Genetic Diversity and Population Structure of Largefin Longbarbel Catfish (Hemibagrus macropterus) Inferred by mtDNA and Microsatellite DNA Markers
by
,
Yanling Hou
1,†,
Huan Ye
1,2,†,
Huamei Yue
2,
Junyi Li
2,
Ling Huang
2,
Ziling Qu
2,
Rui Ruan
2,
Danqing Lin
3,
Zhiqiang Liang
4,
Yong Xie
5 and
Chuangju Li
1,2,* 1
College of Fisheries and Life Sciences, Shanghai Ocean University, Shanghai 201306, China
2
Key Laboratory of Freshwater Biodiversity Conservation, Ministry of Agriculture and Rural Affairs, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, China
3
Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture and Rural Affairs, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, China
4
Hunan Fisheries Science Institute, Changsha 410153, China
5
Chongqing Fishery Sciences Research Institute, Chongqing 400020, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Animals 2025, 15(6), 770; https://doi.org/10.3390/ani15060770
Submission received: 24 January 2025
/
Revised: 4 March 2025
/
Accepted: 6 March 2025
/
Published: 8 March 2025
(This article belongs to the Section Animal Genetics and Genomics)
Simple Summary
Understanding the genetic background of populations is crucial for their commercial exploitation and conservation. This study analyzed the genetic diversity and population structure of seven wild populations and one stock seed population of the largefin longbarbel catfish (Hemibagrus macropterus). The genetic diversity parameters indicated that the largefin longbarbel catfish maintains high genetic diversity. Furthermore, significant genetic differentiation was observed between the population in the upper reaches of the Yangtze River and the other populations. These findings provide essential genetic information for the development of genetic breeding programs and the conservation of wild resources of the largefin longbarbel catfish.
Abstract
The largefin longbarbel catfish (Hemibagrus macropterus), a freshwater species endemic to China with fundamental economic importance, requires investigation into its genetic structure for effective management. In this study, we employed mitochondrial cytochrome b (Cytb) gene sequences and 14 microsatellite loci to elucidate the genetic structure of 195 individuals across eight distinct populations. The Cytb analysis revealed a haplotype number (H) of 31, haplotype diversity (Hd) of 0.853, and nucleotide diversity (π) of 0.0127. Population neutrality tests indicated that Tajima’s D (−0.59467) and Fu and Li’s D* (0.56621) were not statistically significant, and the mismatch distribution exhibited a multimodal pattern. Microsatellite analysis revealed that the mean number of alleles (Na), observed heterozygosity (Ho), and polymorphic information content (PIC) across all loci were 18.500, 0.761, and 0.808, respectively. The UPGMA phylogram constructed based on genetic distance identified two distinct clusters, with paired Fst values ranging from 0.108 to 0.138. These results suggest that the largefin longbarbel catfish is in a state of dynamic equilibrium with high genetic diversity. Furthermore, there was significant genetic differentiation between the YB population and the other seven populations, indicating that the population in the upper reaches of the Yangtze River should be managed as a distinct unit.
1. Introduction
The largefin longbarbel catfish (Hemibagrus macropterus), a member of the Bagridae family comprising over 220 species [1], is an endemic, medium-sized benthic fish native to China, predominantly found in the Yangtze and Pearl River basins [2]. This species is highly valued for its tender flesh, minimal bone spurs, and significant nutritional benefits, making it an economic fish with substantial demand, particularly in Southwest China [3], where the market price is as high as CNY 100–200 per kilogram. This species was assessed as Least Concern according to the IUCN Red List of Threatened Species in 2011, nonetheless, recent years have witnessed a decline in its wild populations due to anthropogenic activities such as overfishing, water pollution, habitat destruction, and dam construction, which have collectively resulted in a reduction in breeding individuals, degradation of habitats and spawning sites, and a consequent sharp decline in its natural resources. To address the burgeoning market demand, researchers have been engaged in developing artificial propagation techniques for the largefin longbarbel catfish since the 1990s, achieving notable advancements in recent times [4,5,6]. Currently, the majority of largefin longbarbel catfish available in the Chinese market come from commercial aquaculture with an annual output of dozens of tons, and the breeding scale reaches several hundred thousand. Meanwhile, a portion of these artificially bred individuals are utilized for release into the wild as part of efforts to restore the natural resources of largefin longbarbel catfish. During the domestication process, intense artificial selection and the insufficient introduction of new parental stock have resulted in a limited number of parental individuals sustaining the population. This scenario potentially gives rise to reduced genetic diversity and the accumulation of deleterious genetic variations, resulting in the degradation of germplasm resources [7].
Genetic diversity, or polymorphism, arises from the variation in genetic material among individuals within the same species [8]. It is fundamental to the adaptability of populations, equipping them with the capacity to confront survival challenges [9,10]. The advent and advancement of molecular biology have introduced a range of genetic markers, such as mitochondrial DNA (mtDNA) [11], random amplified polymorphic DNAs (RAPDs) [12], restriction fragment length polymorphisms (RFLPs) [13], amplified fragment length polymorphisms (AFLPs) [14], simple sequence repeats (SSRs) [15], and single nucleotide polymorphism (SNP) [16], which are extensively utilized in genetic research across various organisms, significantly advancing the field of population genetics [17,18].
Due to its straightforward structure, matrilineal mode of inheritance, moderate rate of evolution, and sensitivity to phylogenetic information [19], mtDNA has been extensively employed in the investigation of genetic diversity and the historical dynamics of populations, as exemplified by studies on Megalobrama skolkovii [19], Acrossocheilus [20], and Hemibagrus guttatus [21]. Furthermore, SSRs are widespread across the genomes of both prokaryotic and eukaryotic organisms, comprising tandem repeats of 1–6 nucleotides [22]. This marker is characterized by their high informational content, locus specificity, significant intraspecific polymorphism, and co-dominant inheritance. As a result, they have been widely utilized in research concerning genetic diversity, population genetic structure, molecular breeding, paternity testing, and gene flow assessment in aquatic species, such as Hypophthalmichthys molitrix [23] and Pelteobagrus fulvidraco [24]. The integration of mtDNA and SSRs has been utilized to investigate the genetic structure of numerous aquatic organisms within the Yangtze River, including Leiocassis longirostris [25], Coilia [26], and Eriocheir sinensis [27]. However, in the case of the largefin longbarbel catfish, research has been limited to a single study conducted in 2009, which employed the Cytb gene to analyze the genetic structure and geographical differentiation among 12 populations comprising 96 specimens [28].
The genome of the largefin longbarbel catfish has been assembled at the chromo-some level (CNGBdb accession No. PRJCA019452) [29], thereby offering valuable genetic resources for research. However, its genetic structure has yet to be investigated using genomic approaches. Therefore, a comprehensive study is necessary to elucidate the population structure of the largefin longbarbel catfish, which is essential for informing breeding programs and the conservation of wild resources.
In this study, a fragment of Cytb gene and 14 microsatellite markers were employed to assess the genetic diversity and population structure of seven wild populations and one seed stock population of the largefin longbarbel catfish. The findings are anticipated to offer valuable insights for artificial breeding programs, artificial release initiatives, and the recovery and management of wild populations.
2. Materials and Methods
2.1. Sample Collection and DNA Extraction
A total of 195 specimens were collected from seven distinct localities within the Yangtze River and Pearl River basins, as well as from a seed stock population at the Largefin Longbarbel Catfish Foundation Seed Farm, affiliated with the Fisheries Science Institute of Chongqing (Figure 1, Table 1). Fin rays, preserved in 100% ethanol, or blood samples were obtained from fresh specimens and subsequently stored at −20 °C. Genomic DNA was extracted from each specimen using the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 (TaKaRa, Kusatsu City, Shiga Prefecture, Japan). The concentration and quality of the extracted DNA were assessed using a NanoDrop 8000 spectrophotometer (Thermo Fisher Scientific, Carlsbad, CA, USA) and 1% agarose gel electrophoresis, respectively. The DNA was then stored at −20 °C for future experimental procedures.
2.2. Amplication of Cytb Gene Sequence in Largefin Longbarbel Catfish
Universal primers L 14724 (5′-GACTTGAAAAACCACCGTTG-3′) and H 15915 (5′-CTCCGATCTCCGGATTACAAGAC-3′) were applied to amplify the Cytb gene fragment via PCR, as described in previous studies [30]. The PCR mixture comprised 2 × Taq PCR Master Mix (Vazyme Biotech Co., Ltd., Nanjing, China), 20 ng of DNA template, and 10 pmol of each primer, with a total reaction volume of 20 μL. PCR amplification was conducted under the following conditions: an initial denaturation at 95 °C for 5 min, followed by 35 cycles of amplification (95 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s), and a final extension at 72 °C for 5 min. The quality of each PCR product was evaluated by 1% agarose gel electrophoresis, followed by sequencing on an ABI3730xl DNA analyzer (Applied Biosystems, Inc., Carlsbad, CA, USA).
2.3. Microsatellite Amplification and Typing in Largefin Longbarbel Catfish
SSR analysis was conducted on the transcriptome data of the largefin longbarbel catfish, resulting in the selection of 200 SSR loci. Primers for these loci were designed using Primer Premier v5.0 [31]. The specificity, stability, and polymorphism of the loci were evaluated by randomly selecting 10 individuals, leading to the identification of suitable loci. Forward primers labeled with fluorescent dyes (TAMRA, FAM, or HEX) at the 5′ end were utilized for PCR amplification to produce fluorescently labeled PCR products. The PCR amplification was executed using the VeritiPro™ Thermal Cycler, 384-well (Thermo Scientific, Waltham, MA, USA), with a reaction mixture containing 1 µL of sample DNA (~20 ng), 5 µL of 2 × Taq Master Mix (Vazyme), 0.5 µL of each primer, and 3 µL of double-distilled water. The thermal cycling conditions were as follows: an initial denaturation at 95 °C for 5 min; followed by 35 cycles of 30 s at 95 °C, 30 s at 52 °C to 62 °C, and 30 s at 72 °C; with a final extension at 72 °C for 10 min. To ensure primer specificity and uniformity of the PCR product, 2 µL of the PCR product was subjected to agarose gel electrophoresis at a 1% concentration following PCR amplification. The efficiency and specificity of amplification for each primer were assessed based on the intensity and pattern of the bands, respectively. PCR products were analyzed using an ABI 3730xL DNA Analyzer (Applied Biosystems), and the resulting data were processed with GeneMarker® HTS v 2.5.0 software [32].
2.4. Data Analysis of Cytb in Largefin Longbarbel Catfish
The genetic diversity indices of the Cytb gene, including the number of sequences, number of haplotypes (h), haplotype diversity (Hd), and nucleotide diversity (π), were evaluated using DNAsp v5.0 [33]. Genetic distances between different populations were calculated using the Kimura-2-parameter distance model (K2P) in MEGA v7.0 software [34]. A network of haplotype relationships was constructed using the Median-Joining model [35]. Analysis of molecular variance (AMOVA) was conducted to determine the distribution of genetic variation within and among populations, and pairwise genetic differentiation indices (Fst) were calculated between populations using Arlequin v3.5 software [36]. Neutrality tests were performed using Tajima’s D and Fu’s Fs statistics [37].
2.5. Data Analysis of SSR in Largefin Longbarbel Catfish
The polymorphic information content (PIC) of each locus and the genetic diversity indices for each population, including the number of observed alleles (Na), number of effective alleles (Ne), observed heterozygosity (Ho), and expected heterozygosity (He), were calculated using the software packages Cervus v3.0 [38], GenAlEx v6.501 [39], or Genepop v4.0 [40]. Nei’s genetic distance (Nei, 1983) among all populations was calculated from allele frequencies using PowerMarker v3.25, and based on the Nei’s genetic distance matrix, cluster analysis was conducted employing the unweighted pair group method with arithmetic means method (UPGMA). To evaluate genetic variation within individuals and populations, as well as between populations, analysis of molecular variance (AMOVA) was performed, and paired genetic differentiation coefficients were calculated. Principal Coordinate Analysis (PCoA) was utilized to illstrate the similarities or differences among related populations, using GenAlEx v6.501 and Arlequin v3.5. Genetic clustering patterns were assessed using a Bayesian model implemented in STRUCTURE v2.3.4 [41]. The value of K was set to vary from 1 to 20. For each value of K, analyses were conducted 20 times, incorporating a burn-in period of 10,000 iterations followed by 100,000 iterations of the Markov Chain Monte Carlo (MCMC) method. Subsequently, the ΔK value was computed to ascertain the most appropriate number of genetic clusters, as indicated by the ΔK metric.
3. Results
3.1. Genetic Diversity
3.1.1. Genetic Diversity of Cytb in Largefin Longbarbel Catfish
A total of 31 haplotypes were identified from 195 individuals based on the Cytb gene (Table 2). The haplotype diversity (Hd) varied from 0.154 in the YB population to 0.887 in the HH population, with an overall haplotype diversity of 0.853. Nucleotide diversity (π) ranged from 0.0005 in the YS population to 0.0108 in the YC population, with an overall nucleotide diversity of 0.0127 (Table 3). The number of haplotypes per population ranged from 2 to 15, with the YB population exhibiting the fewest haplotypes (h = 2) and the HH population displaying the most (h = 15), suggesting that the HH population possesses the highest genetic diversity, whereas the YB population exhibits the lowest genetic diversity.
3.1.2. SSRs Polymorphism and Genetic Variation in Largefin Longbarbel Catfish
Following the detection of primers, 14 SSR loci capable of stable amplification were identified (Table 4). Utilizing these 14 pairs of microsatellite primers, a total of 259 alleles were detected across 195 individuals from eight distinct populations of the largefin longbarbel catfish. The number of alleles (Na) ranged from 9 (Hem002) to 44 (Hem041), with an average of 18.500. The effective number of alleles (Ne) varied from 2.599 (Hem002) to 13.787 (Hem041), with an average of 7.488. Observed heterozygosity (Ho) ranged from 0.495 to 0.928, with an average value of 0.761, while expected heterozygosity (He) varied from 0.615 to 0.927, with an average of 0.828. All 14 microsatellite markers exhibited high levels of polymorphism, as indicated by polymorphic information content (PIC) values ranging from 0.557 to 0.923, with an average of 0.808 (Table 5).
The number of alleles (Na) across all populations ranged from 6.786 in the YB population to 11.857 in the HH population, while the effective number of alleles (Ne) ranged from 4.393 in the YB population to 7.457 in the HH population. Observed heterozygosity (Ho) varied from 0.697 in the YB population to 0.830 in the HH population, and expected heterozygosity (He) ranged from 0.706 in the CQSS population to 0.831 in the HH population (Table 6).
3.2. Genetic Differentiation and Population Structure
3.2.1. Genetic Differentiation and Population Structure Based on Cytb
The genetic distance among the eight populations varied from 0.0624 (YB/HH) to 0.0014 (SS/WH), while pairwise Fst values ranged from −0.0333 (YC/CQSS) to 0.9137 (YB/YS) (Table 7). Among those, the HH and YB populations exhibiting significant genetic differentiation from other populations (Fst > 0.25). The AMOVA analysis of the Cytb gene indicated that 65.65% of the genetic variation was attributable to differences among populations, whereas 34.35% occurred within populations, suggesting that the genetic differences primarily originated from inter-population variation (Table 8).
Network analysis illustrated the frequency and distribution of Cytb gene haplotypes (Figure 2). Haplotype 2 and Haplotype 6 emerged as the most prevalent, both appearing in six populations. The YS population exhibited four distinct haplotypes, two of which were shared with populations in the middle and lower reaches of the Yangtze River, indicating a relatively close genetic relationship between the Pearl River population and those in the middle and lower Yangtze River. HH population may have spread from the populations in the middle reaches of Yangtze River, and the diffused population had differentiated into new haplotypes.
3.2.2. Genetic Differentiation and Population Structure Based on SSR
The result of genetic differentiation analysis of eight populations showed that the paired Fst values were between 0.011 (SS/WH) and 0.138 (YB/NJ), indicating low to moderate differentiation among different populations and the genetic differentiation between YB and NJ population was the most significant (Table 9). The gene flow (Nm) among eight populations ranged from 1.557 (YB/NJ) to 23.383 (SS/WH), indicating that the gene flow among populations was at a low or medium level, with the largest gene flow between SS population and other populations (1.702~23.383) and the smallest gene flow between YB population and other populations (1.702~2.071).
The maximum genetic distance among eight populations was 0.827 (YB/WH) and the minimum genetic distance was 0.226 (SS/WH) (Table 10). The unweighted paired average method (UPGMA) based on Nei genetic distance was used for cluster analysis. The UPGMA phylogram showed that there were two branches, YB population was located in one independent branch, and the other seven populations were located in another independent branch (Figure 3).
The result of principal coordinate analysis (PCoA) was consistent with the result of UPGMA phylogram. YB population formed a single cluster, while other populations formed the other cluster (Figure 4). The results of molecular variance analysis (AMOVA) showed that 7% of the genetic variation occurred between populations, 3% among individuals, and 90% within individuals, and the genetic variation within individuals was the main source of the total variation (Table 11). To further understand the clustering situation of largefin longbarbel catfish, each individual was analyzed based on likelihood function. The value of ∆K reached the maximum at K = 5, indicating that all individuals were most likely to be classified into five clusters (Figure 5 and Figure S1). Among them, the populations in the middle and lower reaches of the Yangtze River were clustered into a subgroup, and the other four populations were each a subgroup.
3.3. Demographic History
When the seven wild populations were regarded as a whole for neutral test, Tajima’s D was −0.52814 (p > 0.1) and Fu and Li’s D* was 0.56938 (p > 0.1), both of which were small and had no statistical significance, indicating that the Cytb sequence of largefin longbarbel catfish followed the neutral model in evolution. Meanwhile, mismatch distribution analysis showed multi-peaks, which indicated that the wild largefin longbarbel catfish was in a state of dynamic balance and had not experienced population bottleneck or population expansion recently (Figure 6).
4. Discussion
Understanding the level of genetic diversity within a species is crucial for assessing its adaptive potential in response to environmental changes [42]. It also serves as a prerequisite for the sustainable utilization of germplasm resources [27]. Information regarding population structure offers valuable scientific insights for the management and conservation of different populations and contributes to the study of biogeography [28]. In this study, high level of genetic diversity and a low to moderate level of genetic differentiation among populations of the largefin longbarbel catfish were revealed.
4.1. Genetic Diversity
Haplotype diversity and nucleotide diversity serve as crucial metrics for assessing the genetic variation in mitochondrial DNA, providing insights into the level of genetic diversity based on their numerical values [42]. A population is deemed to have low genetic diversity when its haplotype diversity is below 0.5 and its nucleotide diversity index is less than 0.005 [43]. In the present study, the haplotype diversity and nucleotide diversity of eight populations of largefin longbarbel catfish were found to be 0.853 and 0.0127, respectively, suggesting a high level of genetic diversity. When compared to the genetic diversity of other aquatic organisms based on the Cytb gene, such as Leiocassis longirostris (Hd = 0.5417) [44], Megalobrama amblycephala (Hd = 0.768) [42], and Pangasius bocourti (Hd = 0.742) [45], the genetic diversity indices of the largefin longbarbel catfish are relatively high. Furthermore, the 14 microsatellite loci employed in this study exhibited a high degree of polymorphism (PIC > 0.5), underscoring their substantial utility for genetic diversity analysis [46]. In the context of microsatellite sequence analysis, heterozygosity serves as a crucial parameter for assessing population genetic diversity [43]. Compared to the heterozygosity observed in microsatellites of other freshwater fish species in China, the largefin longbarbel catfish exhibited higher observed alleles (Na = 18.500) and observed heterozygosity (Ho = 0.761) than Hypophthalmichthys nobilis (Na = 11.333, Ho = 0.718) [46], Mylopharyngodon piceus (Na = 7.6, Ho = 0.744) [47], and Hypophthalmichthys molitrix (Na = 11.857, Ho = 0.521) [48]. These findings suggest that the largefin longbarbel catfish currently maintains a high level of genetic diversity, corroborating the results obtained from Cytb gene sequence analysis. Despite the significant decline in wild populations of the largefin longbarbel catfish in recent decades, the species retains substantial genetic diversity, indicating its high adaptive potential and relatively low danger of reduced genetic diversity in researched populations, including the stock population (CQSS).
Among the eight populations of Hemibagrus macropterus, the YB population exhibited the lowest genetic diversity, potentially attributable to its relatively small sample size of 13 individuals compared to other populations. The genetic diversity indices of a population are often correlated with sample size, with larger samples generally exhibiting higher genetic diversity [49]. Historically, the largefin longbarbel catfish constituted a significant portion of the catch in the upper reaches of the Yangtze River, contributing to a substantial yield [5]. Overfishing may therefore be a contributing factor to the reduced genetic diversity observed in the YB population. Conversely, the HH population demonstrated the highest level of genetic diversity, which may be linked to its proximity to the National Aquatic Germplasm of Largefin longbarbel catfish Conservation Zone in Yuanjiang. Scientific management and protection system in the conservation zone, including protection facilities construction, resource protection, and ecological restoration, may contribute to the high genetic diversity of HH population.
4.2. Genetic Structure
The genetic differentiation coefficient (Fst) serves as a crucial index for assessing the extent of genetic divergence among populations [43]. Analyses of paired genetic differentiation coefficients derived from the Cytb gene and microsatellite markers indicate significant genetic differentiation between the YB population and the other seven populations. The construction of the Gezhouba and Three Gorges Dams has isolated the upper reaches of the Yangtze River, creating a distinct environment that likely contributes to this genetic divergence. Studies on the genetic structure of other Bagridae fishes, such as Pelteobagrus fulvidraco [50], Hemibagrus guttatus [51], and Leiocassis longirostris [52], further corroborate the substantial impact of these dams. Additionally, historical evidence suggests that the upper and mid-lower reaches of the Yangtze River were once separate rivers, which may have also influenced the genetic structure of the largefin longbarbel catfish [28]. However, the small sample size of YB population may affect the representativeness of haplotype distribution, thus adversely affecting the analysis results of population structure [49,53], so a larger sample size is necessary in future studies.
The haplotype network analysis based on the Cytb gene and the structural diagrams derived from microsatellite data both indicated that the genetic relationship between the HH population and the other three populations in the middle reaches of the Yangtze River is relatively distant. This genetic divergence may be attributed to the ecological preferences of the largefin longbarbel catfish. The HH population was sampled from Yuanjiang, a tributary of the Yangtze River that traverses Dongting Lake before joining the main river. Given that the largefin longbarbel catfish typically inhabits rapid-flow environments [28], Dongting Lake likely acts as a barrier to its dispersal [54], potentially increasing the genetic distance between the HH population and other populations in the middle reaches of the Yangtze River.
It is noteworthy that the genetic differentiation between the YS population in the Pearl River basin and populations in the mid-lower reaches of the Yangtze River is minimal. The YS population was sampled from the Lijiang River, a tributary of the Pearl River. Since 214 BC, when the Lingqu Canal was constructed and opened for navigation, the Lijiang River and the Yangtze River basins have been interconnected [55,56], potentially facilitating gene flow among largefin longbarbel catfish across these basins [28]. Furthermore, as a species of commercial significance, modern trade practices could facilitate genetic exchange between the Yangtze River and Pearl River basins. Given the relatively close proximity between HH and YS, the impact of contemporary trade may be more pronounced. Additionally, certain individuals from the CQSS population have been utilized for artificial release in the Yangtze River basin, potentially resulting in introgression from the CQSS population into the YB and YC populations.
5. Conclusions
In this study, the genetic background of both wild and stock seed populations was analyzed using mtDNA and SSRs, providing a comprehensive examination of the genetic diversity and structure across different populations. Our findings indicate that the largefin longbarbel catfish exhibits high genetic diversity, with significant genetic differentiation observed between the YB population and other populations. This may suggest that the population in the upper reaches of the Yangtze River should be managed and conserved as a management unit. Additionally, these findings offer scientific guidance for selecting parent stock for artificial propagation. For future research, it is essential to incorporate a greater number of sampling locations and increase the sample size. Additionally, the genomic data of the largefin longbarbel catfish facilitate the application of genomic approaches, including SNPs and structural variation.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani15060770/s1, Figure S1: K value change diagram of Hemibagrus macropterus based on SSR.
Author Contributions
Conceptualization, H.Y. (Huan Ye) and C.L.; formal analysis, Y.H. and H.Y. (Huan Ye); funding acquisition, H.Y. (Huan Ye); Investigation, H.Y. (Huamei Yue), J.L., L.H., Z.Q., R.R. and D.L.; methodology, H.Y. (Huan Ye), H.Y. (Huamei Yue) and Z.L.; project administration, C.L.; resources, D.L., Z.L. and Y.X.; software, J.L., L.H., Z.Q. and R.R.; supervision, C.L.; validation, Y.H. and Y.X.; visualization, Y.H.; writing—original draft, Y.H.; writing—review and editing, Huan Ye. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the National Key R&D Program of China (2022YFD2400101) and Central Public-Interest Scientific Institution Basal Research Fund, CAFS (Nos. 2022XT0301 and 2023TD23).
Institutional Review Board Statement
The animal study protocol was approved by the Laboratory Animal Center of the Yangtze River Fisheries Research Institute of the Chinese Academy. of Fishery Sciences, and the approval number is YFI2023YH02, and the approval date is 1 April 2023.
Informed Consent Statement
Not applicable.
Data Availability Statement
The data are contained in the article.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Ferraris, C.J. Checklist of catfishes, recent and fossil (Osteichthyes: Siluriformes), and catalogue of siluriform primary types. Zootaxa 2007, 1418, 1–628. [Google Scholar] [CrossRef]
- Ba, J.; Li, Y.; Jia, X.; Wang, D.; Duan, X.; Chen, D. Characterization and cross-species amplification of 19 polymorphic microsatellite loci of Hemibagrus macropterus (Bleeker) in the Yangtze River. Conserv. Genet. Resour. 2015, 7, 5–8. [Google Scholar] [CrossRef]
- Zhang, M.; Liu, W.; Li, G. Isolation and characterisation of collagens from the skin of largefin longbarbel catfish (Mystus macropterus). Food Chem. 2009, 115, 826–831. [Google Scholar] [CrossRef]
- Ma, Y.; Zhu, J.; Chen, Y.; Xie, Y.; Zhang, F. Study on artificial propagation and seed cultivation of Mystus macropterus. Chongqing Fish 2012, 2, 20–22. (In Chinese) [Google Scholar]
- Li, X.; Zhu, Y.; Yang, D.; Wu, X.; Li, X.; Zhu, T.; Meng, Z.; Shi, Z.; Zhang, Y. Research progress and prospect of artificial propagation of Mystus macropterus. Fish. Sci. Technol. Inf. 2023, 50, 128–132. (In Chinese) [Google Scholar]
- Li, X.; Wu, X.; Li, X.; Wei, N.; Jiang, M.; Zhu, Y.; Zhu, T. Effect of different opening diet on the growth, the structure of the digestive tract and digestive enzyme activity of larval and juvenile Mystus macropterus. Biology 2024, 13, 749. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Mou, C.; Zhou, J.; Ye, H.; Wei, Z.; Ke, H.; Huang, Z.; Duan, Y.; Zhao, Z.; Zhao, H.; et al. Genetic diversity of Chinese longsnout catfish (Leiocassis longirostris) in four farmed populations based on 20 new microsatellite DNA markers. Diversity 2022, 14, 654. [Google Scholar] [CrossRef]
- Ellegren, H.; Galtier, N. Determinants of genetic diversity. Nat. Rev. Genet. 2016, 17, 422–433. [Google Scholar] [CrossRef]
- Stoffel, M.A.; Johnston, S.E.; Pilkington, J.G.; Pemberton, J.M. Genetic architecture and lifetime dynamics of inbreeding depression in a wild mammal. Nat. Commun. 2021, 12, 2972. [Google Scholar] [CrossRef]
- Moises, E.; Tomr, B.; Lucas, C.; Gillespie, L.; Hateley, S.; Kyriazis, C.C.; Lang, P.L.M.; Leventhal, L.; Nogues-Bravo, D.; Pagowski, V.; et al. Genetic diversity loss in the Anthropocene. Science 2022, 377, 1431–1435. [Google Scholar]
- Ikpeme, E.; Ekerette, E.; Ozoje, M. 220 Mitochondrial DNA polymorphism as a measure of genetic diversity in African tilapia fish. J. Anim. Sci. 2019, 97, 47–48. [Google Scholar] [CrossRef]
- Mishra, A.K.; Lakra, W.S.; Bhatt, J.P.; Goswami, M.; Nagpure, N.S. Genetic characterization of two hill stream fish species Barilius bendelisis (Ham. 1807) and Barilius barna (Ham. 1822) using RAPD markers. Mol. Biol. Rep. 2012, 39, 10167–10172. [Google Scholar] [CrossRef] [PubMed]
- Apostolidis, A.; Moutou, K.; Stamatis, C.; Mamuris, Z. Genetic structure of three marine fishes from the Gulf of Pagasitikos (Greece) based on allozymes, RAPD, and mtDNA RFLP markers. Biologia 2009, 64, 1005–1010. [Google Scholar] [CrossRef]
- Takahashi, H.; Takeshita, N.; Tanoue, H.; Ueda, S.; Takeshima, H.; Komatsu, T.; Kinoshita, I.; Nishida, M. Severely depleted genetic diversity and population structure of a large predatory marine fish (Lates japonicus) endemic to Japan. Conserv. Genet. 2015, 16, 1155–1165. [Google Scholar] [CrossRef]
- Diyie, R.L.; Agyarkwa, S.K.; Armah, E.; Amonoo, N.A.; Owusu-Frimpong, I.; Osei-Atweneboana, M.Y. Genetic variations among different generations and cultured populations of Nile Tilapia (Oreochromis niloticus) in Ghana: Application of microsatellite markers. Aquaculture 2021, 544, 737070. [Google Scholar] [CrossRef]
- Cui, R.; Huang, J.; Wang, S.; Zhang, X. Whole-genome resequencing reveals genetic diversity and selection signatures in five populations of Mandarin Fish (Siniperca chuatsi). Aquac. Rep. 2024, 39, 102406. [Google Scholar] [CrossRef]
- Liu, Z.J.; Cordes, J.F. DNA marker technologies and their applications in aquaculture genetics. Aquaculture 2004, 238, 1–37. [Google Scholar] [CrossRef]
- Panchariya, D.C.; Dutta, P.; Ananya; Chawade, A.; Nayee, N.; Azam, S.; Gandham, R.K.; Majumdar, S.; Kushwaha, S.K. Genetic marker: A genome maping tool to decode genetic diversity of livestock animals. Front. Genet. 2024, 15, 1463474. [Google Scholar] [CrossRef]
- Chen, J.; Wang, W. Genetic diversity and genetic differentiation of Megalobrama populations inferred by mitochondrial markers. Genes Genom. 2021, 43, 1119–1132. [Google Scholar] [CrossRef]
- Zhou, M.Y.; Wang, J.J.; Ren, J.F.; Li, F.; Wu, J.X.; Zhou, J.J.; Li, J.L.; Yang, J.Q.; Lin, H.D. Historical landscape evolution shaped the phylogeography and population history of the cyprinid fishes of Acrossocheilus (Cypriniformes: Cyprinidae) according to mitochondrial DNA in Zhejiang Province, China. Diversity 2023, 15, 425. [Google Scholar] [CrossRef]
- Kuang, T.; Shuai, F.; Li, X.; Chen, W.; Lek, S. Genetic diversity and population structure of Hemibagrus guttatus (Bagridae, Siluriformes) in the larger subtropical Pearl River based on COI and Cyt b genes analysis. Ann. Limnol.-Int. J. Lim. 2021, 57, 7. [Google Scholar] [CrossRef]
- Tautz, D.; Renz, M. Simple sequences are ubiquitous repetitive components of eukaryotic genomes. Nucleic Acids Res. 1984, 12, 4127–4138. [Google Scholar] [CrossRef]
- Luo, Y.T.; Fang, D.A.; Zhou, Y.F.; Xu, D.P.; Peng, Y.X.; Zhang, M.Y.; Mao, C.C.; Tang, X.X.; Xu, J.; You, Y. Genetic diversity, habitat relevance and conservation strategies of the silver carp in the Yangtze River by simple sequence repeat. Front. Ecol. Evol. 2022, 10, 850183. [Google Scholar] [CrossRef]
- Guo, W.; Guo, C.; Wang, Y.; Hu, W.; Mei, J. Population structure and genetic diversity in yellow catfish (Pelteobagrus fulvidraco) assessed with microsatellites. J. Genet. 2019, 98, 26. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; He, K.; Xiang, P.; Wang, X.; Tong, L.; Wei, Z.; Zhang, X.; Song, Z. Temporal genetic variation of the Chinese longsnout catfish (Leiocassis longirostris) in the upper Yangtze River with resource decline. Environ. Biol. Fishes 2022, 105, 1139–1151. [Google Scholar] [CrossRef]
- Xuan, Z.; Jiang, T.; Liu, H.; Chen, X.; Yang, J. Mitochondrial DNA and microsatellite analyses reveal strong genetic differentiation between two types of estuarine tapertail anchovies (Coilia) in Yangtze River Basin, China. Hydrobiologia 2021, 848, 1409–1431. [Google Scholar] [CrossRef]
- Zhou, L.; Gao, J.; Yang, Y.; Nie, Z.; Liu, K.; Xu, G. Genetic diversity and population structure analysis of Chinese mitten crab (Eriocheir sinensis) in the Yangtze and Liaohe Rivers. Fishes 2023, 8, 253. [Google Scholar] [CrossRef]
- Yang, L.; Mayden, R.L.; He, S. Population genetic structure and geographical differentiation of the Chinese catfish Hemibagrus macropterus (Siluriformes, Bagridae): Evidence for altered drainage patterns. Mol. Phylogenet. Evol. 2009, 51, 405–411. [Google Scholar] [CrossRef]
- Ye, H.; Fan, J.; Hou, Y.; Yue, H.; Ruan, R.; Li, S.; Hu, C.; Xie, Y.; Li, C. Chromosome-level genome assembly of the largefin longbarbel catfish (Hemibagrus macropterus). Front. Genet. 2023, 14, 1297119. [Google Scholar] [CrossRef]
- Ma, C.; Cheng, Q.; Zhang, Q.; Zhuang, P.; Zhao, Y. Genetic variation of Coilia ectenes (Clupeiformes: Engraulidae) revealed by the complete cytochrome b sequences of mitochondrial DNA. J. Exp. Mar. Biol. Ecol. 2010, 385, 14–19. [Google Scholar] [CrossRef]
- Lalitha, S. Primer Premier 5. Biotech Sofw. Int. Rep. 2000, 1, 270–272. [Google Scholar]
- Holland, M.M.; Pack, E.D.; McElhoe, J.A. Evaluation of GeneMarker® HTS for improved alignment of mtDNA MPS data, haplotype determination, and heteroplasmy assessment. Forensic Sci. Int. Genet. 2017, 28, 90–98. [Google Scholar] [CrossRef] [PubMed]
- Librado, P.; Rozas, J. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 2009, 25, 1451–1452. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Bandelt, H.J.; Forster, P.; Röhl, A. Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 1999, 16, 37–48. [Google Scholar] [CrossRef]
- Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef] [PubMed]
- Ramos-Onsins, S.E.; Rozas, J. Statistical properties of new neutrality tests against population growth. Mol. Biol. Evol. 2002, 19, 2092–2100. [Google Scholar] [CrossRef]
- Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 2007, 16, 1099–1106. [Google Scholar] [CrossRef]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
- Rousset, F. GENEPOP’007: A complete re-implementation of the genepop software for Windows and Linux. Mol. Ecol. Resour. 2008, 8, 103–106. [Google Scholar] [CrossRef]
- Hubisz, M.J.; Falush, D.; Stephens, M.; Pritchard, J.K. Inferring weak population structure with the assistance of sample group information. Mol. Ecol. Resour. 2009, 9, 1322–1332. [Google Scholar] [CrossRef]
- Dong, F.; Cheng, P.; Sha, H.; Yue, H.; Wan, C.; Zhang, Y.; Zhang, H.; Wei, Q. Genetic diversity and population structure analysis of blunt snout bream (Megalobrama amblycephala) in the Yangtze River Basin: Implications for conservation and utilization. Aquac. Rep. 2024, 35, 101925. [Google Scholar] [CrossRef]
- Ke, X.; Liu, J.; Gao, F.; Cao, J.; Liu, Z.; Lu, M. Analysis of genetic diversity among six dojo loach (Misgurnus anguillicaudatus) populations in the Pearl River Basin based on microsatellite and mitochondrial DNA markers. Aquac. Rep. 2022, 27, 101346. [Google Scholar] [CrossRef]
- Xiao, M.S.; Xia, H.W.; Ma, Y.H. Genetic variation of the Chinese longsnout catfish Leiocassis longirostris in the Yangtze River revealed using mitochondrial DNA cytochrome b sequences. Acta Ecol. Sin. 2012, 32, 305–313. [Google Scholar] [CrossRef]
- Ha, T.T.T.; Nga, T.T.; Hang, T.N.A.; Alam, M.S. Genetic diversity in Pangasius spp. collected in Bangladesh based on mitochondrial cytochrome b gene sequence analysis. Aquac. Rep. 2020, 17, 100351. [Google Scholar] [CrossRef]
- Zhu, W.; Fu, J.; Luo, M.; Wang, L.; Wang, P.; Liu, Q.; Dong, Z. Genetic diversity and population structure of bighead carp (Hypophthalmichthys nobilis) from the middle and lower reaches of the Yangtze River revealed using microsatellite markers. Aquac. Rep. 2022, 27, 101377. [Google Scholar] [CrossRef]
- Zhou, Y.; Tong, J.; Wang, J.; Yu, X. Development of microsatellite markers and genetic diversity in wild and cultured populations of black carp (Mylopharyngodon piceus) along the Yangtze River. Aquac. Int. 2020, 28, 1867–1882. [Google Scholar] [CrossRef]
- Sha, H.; Luo, X.Z.; Wang, D.; Li, X.H.; Zou, G.W.; Liang, H.W. New insights to protection and utilization of silver carp (Hypophthalmichthys molitrix) in Yangtze River based on microsatellite analysis. Fish. Res. 2021, 241, 105997. [Google Scholar] [CrossRef]
- Reiner, G.; Lang, M.; Willems, H. Impact of different panels of microsatellite loci, different numbers of loci, sample sizes, and gender ratios on population genetic results in red deer. Eur. J. Wildl. Res. 2019, 65, 25. [Google Scholar] [CrossRef]
- Guo, X.Z.; Chen, H.M.; Wang, A.B.; Qian, X.Q. Population genetic structure of the yellow catfish (Pelteobagrus fulvidraco) in China inferred from microsatellite analyses: Implications for fisheries management and breeding. J. World Aquac. Soc. 2022, 53, 174–191. [Google Scholar] [CrossRef]
- Chen, W.; Xiang, D.; Gao, S.; Zhu, S.; Wu, Z.; Li, Y.; Li, J. Whole-genome resequencing confirms the genetic effects of dams on an endangered fish Hemibagrus guttatus (Siluriformes: Bagridae): A case study in a tributary of the Pearl River. Gene 2024, 895, 148000. [Google Scholar] [CrossRef]
- Hou, Y.; Ye, H.; Song, X.; Fan, J.; Li, J.; Shao, J.; Wang, Y.; Lin, D.; Yue, H.; Ruan, R.; et al. Genetic Diversity and Population Structure of Chinese Longsnout Catfish (Leiocassis longirostris) Using Microsatellite DNA Markers. Fishes 2024, 9, 35. [Google Scholar] [CrossRef]
- Henriques, R.; von der Heyden, S.; Lipinski, M.R.; du Toit, N.; Kainge, P.; Bloomer, P.; Matthee, C.A. Spatio-temporal genetic structure and the effects of long-term fishing in two partially sympatric offshore demersal fishes. Mol. Ecol. 2016, 25, 5843–5861. [Google Scholar] [CrossRef] [PubMed]
- Perdices, A.; Cunha, C.; Coelho, M.M. Phylogenetic structure of Zacco platypus (Teleostei, Cyprinidae) populations on the upper and middle Chang Jiang (=Yangtze) drainage inferred from cytochrome b sequences. Mol. Phylogenet. Evol. 2004, 31, 192–203. [Google Scholar] [CrossRef] [PubMed]
- Perdices, A.; Sayanda, D.; Coelho, M.M. Mitochondrial diversity of Opsariichthys bidens (Teleostei, Cyprinidae) in three Chinese drainages. Mol. Phylogenet. Evol. 2005, 37, 920–927. [Google Scholar] [CrossRef]
- Berrebi, P.; Retif, X.; Fang, F.; Zhang, C.G. Population structure and systematics of Opsariichthys bidens (Osteichthyes: Cyprinidae) in south-east China using a new nuclear marker: The introns (EPIC-PCR). Biol. J. Linn. Soc. 2006, 87, 155–166. [Google Scholar] [CrossRef]
Figure 1.
Sampling localities for Hemibagrus macropterus populations. YB, Yibin; YC, Yichang; SS, Shishou; WH, Wuhan; NJ, Nanjing; HH, Huaihua; YS, Yangshuo; CQSS, Stock seed; TGD, Three Gorges Dam; GD, Gezhouba Dam.
Figure 1.
Sampling localities for Hemibagrus macropterus populations. YB, Yibin; YC, Yichang; SS, Shishou; WH, Wuhan; NJ, Nanjing; HH, Huaihua; YS, Yangshuo; CQSS, Stock seed; TGD, Three Gorges Dam; GD, Gezhouba Dam.
Figure 2.
Haplotype network diagram of eight populations of Hemibagrus macropterus based on Cytb. YB, Yibin; YC, Yichang; SS, Shishou; WH, Wuhan; NJ, Nanjing; HH, Huaihua; YS, Yangshuo; CQSS, Stock seed.
Figure 2.
Haplotype network diagram of eight populations of Hemibagrus macropterus based on Cytb. YB, Yibin; YC, Yichang; SS, Shishou; WH, Wuhan; NJ, Nanjing; HH, Huaihua; YS, Yangshuo; CQSS, Stock seed.
Figure 3.
UPGMA phylogram for eight populations of Hemibagrus macropterus based on SSRs. YB, Yibin; YC, Yichang; SS, Shishou; WH, Wuhan; NJ, Nanjing; HH, Huaihua; YS, Yangshuo; CQSS, Stock seed.
Figure 3.
UPGMA phylogram for eight populations of Hemibagrus macropterus based on SSRs. YB, Yibin; YC, Yichang; SS, Shishou; WH, Wuhan; NJ, Nanjing; HH, Huaihua; YS, Yangshuo; CQSS, Stock seed.
Figure 4.
PCoA of eight populations of Hemibagrus macropterus based on SSRs. YB, Yibin; YC, Yichang; SS, Shishou; WH, Wuhan; NJ, Nanjing; HH, Huaihua; YS, Yangshuo; CQSS, Stock seed.
Figure 4.
PCoA of eight populations of Hemibagrus macropterus based on SSRs. YB, Yibin; YC, Yichang; SS, Shishou; WH, Wuhan; NJ, Nanjing; HH, Huaihua; YS, Yangshuo; CQSS, Stock seed.
Figure 5.
(a) Structural diagram of Hemibagrus macropterus for K = 2; (b) Structural diagram of Hemibagrus macropterus for K = 3; (c) Structural diagram of Hemibagrus macropterus for K = 4; (d) Structural diagram of Hemibagrus macropterus for K = 5. Different colors represent different clustering subgroups. YB, Yibin; YC, Yichang; SS, Shishou; WH, Wuhan; NJ, Nanjing; HH, Huaihua; YS, Yangshuo; CQSS, Stock seed.
Figure 5.
(a) Structural diagram of Hemibagrus macropterus for K = 2; (b) Structural diagram of Hemibagrus macropterus for K = 3; (c) Structural diagram of Hemibagrus macropterus for K = 4; (d) Structural diagram of Hemibagrus macropterus for K = 5. Different colors represent different clustering subgroups. YB, Yibin; YC, Yichang; SS, Shishou; WH, Wuhan; NJ, Nanjing; HH, Huaihua; YS, Yangshuo; CQSS, Stock seed.
Figure 6.
Mismatch distribution of Cytb of Hemibagrus macropterus.
Table 1.
Information on Hemibagrus macropterus samples.
| Location | Population Name | Sample Size | Geographic Location | Collection Date |
|---|---|---|---|---|
| Upper reaches of Yangtze River | Yibin (YB) | 13 | Sichuan (28.7669° N, 104.6279° E) | June 2022 |
| Middle reaches of Yangtze River | Yichang (YC) | 26 | Sichuan (30.4152° N, 111.8944° E) | June 2023 |
| Shishou (SS) | 25 | Hubei (29.7382° N, 112.3955° E) | October 2021 | |
| Wuhan (WH) | 19 | Hubei (30.6827° N, 114.5270° E) | November 2021 | |
| Lower reaches of Yangtze River | Nanjing (NJ) | 19 | Jiangsu (32.0646° N, 118.8024° E) | June 2023 |
| Xiang Jiang River (Yangtze River tributary) | Huaihua (HH) | 32 | Hunan (27.3469° N, 109.1798° E) | April 2024 |
| Li Jiang River (Pearl River tributary) | Yangshuo (YS) | 31 | Guangxi (24.7784° N, 110.4965° E) | May 2024 |
| Chongqing city | Stock seed (CQSS) | 30 | Chongqing (29.9138° N, 107.2414° E) | March 2023 |
Table 2.
Frequency distribution of haplotypes in eight populations of Hemibagrus macropterus.
| Haplotype | Location | |||||||
|---|---|---|---|---|---|---|---|---|
| YB | YC | SS | WH | NJ | HH | YS | CQSS | |
| Hap_1 | 12 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Hap_2 | 1 | 9 | 6 | 0 | 1 | 0 | 5 | 16 |
| Hap_3 | 0 | 11 | 12 | 10 | 7 | 0 | 0 | 12 |
| Hap_4 | 0 | 1 | 2 | 0 | 1 | 0 | 0 | 0 |
| Hap_5 | 0 | 2 | 0 | 0 | 0 | 0 | 0 | 2 |
| Hap_6 | 0 | 1 | 2 | 5 | 2 | 2 | 23 | 0 |
| Hap_7 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| Hap_8 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| Hap_9 | 0 | 0 | 2 | 0 | 1 | 0 | 0 | 0 |
| Hap_10 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 |
| Hap_11 | 0 | 0 | 0 | 3 | 2 | 0 | 0 | 0 |
| Hap_12 | 0 | 0 | 0 | 1 | 1 | 0 | 0 | 0 |
| Hap_13 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 |
| Hap_14 | 0 | 0 | 0 | 0 | 2 | 0 | 0 | 0 |
| Hap_15 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 |
| Hap_16 | 0 | 0 | 0 | 0 | 0 | 10 | 0 | 0 |
| Hap_17 | 0 | 0 | 0 | 0 | 0 | 2 | 0 | 0 |
| Hap_18 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 |
| Hap_19 | 0 | 0 | 0 | 0 | 0 | 2 | 0 | 0 |
| Hap_20 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 |
| Hap_21 | 0 | 0 | 0 | 0 | 0 | 4 | 0 | 0 |
| Hap_22 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 |
| Hap_23 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 |
| Hap_24 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 |
| Hap_25 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 |
| Hap_26 | 0 | 0 | 0 | 0 | 0 | 2 | 0 | 0 |
| Hap_27 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 |
| Hap_28 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 |
| Hap_29 | 0 | 0 | 0 | 0 | 0 | 2 | 0 | 0 |
| Hap_30 | 0 | 0 | 0 | 0 | 0 | 0 | 2 | 0 |
| Hap_31 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 |
Table 3.
Genetic diversity in eight populations of Hemibagrus macropterus based on Cytb.
| Population | N | h | Hd | π |
|---|---|---|---|---|
| YB | 13 | 2 | 0.154 | 0.0100 |
| YC | 26 | 7 | 0.717 | 0.0108 |
| SS | 25 | 6 | 0.720 | 0.0013 |
| WH | 19 | 4 | 0.661 | 0.0015 |
| NJ | 19 | 10 | 0.860 | 0.0035 |
| HH | 32 | 15 | 0.887 | 0.0048 |
| YS | 31 | 4 | 0.432 | 0.0005 |
| CQSS | 30 | 3 | 0.570 | 0.0085 |
| Total | 195 | 31 | 0.853 | 0.0127 |
N: Number of individuals; h: Number of haplotypes; Hd: Haplotype diversity; π: Nucleotide diversity.
Table 4.
Information of 14 SSR loci in Hemibagrus macropterus.
| Locus | Forward Primer | Reverse Primer | Allele Ranges (bp) |
|---|---|---|---|
| Hem002 | GAGATCGAGGAGAGCGGGAA | CACCACCTCCGTCATGTTCT | 314–334 |
| Hem003 | TCGGTGTTTGTTGTCCGAAA | ACGCGGGTAGTAGTAGTGGT | 223–248 |
| Hem004 | TATGGAGTTGTCCCGCCCTA | CATGCGCAGTAGAGGGAGAT | 152–191 |
| Hem005 | CAGCTCCGACTCCATGACTG | TAAGCTGCAATGCACCGTTG | 297–320 |
| Hem010 | GTGCACTGATTCAGCTCCCT | CCAACCCTAGTCCTGCAGTG | 259–290 |
| Hem012 | GTACTTGCTCTTGACGCTGC | GCGACCTCACGGTTAGAACA | 222–273 |
| Hem015 | TTCAACAGGTCAGGCTTGCA | GTCCGAACACCAACCGGTAT | 251–270 |
| Hem022 | CTGTGGTGCCTGAGAGATGG | ACCAACACCATGCTTCACCA | 177–202 |
| Hem032 | CAAACCCTGGAGTCCTGTCC | ATGTGCTTCACGGAGCTTGT | 278–314 |
| Hem036 | ACCTGGTTGATGACTGCTGG | TGATGCAGTCTTCGCAGTGT | 261–283 |
| Hem041 | GAAGCGGACAGTGATGACCA | GCTCAACTTCAGCCTGGTGA | 256–291 |
| Hem046 | TTGTGCCCTGTGATAGCCTG | CCAGCCAGGGAGCAAACTTA | 181–287 |
| Hem047 | ACCTCACTGTTCCTGCAGTC | GGGAGAAGTGAGGCAAGAGG | 244–267 |
| Hem048 | AGGGTGATGTGGAAGGACCT | CGACTACCAGCTACCACGTC | 233–281 |
Table 5.
Genetic variability at 14 SSR loci in 195 individuals of Hemibagrus macropterus.
| Locus | Na | Ne | I | Ho | He | F | PIC | Prob | Signif |
|---|---|---|---|---|---|---|---|---|---|
| Hem002 | 9 | 2.599 | 1.256 | 0.495 | 0.615 | 0.196 | 0.557 | 0.153 | ns |
| Hem003 | 18 | 9.902 | 2.500 | 0.874 | 0.899 | 0.027 | 0.891 | 0.000 | *** |
| Hem004 | 18 | 11.491 | 2.579 | 0.747 | 0.913 | 0.181 | 0.906 | 0.000 | *** |
| Hem005 | 17 | 6.850 | 2.247 | 0.774 | 0.854 | 0.094 | 0.840 | 0.716 | ns |
| Hem010 | 19 | 4.349 | 1.889 | 0.682 | 0.770 | 0.114 | 0.743 | 0.017 | * |
| Hem012 | 18 | 7.980 | 2.346 | 0.846 | 0.875 | 0.033 | 0.863 | 0.999 | ns |
| Hem015 | 15 | 4.596 | 1.868 | 0.753 | 0.782 | 0.038 | 0.755 | 0.054 | ns |
| Hem022 | 16 | 8.641 | 2.322 | 0.794 | 0.884 | 0.102 | 0.873 | 0.588 | ns |
| Hem032 | 20 | 10.234 | 2.557 | 0.788 | 0.902 | 0.127 | 0.895 | 0.244 | ns |
| Hem036 | 14 | 4.525 | 1.844 | 0.696 | 0.779 | 0.107 | 0.754 | 0.882 | ns |
| Hem041 | 44 | 13.787 | 3.026 | 0.907 | 0.927 | 0.022 | 0.923 | 0.836 | ns |
| Hem046 | 17 | 2.737 | 1.361 | 0.644 | 0.635 | −0.014 | 0.574 | 0.011 | * |
| Hem047 | 15 | 6.878 | 2.157 | 0.722 | 0.855 | 0.156 | 0.839 | 0.103 | ns |
| Hem048 | 19 | 10.260 | 2.504 | 0.928 | 0.903 | −0.028 | 0.894 | 0.393 | ns |
| Mean | 18.500 | 7.488 | 2.175 | 0.761 | 0.828 | 0.083 | 0.808 | ||
| St Dev | 7.842 | 3.426 | 0.488 | 0.114 | 0.100 | 0.071 | 0.118 |
Na, observed alleles; Ne, effective allele; I, Shannon index; Ho, observed heterozygosity; He, expected heterozygosity; F, fixation index; PIC, polymorphic information index; Prob, probability of genotype frequency randomly deviating from Hardy–Weinberg expectation; Signif, significance (ns represents not significant, the population conforms to HWE; * represents significant difference p < 0.05 and *** represents significant difference p < 0.001).
Table 6.
Genetic diversity of 14 SSR loci in eight populations of Hemibagrus macropterus.
| Population | Na | Ne | I | Ho | He | F | |
|---|---|---|---|---|---|---|---|
| YB | Mean | 6.786 | 4.293 | 1.539 | 0.697 | 0.713 | 0.013 |
| SE | 0.712 | 0.463 | 0.132 | 0.049 | 0.046 | 0.039 | |
| YC | Mean | 9.357 | 5.062 | 1.764 | 0.734 | 0.760 | 0.043 |
| SE | 0.929 | 0.554 | 0.126 | 0.048 | 0.032 | 0.040 | |
| SS | Mean | 8.714 | 5.145 | 1.744 | 0.783 | 0.765 | −0.020 |
| SE | 0.766 | 0.579 | 0.120 | 0.045 | 0.030 | 0.042 | |
| WH | Mean | 7.929 | 4.904 | 1.712 | 0.789 | 0.765 | −0.035 |
| SE | 0.675 | 0.472 | 0.110 | 0.036 | 0.027 | 0.039 | |
| NJ | Mean | 7.714 | 4.870 | 1.624 | 0.711 | 0.736 | 0.022 |
| SE | 0.854 | 0.723 | 0.139 | 0.030 | 0.034 | 0.036 | |
| HH | Mean | 11.857 | 7.457 | 2.089 | 0.830 | 0.831 | 0.001 |
| SE | 1.346 | 0.891 | 0.128 | 0.029 | 0.025 | 0.021 | |
| YS | Mean | 10.786 | 5.947 | 1.904 | 0.789 | 0.793 | 0.006 |
| SE | 0.973 | 0.720 | 0.123 | 0.034 | 0.028 | 0.023 | |
| CQSS | Mean | 7.857 | 4.455 | 1.568 | 0.706 | 0.706 | 0.028 |
| SE | 0.824 | 0.524 | 0.142 | 0.063 | 0.050 | 0.052 |
Na, observed alleles; Ne, effective allele; I, Shannon index; Ho, observed heterozygosity; He, expected heterozygosity; F, fixation index.
Table 7.
Pairwise estimates of genetic distance (above the diagonal) and Fst (below the diagonal) for eight populations of Hemibagrus macropterus based on Cytb.
Table 7.
Pairwise estimates of genetic distance (above the diagonal) and Fst (below the diagonal) for eight populations of Hemibagrus macropterus based on Cytb.
| Population | YB | YC | SS | WH | NJ | HH | YS | CQSS |
|---|---|---|---|---|---|---|---|---|
| YB | 0.0569 | 0.0612 | 0.0611 | 0.0614 | 0.0624 | 0.0622 | 0.0573 | |
| YC | 0.8135 | 0.0064 | 0.0065 | 0.0074 | 0.0133 | 0.0066 | 0.0094 | |
| SS | 0.9053 | 0.0369 | 0.0014 | 0.0024 | 0.0096 | 0.0015 | 0.0052 | |
| WH | 0.9031 | 0.0382 | −0.0002 | 0.0025 | 0.0098 | 0.0016 | 0.0053 | |
| NJ | 0.8867 | 0.0168 | −0.0012 | −0.0148 | 0.0102 | 0.0025 | 0.0062 | |
| HH | 0.8780 | 0.4167 | 0.6831 | 0.6762 | 0.5920 | 0.0094 | 0.0127 | |
| YS | 0.9137 | 0.1398 | 0.3805 | 0.3541 | 0.1908 | 0.7195 | 0.0055 | |
| CQSS | 0.8355 | −0.0333 | 0.0381 | 0.0398 | 0.0168 | 0.4824 | 0.1732 |
Table 8.
Analysis of molecular variance (AMOVA) test on Cytb in eight populations of Hemibagrus macropterus.
Table 8.
Analysis of molecular variance (AMOVA) test on Cytb in eight populations of Hemibagrus macropterus.
| Source | d.f. | SS | VC | % | F |
|---|---|---|---|---|---|
| Among populations | 7 | 821.139 | 4.75671 Va | 65.65 | FST = 0.65645 |
| Within populations | 187 | 465.517 | 2.48940 Vb | 34.35 | |
| Total | 194 | 1286.656 | 7.24611 |
Source, source of variation; d.f., degree of freedom; SS, sum of squares; VC, Variance components; %, percentage of variation; F, fixation index.
Table 9.
The pairwise Fst value (below the diagonal) and number of migrants (Nm, above the diagonal) among eight populations of Hemibagrus macropterus based on SSRs.
Table 9.
The pairwise Fst value (below the diagonal) and number of migrants (Nm, above the diagonal) among eight populations of Hemibagrus macropterus based on SSRs.
| YB | YC | SS | WH | NJ | HH | YS | CQSS | |
|---|---|---|---|---|---|---|---|---|
| YB | - | 1.728 | 1.702 | 1.656 | 1.557 | 2.071 | 1.887 | 1.714 |
| YC | 0.126 | - | 18.279 | 15.648 | 16.312 | 8.115 | 7.332 | 6.365 |
| SS | 0.128 | 0.013 | - | 23.383 | 16.669 | 8.626 | 6.530 | 3.968 |
| WH | 0.131 | 0.016 | 0.011 | - | 12.099 | 8.257 | 6.847 | 3.593 |
| NJ | 0.138 | 0.015 | 0.015 | 0.020 | - | 7.770 | 7.410 | 3.672 |
| HH | 0.108 | 0.030 | 0.028 | 0.029 | 0.031 | - | 11.969 | 4.388 |
| YS | 0.117 | 0.033 | 0.037 | 0.035 | 0.033 | 0.020 | - | 3.968 |
| CQSS | 0.127 | 0.038 | 0.059 | 0.065 | 0.064 | 0.054 | 0.059 | - |
Table 10.
Genetic distance among eight populations of Hemibagrus macropterus based on SSRs.
| YB | YC | SS | WH | NJ | HH | YS | CQSS | |
|---|---|---|---|---|---|---|---|---|
| YB | ||||||||
| YC | 0.772 | |||||||
| SS | 0.796 | 0.230 | ||||||
| WH | 0.827 | 0.258 | 0.226 | |||||
| NJ | 0.802 | 0.257 | 0.257 | 0.302 | ||||
| HH | 0.775 | 0.373 | 0.372 | 0.393 | 0.400 | |||
| YS | 0.794 | 0.406 | 0.428 | 0.414 | 0.389 | 0.361 | ||
| CQSS | 0.715 | 0.398 | 0.474 | 0.519 | 0.482 | 0.512 | 0.528 |
Table 11.
AMOVA of eight populations of Hemibagrus macropterus based on SSRs.
| Source | df | TV | MS | Est. Var. | % |
|---|---|---|---|---|---|
| Among Populations | 7 | 179.013 | 25.573 | 0.412 | 7% |
| Among Individuals | 187 | 1063.128 | 5.685 | 0.205 | 3% |
| Within Individuals | 195 | 1028.500 | 5.274 | 5.274 | 90% |
| Total | 389 | 2270.641 | 5.892 | 100% |
Source, source of variation; df, degree of freedom; TV, total variance; MS, mean square error; Est. Var., estimated difference value; %, percentage of variation.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Hou, Y.; Ye, H.; Yue, H.; Li, J.; Huang, L.; Qu, Z.; Ruan, R.; Lin, D.; Liang, Z.; Xie, Y.; et al. Genetic Diversity and Population Structure of Largefin Longbarbel Catfish (Hemibagrus macropterus) Inferred by mtDNA and Microsatellite DNA Markers. Animals 2025, 15, 770. https://doi.org/10.3390/ani15060770
AMA Style
Hou Y, Ye H, Yue H, Li J, Huang L, Qu Z, Ruan R, Lin D, Liang Z, Xie Y, et al. Genetic Diversity and Population Structure of Largefin Longbarbel Catfish (Hemibagrus macropterus) Inferred by mtDNA and Microsatellite DNA Markers. Animals. 2025; 15(6):770. https://doi.org/10.3390/ani15060770
Chicago/Turabian StyleHou, Yanling, Huan Ye, Huamei Yue, Junyi Li, Ling Huang, Ziling Qu, Rui Ruan, Danqing Lin, Zhiqiang Liang, Yong Xie, and et al. 2025. "Genetic Diversity and Population Structure of Largefin Longbarbel Catfish (Hemibagrus macropterus) Inferred by mtDNA and Microsatellite DNA Markers" Animals 15, no. 6: 770. https://doi.org/10.3390/ani15060770
APA StyleHou, Y., Ye, H., Yue, H., Li, J., Huang, L., Qu, Z., Ruan, R., Lin, D., Liang, Z., Xie, Y., & Li, C. (2025). Genetic Diversity and Population Structure of Largefin Longbarbel Catfish (Hemibagrus macropterus) Inferred by mtDNA and Microsatellite DNA Markers. Animals, 15(6), 770. https://doi.org/10.3390/ani15060770
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
