Aspirin Eugenol Ester Modulates the Hypothalamus Transcriptome in Broilers Under High Stocking Density
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Treatment
2.2. Animals and Experimental Design
2.3. Growth Performance and Sample Collection
2.4. RNA Isolation and Sequencing
2.5. Original Data Processing, Alignment Analysis, and Quality Control
2.6. Differentially Expressed Genes
2.7. Analysis for Functional Pathway Enrichment
2.8. Determination of Protein-to-Protein Network Interactions
2.9. Quantitative Real-Time PCR (qRT-PCR) Analysis
2.10. Statistical Analyses
3. Results
3.1. AEE Modulates the Growth Performance of HD Broilers
3.2. RNA-Sequencing Analysis
3.3. Analysis of Differentially Expressed Genes
3.4. GO and KEGG Enrichment Analysis of Differentially Expressed Genes in Broiler Hypothalami
3.5. Identification of Candidate Differentially Expressed Genes and Validation of RNA-Seq Results
4. Discussion
4.1. AEE Modulates the Growth Performance of HD Broilers
4.2. AEE Modulates Hypothalamic Feeding-Related Genes in HD Broilers
4.3. AEE Modulates Neurological Development-Related Genes in HD Broilers
4.4. GO and KEGG Enrichment Analysis of Differentially Expressed Genes in Broiler Hypothalami
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| HD | high stocking density |
| ND | normal stocking density |
| AEE | aspirin eugenol esters |
| DEGs | differential expression genes |
| MC3R | melanocortin 3 receptor |
| MC4R | melanocortin 4 receptor |
| PAX6 | paired box 6 |
| α-MSH | alpha-melanocyte-stimulating hormone |
| NMU | neuromedin U |
| GH | growth hormone |
| SERT | serotonin transporter |
| 5-HT | 5-hydroxytryptamine |
| SERPINB1 | serpin family B member 1 |
| GATA3 | gata binding protein 3 |
| SLC9A9 | solute carrier family 9 member A9 |
| EN2 | engrailed homeobox 2 |
| ISL1 | isl lim homeobox 1 |
| PAX2 | paired box 2 |
| SLC6A4 | solute carrier family 6 member 4 |
| BSX | Brain-specific homeobox |
| GHRH | growth hormone–releasing hormone |
| GAL | galanin and GAMP prepropeptide |
| POMC | proopiomelanocortin |
| AGRP | agouti-related peptide |
| NPY | neuropeptide Y |
| CART | cocaine- and amphetamine-regulated transcript |
| KEGG | Kyoto Encyclopedia of Genes and Genomes |
| GO | Gene Ontology |
References
- Kwon, B.Y.; Park, J.; Kim, D.H.; Lee, K.W. Assessment of Welfare Problems in Broilers: Focus on Musculoskeletal Problems Associated with Their Rapid Growth. Animals 2024, 14, 1116. [Google Scholar] [CrossRef]
- Li, X.M.; Zhang, M.H.; Liu, S.M.; Feng, J.H.; Ma, D.D.; Liu, Q.X.; Zhou, Y.; Wang, X.J.; Xing, S. Effects of Stocking Density on Growth Performance, Growth Regulatory Factors, and Endocrine Hormones in Broilers under Appropriate Environments. Poult. Sci. 2019, 98, 6611–6617. [Google Scholar] [CrossRef]
- Riber, A.B.; van de Weerd, H.A.; de Jong, I.C.; Steenfeldt, S. Review of Environmental Enrichment for Broiler Chickens. Poult. Sci. 2018, 97, 378–396. [Google Scholar] [CrossRef]
- Obeidat, M.D.; Alkhateeb, M.E.M.; Jawasreh, K.I.; Riley, D.G.; Al Sukhni, I.A. Herbal Extract Dietary Supplementation Effect on Growth Performance and Meat Quality in Broiler Raised under Two Stocking Densities. Sci. Rep. 2024, 14, 1863. [Google Scholar] [CrossRef]
- Zhang, H.; Zhang, Y.; Bai, D.; Zhong, J.; Hu, X.; Zhang, R.; Zhen, W.; Ito, K.; Zhang, B.; Yang, Y.; et al. Effect of Dietary Aspirin Eugenol Ester on the Growth Performance, Antioxidant Capacity, Intestinal Inflammation, and Cecal Microbiota of Broilers under High Stocking Density. Poult. Sci. 2024, 103, 103825. [Google Scholar] [CrossRef]
- Liu, Y.; Zhang, Y.; Bai, D.; Li, Y.; He, X.; Ito, K.; Liu, K.; Tan, H.; Zhen, W.; Zhang, B.; et al. Dietary Supplementation with Chlorogenic Acid Enhances Antioxidant Capacity, Which Promotes Growth, Jejunum Barrier Function, and Cecum Microbiota in Broilers under High Stocking Density Stress. Animals 2023, 13, 303. [Google Scholar] [CrossRef]
- Thomas, D.G.; Ravindran, V.; Thomas, D.V.; Camden, B.J.; Cottam, Y.H.; Morel, P.C.H.; Cook, C.J. Influence of Stocking Density on the Performance, Carcass Characteristics and Selected Welfare Indicators of Broiler Chickens. N. Z. Vet. J. 2004, 52, 76–81. [Google Scholar] [CrossRef]
- Taira, K.; Nagai, T.; Obi, T.; Takase, K. Effect of Litter Moisture on the Development of Footpad Dermatitis in Broiler Chickens. J. Vet. Med. Sci. 2014, 76, 583–586. [Google Scholar] [CrossRef]
- Sun, Z.W.; Yan, L.; G, Y.Y.; Zhao, J.P.; Lin, H.; Guo, Y.M. Increasing Dietary Vitamin D3 Improves the Walking Ability and Welfare Status of Broiler Chickens Reared at High Stocking Densities. Poult. Sci. 2013, 92, 3071–3307. [Google Scholar] [CrossRef]
- Dai, D.; Qi, G.; Wang, J.; Zhang, H.; Qiu, K.; Han, Y.; Wu, Y.; Wu, S. Dietary Organic Acids Ameliorate High Stocking Density Stress-Induced Intestinal Inflammation through the Restoration of Intestinal Microbiota in Broilers. J. Anim. Sci. Biotechnol. 2022, 13, 124. [Google Scholar] [CrossRef]
- He, X.; Lu, Z.; Ma, B.; Zhang, L.; Li, J.; Jiang, Y.; Zhou, G.; Gao, F. Chronic Heat Stress Alters Hypothalamus Integrity, the Serum Indexes and Attenuates Expressions of Hypothalamic Appetite Genes in Broilers. J. Therm. Biol. 2019, 81, 110–117. [Google Scholar] [CrossRef]
- Jones, B.J.; Bloom, S.R. The New Era of Drug Therapy for Obesity: The Evidence and the Expectations. Drugs 2015, 75, 935–945. [Google Scholar] [CrossRef]
- Boswell, T.; Dunn, I.C. Regulation of Agouti-Related Protein and Pro-Opiomelanocortin Gene Expression in the Avian Arcuate Nucleus. Front. Endocrinol. 2017, 8, 75. [Google Scholar] [CrossRef]
- Li, J.; Yu, Y.; Wang, Q.; Zhang, J.; Yang, Y.; Li, B.; Zhou, X.; Niu, J.; Wei, X.; Liu, X.; et al. Synthesis of Aspirin Eugenol Ester and Its Biological Activity. Med. Chem. Res. 2012, 21, 995–999. [Google Scholar] [CrossRef]
- Huang, M.Z.; Zhang, Z.D.; Yang, Y.J.; Liu, X.W.; Qin, Z.; Li, J.Y. Aspirin Eugenol Ester Protects Vascular Endothelium from Oxidative Injury by the Apoptosis Signal Regulating Kinase-1 Pathway. Front. Pharmacol. 2020, 11, 588755. [Google Scholar] [CrossRef]
- Ma, N.; Liu, X.W.; Yang, Y.J.; Shen, D.S.; Zhao, X.L.; Mohamed, I.; Kong, X.J.; Li, J.-Y. Evaluation on Antithrombotic Effect of Aspirin Eugenol Ester from the View of Platelet Aggregation, Hemorheology, TXB2/6-Keto-PGF1α and Blood Biochemistry in Rat Model. BMC Vet. Res. 2016, 12, 108. [Google Scholar] [CrossRef]
- Kridtayopas, C.; Rakangtong, C.; Bunchasak, C.; Loongyai, W. Effect of Prebiotic and Synbiotic Supplementation in Diet on Growth Performance, Small Intestinal Morphology, Stress, and Bacterial Population under High Stocking Density Condition of Broiler Chickens. Poult. Sci. 2019, 98, 4595–4605. [Google Scholar] [CrossRef]
- Guardia, S.; Konsak, B.; Combes, S.; Levenez, F.; Cauquil, L.; Guillot, J.-F.; Moreau-Vauzelle, C.; Lessire, M.; Juin, H.; Gabriel, I. Effects of Stocking Density on the Growth Performance and Digestive Microbiota of Broiler Chickens. Poult. Sci. 2011, 90, 1878–1889. [Google Scholar] [CrossRef]
- Simitzis, P.E.; Kalogeraki, E.; Goliomytis, M.; Charismiadou, M.A.; Triantaphyllopoulos, K.; Ayoutanti, A.; Niforou, K.; Hager-Theodorides, A.L.; Deligeorgis, S.G. Impact of Stocking Density on Broiler Growth Performance, Meat Characteristics, Behavioural Components and Indicators of Physiological and Oxidative Stress. Br. Poult. Sci. 2012, 53, 721–730. [Google Scholar] [CrossRef]
- Chegini, S.; Kiani, A.; Rokni, H. Alleviation of Thermal and Overcrowding Stress in Finishing Broilers by Dietary Propolis Supplementation. Ital. J. Anim. Sci. 2018, 17, 377–385. [Google Scholar] [CrossRef]
- Rambau, M.D.; Mudau, M.L.; Makhanya, S.D.; Benyi, K. Effects of Stocking Density and Daily Feed Withdrawal Periods on the Performance of Broiler Chickens in a Semi-Arid Environment. Trop. Anim. Health Prod. 2016, 48, 1547–1554. [Google Scholar] [CrossRef]
- Buijs, S.; Keeling, L.; Rettenbacher, S.; Van Poucke, E.; Tuyttens, F.A.M. Stocking Density Effects on Broiler Welfare: Identifying Sensitive Ranges for Different Indicators. Poult. Sci. 2009, 88, 1536–1543. [Google Scholar] [CrossRef]
- Mahrose, K.M.; El-Hack, M.E.A.; Amer, S.A. Influences of Dietary Crude Protein and Stocking Density on Growth Performance and Body Measurements of Ostrich Chicks. An. Acad. Bras. Cienc. 2019, 91, e20180479. [Google Scholar] [CrossRef]
- Jobe, M.C.; Ncobela, C.N.; Kunene, N.W.; Opoku, A.R. Effects of Cassia abbreviata Extract and Stocking Density on Growth Performance, Oxidative Stress and Liver Function of Indigenous Chickens. Trop. Anim. Health Prod. 2019, 51, 2567–2574. [Google Scholar] [CrossRef]
- Cengiz, Ö.; Köksal, B.H.; Tatlı, O.; Sevim, Ö.; Ahsan, U.; Üner, A.G.; Ulutaş, P.A.; Beyaz, D.; Büyükyörük, S.; Yakan, A.; et al. Effect of Dietary Probiotic and High Stocking Density on the Performance, Carcass Yield, Gut Microflora, and Stress Indicators of Broilers. Poult. Sci. 2015, 94, 2395–2403. [Google Scholar] [CrossRef]
- Morton, G.J.; Cummings, D.E.; Baskin, D.G.; Barsh, G.S.; Schwartz, M.W. Central Nervous System Control of Food Intake and Body Weight. Nature 2006, 443, 289–295. [Google Scholar] [CrossRef]
- Wen, S.; Wang, C.; Gong, M.; Zhou, L. An Overview of Energy and Metabolic Regulation. Sci. China Life Sci. 2019, 62, 771–790. [Google Scholar] [CrossRef]
- Furuse, M. Central Regulation of Food Intake in the Neonatal Chick. Anim. Sci. J. 2002, 73, 83–94. [Google Scholar] [CrossRef]
- Kuenzel, W.J.; Beck, M.M.; Teruyama, R. Neural Sites and Pathways Regulating Food Intake in Birds: A Comparative Analysis to Mammalian Systems. J. Exp. Zool. 1999, 283, 348–364. [Google Scholar] [CrossRef]
- Boswell, T.; Dunn, I.C.; Corr, S.A. Neuropeptide Y Gene Expression in the Brain Is Stimulated by Fasting and Food Restriction in Chickens. Br. Poult. Sci. 1999, 40 (Suppl. S1), S42–S43. [Google Scholar] [CrossRef]
- Boswell, T.; Dunn, I.C.; Corr, S.A. Hypothalamic Neuropeptide Y mRNA Is Increased after Feed Restriction in Growing Broilers. Poult. Sci. 1999, 78, 1203–1207. [Google Scholar] [CrossRef]
- Boswell, T.; Li, Q.; Takeuchi, S. Neurons Expressing Neuropeptide Y mRNA in the Infundibular Hypothalamus of Japanese Quail Are Activated by Fasting and Co-Express Agouti-Related Protein mRNA. Brain Res. Mol. Brain Res. 2002, 100, 31–42. [Google Scholar] [CrossRef]
- Furuse, M.; Matsumoto, M.; Mori, R.; Sugahara, K.; Kano, K.; Hasegawa, S. Influence of Fasting and Neuropeptide Y on the Suppressive Food Intake Induced by Intracerebroventricular Injection of Glucagon-like Peptide-1 in the Neonatal Chick. Brain Res. 1997, 764, 289–292. [Google Scholar] [CrossRef]
- Small, C.J.; Kim, M.S.; Stanley, S.A.; Mitchell, J.R.; Murphy, K.; Morgan, D.G.; Ghatei, M.A.; Bloom, S.R. Effects of Chronic Central Nervous System Administration of Agouti-Related Protein in Pair-Fed Animals. Diabetes 2001, 50, 248–254. [Google Scholar] [CrossRef]
- Piórkowska, K.; Żukowski, K.; Połtowicz, K.; Nowak, J.; Ropka-Molik, K.; Derebecka, N.; Wesoły, J.; Wojtysiak, D. Identification of Candidate Genes and Regulatory Factors Related to Growth Rate through Hypothalamus Transcriptome Analyses in Broiler Chickens. BMC Genom. 2020, 21, 509. [Google Scholar] [CrossRef]
- Sakkou, M.; Wiedmer, P.; Anlag, K.; Hamm, A.; Seuntjens, E.; Ettwiller, L.; Tschöp, M.H.; Treier, M. A Role for Brain-Specific Homeobox Factor Bsx in the Control of Hyperphagia and Locomotory Behavior. Cell Metab. 2007, 5, 450–463. [Google Scholar] [CrossRef]
- Nogueiras, R.; López, M.; Lage, R.; Perez-Tilve, D.; Pfluger, P.; Mendieta-Zerón, H.; Sakkou, M.; Wiedmer, P.; Benoit, S.C.; Datta, R.; et al. Bsx, a Novel Hypothalamic Factor Linking Feeding with Locomotor Activity, Is Regulated by Energy Availability. Endocrinology 2008, 149, 3009–3015. [Google Scholar] [CrossRef]
- Kaji, T.; Nonogaki, K. Role of Homeobox Genes in the Hypothalamic Development and Energy Balance. Front. Biosci. 2013, 18, 740–747. [Google Scholar]
- Huszar, D.; Lynch, C.A.; Fairchild-Huntress, V.; Dunmore, J.H.; Fang, Q.; Berkemeier, L.R.; Gu, W.; Kesterson, R.A.; Boston, B.A.; Cone, R.D.; et al. Targeted Disruption of the Melanocortin-4 Receptor Results in Obesity in Mice. Cell 1997, 88, 131–141. [Google Scholar] [CrossRef]
- Honda, K.; Saneyasu, T.; Hasegawa, S.; Kamisoyama, H. A Comparative Study of the Central Effects of Melanocortin Peptides on Food Intake in Broiler and Layer Chicks. Peptides 2012, 37, 13–17. [Google Scholar] [CrossRef] [PubMed]
- Takeuchi, S.; Takahashi, S. Melanocortin Receptor Genes in the Chicken—Tissue Distributions. Gen. Comp. Endocrinol. 1998, 112, 220–231. [Google Scholar] [CrossRef]
- Higgins, S.E.; Ellestad, L.E.; Trakooljul, N.; McCarthy, F.; Saliba, J.; Cogburn, L.A.; Porter, T.E. Transcriptional and Pathway Analysis in the Hypothalamus of Newly Hatched Chicks during Fasting and Delayed Feeding. BMC Genom. 2010, 11, 162. [Google Scholar] [CrossRef]
- Graham, E.S.; Turnbull, Y.; Fotheringham, P.; Nilaweera, K.; Mercer, J.G.; Morgan, P.J.; Barrett, P. Neuromedin U and Neuromedin U Receptor-2 Expression in the Mouse and Rat Hypothalamus: Effects of Nutritional Status. J. Neurochem. 2003, 87, 1165–1173. [Google Scholar] [CrossRef]
- Botticelli, L.; Micioni Di Bonaventura, E.; Del Bello, F.; Giorgioni, G.; Piergentili, A.; Quaglia, W.; Bonifazi, A.; Cifani, C.; Micioni Di Bonaventura, M.V. The Neuromedin U System: Pharmacological Implications for the Treatment of Obesity and Binge Eating Behavior. Pharmacol. Res. 2023, 195, 106875. [Google Scholar] [CrossRef]
- Wren, A.M.; Small, C.J.; Abbott, C.R.; Jethwa, P.H.; Kennedy, A.R.; Murphy, K.G.; Stanley, S.A.; Zollner, A.N.; Ghatei, M.A.; Bloom, S.R. Hypothalamic Actions of Neuromedin U. Endocrinology 2002, 143, 4227–4234. [Google Scholar] [CrossRef]
- Mills, E.G.; Izzi-Engbeaya, C.; Abbara, A.; Comninos, A.N.; Dhillo, W.S. Functions of Galanin, Spexin and Kisspeptin in Metabolism, Mood and Behaviour. Nat. Rev. Endocrinol. 2021, 17, 97–113. [Google Scholar] [CrossRef]
- Mohd Zahir, I.; Ogawa, S.; Dominic, N.A.; Soga, T.; Parhar, I.S. Spexin and Galanin in Metabolic Functions and Social Behaviors with a Focus on Non-Mammalian Vertebrates. Front. Endocrinol. 2022, 13, 882772. [Google Scholar] [CrossRef]
- Parrado, C.; Díaz-Cabiale, Z.; García-Coronel, M.; Agnati, L.F.; Coveñas, R.; Fuxe, K.; Narváez, J.A. Region Specific Galanin Receptor/Neuropeptide Y Y1 Receptor Interactions in the Tel- and Diencephalon of the Rat. Relevance for Food Consumption. Neuropharmacology 2007, 52, 684–692. [Google Scholar] [CrossRef]
- Marcos, P.; Coveñas, R. Neuropeptidergic Control of Feeding: Focus on the Galanin Family of Peptides. Int. J. Mol. Sci. 2021, 22, 2544. [Google Scholar] [CrossRef]
- Krulich, L.; Dhariwal, A.P.; McCann, S.M. Stimulatory and Inhibitory Effects of Purified Hypothalamic Extracts on Growth Hormone Release from Rat Pituitary in Vitro. Endocrinology 1968, 83, 783–790. [Google Scholar] [CrossRef]
- Warden, S.J.; Haney, E.M. Skeletal Effects of Serotonin (5-Hydroxytryptamine) Transporter Inhibition: Evidence from In Vitro and Animal-Based Studies. J. Musculoskelet. Neuronal Interact. 2008, 8, 121–132. [Google Scholar]
- Chen, F.X.; Chen, X.S.; Guo, J.-C.; Zheng, B.-A.; Guo, M. Serotonin Transporter-Linked Polymorphic Region Genotypes in Relation to Stress Conditions among Patients with Papillary Thyroid Carcinoma. Int. J. Clin. Exp. Pathol. 2019, 12, 968–977. [Google Scholar]
- Wang, Y.; Wang, Y.; Tang, J.; Li, R.; Jia, Y.; Yang, H.; Wei, H. Impaired Neural Circuitry of Hippocampus in Pax2 Nervous System-Specific Knockout Mice Leads to Restricted Repetitive Behaviors. CNS Neurosci. Ther. 2024, 30, e14482. [Google Scholar] [CrossRef]
- Li, R.; Tang, J.; Wang, Y.; Wang, Y.; Yang, H.; Wei, H. Metabolomics and Transcriptomics Analysis of Prefrontal Cortex in the Pax2 Neuron-Specific Deletion Mice. Prog. Neuropsychopharmacol. Biol. Psychiatry 2024, 128, 110858. [Google Scholar] [CrossRef]
- Münzberg, H.; Morrison, C.D. Structure, Production and Signaling of Leptin. Metabolism 2015, 64, 13–23. [Google Scholar] [CrossRef]
- Myers, M.G.; Cowley, M.A.; Münzberg, H. Mechanisms of Leptin Action and Leptin Resistance. Annu. Rev. Physiol. 2008, 70, 537–556. [Google Scholar] [CrossRef]
- Yamauchi, T.; Kamon, J.; Minokoshi, Y.; Ito, Y.; Waki, H.; Uchida, S.; Yamashita, S.; Noda, M.; Kita, S.; Ueki, K.; et al. Adiponectin Stimulates Glucose Utilization and Fatty-Acid Oxidation by Activating AMP-Activated Protein Kinase. Nat. Med. 2002, 8, 1288–1295. [Google Scholar] [CrossRef]
- Mao, X.; Kikani, C.K.; Riojas, R.A.; Langlais, P.; Wang, L.; Ramos, F.J.; Fang, Q.; Christ-Roberts, C.Y.; Hong, J.Y.; Kim, R.-Y.; et al. APPL1 Binds to Adiponectin Receptors and Mediates Adiponectin Signalling and Function. Nat. Cell Biol. 2006, 8, 516–523. [Google Scholar] [CrossRef]
- Li, X.-M.; Yan, H.-J.; Guo, Y.-S.; Wang, D. The Role of Leptin in Central Nervous System Diseases. Neuroreport 2016, 27, 350–355. [Google Scholar] [CrossRef]
- Qiu, H.; Yang, J.-K.; Chen, C. Influence of Insulin on Growth Hormone Secretion, Level and Growth Hormone Signalling. Sheng Li Xue Bao 2017, 69, 541–556. [Google Scholar]
- Sheldon, I.M.; Cronin, J.G.; Healey, G.D.; Gabler, C.; Heuwieser, W.; Streyl, D.; Bromfield, J.J.; Miyamoto, A.; Fergani, C.; Dobson, H. Innate Immunity and Inflammation of the Bovine Female Reproductive Tract in Health and Disease. Reproduction 2014, 148, R41–R51. [Google Scholar] [CrossRef]
- Helfer, G.; Tups, A. Hypothalamic Wnt Signalling and Its Role in Energy Balance Regulation. J. Neuroendocrinol. 2016, 28, 12368. [Google Scholar] [CrossRef] [PubMed]
- Timper, K.; Brüning, J.C. Hypothalamic Circuits Regulating Appetite and Energy Homeostasis: Pathways to Obesity. Dis. Model. Mech. 2017, 10, 679–689. [Google Scholar] [CrossRef]





| Ingredients (%) | Starter Phase (1–21 d) | Grower Phase (22–42 d) |
|---|---|---|
| Corn | 52.79 | 57.78 |
| Soybean meal | 36.89 | 30 |
| Soybean oil | 4 | 4 |
| Wheat bran | 2 | 2 |
| Calcium biphosphate | 1.912 | 1.623 |
| Stone powder | 1.222 | 1.171 |
| NaCl | 0.3 | 0.3 |
| Choline chloride | 0.3 | 0.26 |
| DL-methionine | 0.265 | 0.106 |
| Trace element premix 1 | 0.2 | 0.2 |
| L-lysine | 0.038 | 0.045 |
| Vitamin premix 2 | 0.03 | 0.03 |
| Zea gluten meal | 0 | 2.43 |
| Metabolic energy(MJ/kg) | 12.40 | 13.0 |
| Crude protein | 21.18 | 19.84 |
| Lysine | 1.14 | 1.05 |
| Methionine | 0.49 | 0.48 |
| Calcium | 1.02 | 0.85 |
| Available P | 0.45 | 0.42 |
| Total P | 0.69 | 0.63 |
| Threonine | 0.77 | 0.22 |
| Genes | Orientation | Primer Sequence(5′ to 3′) | Length | TM 1 | Accession Number 2 |
|---|---|---|---|---|---|
| GAPDH | Forward | TGCTGCCCAGAACATCATCC | 142 | 61 | NM_204305.2 |
| Reverse | ACGGCAGGTCAGGTCAACAA | ||||
| SLC6A4 | Forward | TGACAGCCACGTTCCCTTAC | 114 | 60 | XM_046903726.1 |
| Reverse | GGAGCTTCTGCCATTCAGGT | ||||
| BSX | Forward | GTCACCCCAAGCCTGAACTT | 152 | 60 | XM_046932258.1 |
| Reverse | TGAAAACCGAGGGGACTTCG | ||||
| GHRH | Forward | TGATGGACAGCCGTTACCAC | 113 | 60 | XM_015296359.4 |
| Reverse | GCTGGGAAACCCCTCTAACC | ||||
| GAL | Forward | ACTGCATCCGTGGGACATTT | 110 | 60 | NM_001145389.3 |
| Reverse | CCCACACACCTCTGCATCTT | ||||
| POMC | Forward | GAGAACAGCAAGTGCCAGGA | 146 | 60 | NM_001398117.1 |
| Reverse | ACGTACTTGCGGATGCTCTC | ||||
| NPY | Forward | CCTTCGATGTGGTGATGGGA | 106 | 59 | NM_205473.2 |
| Reverse | ATGCACTGGGAATGACGCTA | ||||
| AGRP | Forward | ATTGCACCGACGAACTTTGC | 97 | 60 | XM_025154207.3 |
| Reverse | GCTGGCAAGAAATGAACGCA | ||||
| PAX2 | Forward | GGCGAGAAGAGGAAACGTGA | 94 | 60 | XM_025151472.3 |
| Reverse | GAAGGTGCTTCCGCAAACTG |
| Parameter | Day | Experimental Group 1 | p-Value | |||
|---|---|---|---|---|---|---|
| ND | HD | ND-AEE | HD-AEE | |||
| Body weight (g) | 7 | 165.29 ± 4.07 | 166.40 ± 1.02 | 159.78 ± 3.74 | 162.00 ± 3.03 | 0.461 |
| 14 | 455.40 ± 2.48 | 453.14 ± 1.48 | 454.51 ± 3.94 | 453.72 ± 3.73 | 0.958 | |
| 21 | 991.71 ± 8.08 a | 964.17 ± 6.52 b | 978.60 ± 6.26 ab | 992.75 ± 4.67 a | 0.022 | |
| 28 | 1632.40 ± 24.72 a | 1542.47 ± 5.83 b | 1632.90 ± 15.59 a | 1593.33 ± 18.89 ab | 0.007 | |
| 35 | 2372.03 ± 38.85 a | 2113.58 ± 25.82 b | 2416.33 ± 38.79 a | 2182.35 ± 26.38 b | <0.001 | |
| 42 | 3006.84 ± 90.18 a | 2511.22 ± 23.87 b | 3049.47 ± 60.57 a | 2647.44 ± 46.22 b | <0.001 | |
| Average daily gain (g) | 1–7 | 18.28 ± 0.57 | 18.37 ± 0.14 | 17.43 ± 0.54 | 17.81 ± 0.43 | 0.449 |
| 8–14 | 41.44 ± 0.34 | 40.96 ± 0.17 | 42.10 ± 0.55 | 41.67 ± 0.51 | 0.317 | |
| 15–21 | 76.62 ± 1.13 a | 72.97 ± 1.00 b | 74.87 ± 1.36 ab | 75.73 ± 0.90 ab | 0.159 | |
| 22–28 | 92.99 ± 1.76 a | 85.02 ± 2.35 b | 94.80 ± 1.09 a | 92.65 ± 0.95 a | 0.003 | |
| 29–35 | 106.49 ± 1.86 a | 78.59 ± 1.41 b | 111.08 ± 3.58 a | 84.76 ± 1.28 b | <0.001 | |
| 36–42 | 93.63 ± 4.46 a | 56.80 ± 2.99 c | 93.04 ± 2.09 a | 66.12 ± 2.37 b | <0.001 | |
| 1–42 | 72.01 ± 1.19 a | 58.79 ± 0.79 c | 71.83 ± 0.73 a | 62.64 ± 0.90 b | <0.001 | |
| Average daily feed intake (g) | 1–7 | 20.29 ± 0.60 | 20.12 ± 0.25 | 19.67 ± 0.31 | 20.25 ± 0.13 | 0.630 |
| 8–14 | 50.58 ± 0.34 | 50.42 ± 0.07 | 51.74 ± 0.85 | 50.63 ± 0.28 | 0.231 | |
| 15–21 | 93.41 ± 1.93 | 90.45 ± 0.29 | 91.55 ± 1.25 | 92.34 ± 0.25 | 0.358 | |
| 22–28 | 124.77 ± 1.13 a | 119.63 ± 0.85 b | 125.27 ± 1.17 a | 123.11 ± 0.82 a | 0.005 | |
| 29–35 | 178.71 ± 3.74 a | 145.41 ± 1.15 b | 177.12 ± 4.08 a | 149.68 ± 1.17 b | <0.001 | |
| 36–42 | 158.11 ± 6.59 ab | 145.34 ± 2.53 b | 166.37 ± 3.99 a | 148.23 ± 0.82 b | 0.008 | |
| 1–42 | 104.31 ± 1.77 a | 95.23 ± 0.67 b | 105.77 ± 1.30 a | 97.72 ± 0.44 b | <0.001 | |
| Feed conversion ratio (g/g) | 1–7 | 1.11 ± 0.02 | 1.10 ± 0.02 | 1.13 ± 0.02 | 1.14 ± 0.02 | 0.490 |
| 8–14 | 1.22 ± 0.01 | 1.23 ± 0.004 | 1.23 ± 0.01 | 1.22 ± 0.01 | 0.741 | |
| 15–21 | 1.22 ± 0.01 | 1.24 ± 0.02 | 1.22 ± 0.01 | 1.22 ± 0.02 | 0.666 | |
| 22–28 | 1.35 ± 0.03 b | 1.44 ± 0.02 a | 1.33 ± 0.02 b | 1.35 ± 0.03 b | 0.048 | |
| 29–35 | 1.70 ± 0.01 c | 1.85 ± 0.02 a | 1.67 ± 0.02 c | 1.79 ± 0.01 b | <0.001 | |
| 36–42 | 1.77 ± 0.02 c | 2.58 ± 0.13 a | 1.75 ± 0.04 c | 2.24 ± 0.05 b | <0.001 | |
| 1–42 | 1.45 ± 0.02 c | 1.62 ± 0.02 a | 1.47 ± 0.01 c | 1.56 ± 0.02 b | <0.001 | |
| Groups 1 | Raw Reads No. | Clean Reads No. | Clean Reads (%) | Q20 (%) | Q30 (%) | Total Mapped | Uniquely Mapped | Mapped to Gene |
|---|---|---|---|---|---|---|---|---|
| ND | 54,627,494 | 53,590,940 | 98.10 | 98.42 | 95.73 | 51,313,726 (95.75%) | 50,590,855 (98.59%) | 41,199,424 (81.44%) |
| ND | 59,561,068 | 58,377,802 | 98.01 | 98.41 | 95.71 | 56,006,660 (95.94%) | 55,201,661 (98.56%) | 45,369,218 (82.19%) |
| ND | 38,935,978 | 38,159,888 | 98.01 | 98.34 | 95.50 | 36,499,616 (95.65%) | 36,000,012 (98.63%) | 29,367,686 (81.58%) |
| ND | 53,717,526 | 52,641,386 | 98.00 | 98.35 | 95.57 | 50,426,148 (95.79%) | 49,731,343 (98.62%) | 40,102,134 (80.64%) |
| HD | 55,126,948 | 54,012,172 | 97.98 | 98.24 | 95.33 | 51,716,515 (95.75%) | 50,960,061 (98.54%) | 41,851,625 (82.13%) |
| HD | 57,971,320 | 56,861,700 | 98.09 | 98.33 | 95.55 | 54,397,081 (95.67%) | 53,605,331 (98.54%) | 43,806,353 (81.72%) |
| HD | 52,914,462 | 51,848,830 | 97.99 | 98.30 | 95.47 | 49,638,355 (95.74%) | 48,907,266 (98.53%) | 39,821,221 (81.42%) |
| HD | 52,405,628 | 51,378,738 | 98.04 | 98.30 | 95.45 | 49,270,482 (95.90%) | 48,560,595 (98.56%) | 39,948,204 (82.26%) |
| ND-AEE | 96,277,166 | 94,644,780 | 98.30 | 97.94 | 94.43 | 90,487,299 (95.61%) | 89,090,158 (98.46%) | 72,843,917 (81.76%) |
| ND-AEE | 59,467,550 | 58,389,396 | 98.19 | 98.07 | 94.80 | 55,852,055 (95.65%) | 55,057,385 (98.58%) | 44,605,943 (81.02%) |
| ND-AEE | 36,419,636 | 35,667,052 | 97.93 | 98.32 | 95.51 | 34,156,642 (95.77%) | 33,698,525 (98.66%) | 27,414,297 (81.35%) |
| ND-AEE | 59,226,338 | 58,023,966 | 97.97 | 98.25 | 95.34 | 55,618,180 (95.85%) | 54,830,328 (98.58%) | 45,123,700 (82.30%) |
| HD-AEE | 42,148,190 | 41,288,004 | 97.96 | 98.25 | 95.35 | 39,459,283 (95.57%) | 38,890,828 (98.56%) | 32,095,712 (82.53%) |
| HD-AEE | 52,143,530 | 51,121,882 | 98.04 | 98.28 | 95.41 | 48,840,492 (95.54%) | 48,123,218 (98.53%) | 39,620,219 (82.33%) |
| HD-AEE | 58,649,914 | 57,427,750 | 97.92 | 98.22 | 95.27 | 54,935,238 (95.66%) | 54,125,547 (98.53%) | 44,961,555 (83.07%) |
| HD-AEE | 46,643,014 | 45,702,484 | 97.98 | 98.26 | 95.36 | 43,645,127 (95.50%) | 42,994,732 (98.51%) | 35,145,550 (81.74%) |
| Groups | Expression Type | Genes | Description | Log2 Fold Change | p-Value | GO Terms | KEGG Terms |
|---|---|---|---|---|---|---|---|
| ND vs. HD | Upregulated | PAX2 | paired box 2 | 1.35859670192997 | 0.012364407545465 | Anatomical structure development | |
| SLC6A4 | solute carrier family 6 member 4 | 2.32591701032793 | 0.0168377568709956 | Brain development; central nervous system development | |||
| NMU | neuromedin U | 2.84911998315659 | 0.0235247051040035 | Neuropeptide receptor binding; feeding behavior | Neuroactive ligand–receptor interaction | ||
| Downregulated | BSX | brain specific homeobox | −2.84526873595193 | 0.000768191298709178 | Nervous system development; brain development; feeding behavior | ||
| GHRH | growth hormone–releasing hormone | −1.79719156328328 | 0.0112923940240136 | Hormone activity | |||
| GAL | galanin and GAMP prepropeptide | −1.96984201020936 | 0.0159764943487804 | Nervous system development; feeding behavior | Neuroactive ligand–receptor interaction | ||
| POMC | proopiomelanocortin | −4.11476242453669 | 0.0253199901809521 | Neuropeptide receptor binding; hormone activity | Neuroactive ligand–receptor interaction; adipocytokine signaling pathway; melanogenesis | ||
| NPY | neuropeptide Y | −1.3453977903136 | 0.0296508934963984 | Neuron differentiation; feeding behavior | Neuroactive ligand–receptor interaction; adipocytokine signaling pathway | ||
| HD vs. HD–AEE | Upregulated | POMC | proopiomelanocortin | 4.95937427051282 | 0.0000731210766572 | Neuropeptide receptor binding; melanocortin receptor binding | Neuroactive ligand–receptor interaction; adipocytokine signaling pathway; melanogenesis |
| AGRP | agouti–related peptide | 4.67024721779006 | 0.00437397674819453 | Feeding behavior; melanocortin receptor binding | Adipocytokine signaling pathway | ||
| GAL | galanin and GMAP prepropetide | 2.48206229418743 | 0.00885532689389276 | Feeding behavior; neuropeptide receptor binding | Neuroactive ligand–receptor interaction; adipocytokine signaling pathway; melanogenesis | ||
| BSX | brain–specific homeobox | 3.15582202791072 | 0.00971339458154058 | Nervous system development; feeding behavior | |||
| NPY | neuropeptide Y | 0.990330132410699 | 0.0430652490292915 | Feeding behavior; nervous system development | Neuroactive ligand–receptor interaction; adipocytokine signaling pathway | ||
| GHRH | growth hormone–releasing hormone | 1.88699917744512 | 0.0444791550523927 | Receptor regulator activity; signaling receptor binding | |||
| Downregulated | PAX2 | paired box 2 | −1.21653626578342 | 0.0496875384577193 | Animal organ development; biological regulation |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, X.; Zhang, Y.; Bai, D.; Zhen, W.; Guo, C.; Wang, Z.; Ma, P.; Ma, X.; Xie, X.; Ito, K.; et al. Aspirin Eugenol Ester Modulates the Hypothalamus Transcriptome in Broilers Under High Stocking Density. Animals 2025, 15, 823. https://doi.org/10.3390/ani15060823
Zhao X, Zhang Y, Bai D, Zhen W, Guo C, Wang Z, Ma P, Ma X, Xie X, Ito K, et al. Aspirin Eugenol Ester Modulates the Hypothalamus Transcriptome in Broilers Under High Stocking Density. Animals. 2025; 15(6):823. https://doi.org/10.3390/ani15060823
Chicago/Turabian StyleZhao, Xiaodie, Yi Zhang, Dongying Bai, Wenrui Zhen, Caifang Guo, Ziwei Wang, Penghui Ma, Xiqiang Ma, Xiaolin Xie, Koichi Ito, and et al. 2025. "Aspirin Eugenol Ester Modulates the Hypothalamus Transcriptome in Broilers Under High Stocking Density" Animals 15, no. 6: 823. https://doi.org/10.3390/ani15060823
APA StyleZhao, X., Zhang, Y., Bai, D., Zhen, W., Guo, C., Wang, Z., Ma, P., Ma, X., Xie, X., Ito, K., Zhang, B., Yang, Y., Li, J., & Ma, Y. (2025). Aspirin Eugenol Ester Modulates the Hypothalamus Transcriptome in Broilers Under High Stocking Density. Animals, 15(6), 823. https://doi.org/10.3390/ani15060823

