani15081101

Chicago/Turabian Style

Li, Jifeng, Yong Ruan, Chuanmei Jiang, Jinkui Sun, Dongwei An, Bo Zhou, Huan Liu, Ziyang Li, and Houqiang Xu. 2025. "Tissue-Specific Expression of the Porcine DHRS3 Gene and Its Impact on the Proliferation and Differentiation of Myogenic Cells" Animals 15, no. 8: 1101. https://doi.org/10.3390/ani15081101

APA Style

Li, J., Ruan, Y., Jiang, C., Sun, J., An, D., Zhou, B., Liu, H., Li, Z., & Xu, H. (2025). Tissue-Specific Expression of the Porcine DHRS3 Gene and Its Impact on the Proliferation and Differentiation of Myogenic Cells. Animals, 15(8), 1101. https://doi.org/10.3390/ani15081101

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop