Molecular Characterization of BsCu/Zn-Superoxide Dismutases and BsMn-Superoxide Dismutases from Chinese Black Sleeper (Bostrychus sinensis)
Simple Summary
Abstract
1. Introduction
2. Material and Method
2.1. Animals
2.2. Median 96 h Lethal Concentration (96 h LC50) of B. sinensis Under Cd2+ Ion Stress
2.3. Cd2+ Stress Treatment
2.4. Bacterial Infection and Poly(I:C) Stimulation
2.5. The cDNA Cloning of BsCu/Zn-SOD and BsMn-SOD
2.6. Bioinformatics Analysis
3. Result
3.1. Characterization of BsCu/Zn-SOD and BsMn-SOD
3.2. Effects of Cd2+ Exposure on 96 h LC50
3.3. Homology and Phylogenetic Analysis
3.4. Expression of BsCu/Zn-SOD and BsMn-SOD in Normal Tissues
3.5. Stimulation of BsCu/Zn-SOD and BsMn-SOD Expression by V. parahaemolyticus in the B. sinensis
3.6. Expression of BsCu/Zn-SOD and BsMn-SOD Genes in Cd2+ Stress
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- He, J.-Y.; Chi, C.-F.; Liu, H.-H. Identification and analysis of an intracellular Cu/Zn superoxide dismutase from Sepiella maindroni under stress of Vibrio harveyi and Cd2+. Dev. Comp. Immunol. 2014, 47, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Sun, S.; Zhu, J.; Jiang, X.; Li, B.; Ge, X. Molecular cloning, tissue distribution and expression analysis of a manganese superoxide dismutase in blunt snout bream Megalobrama amblycephala. Fish Shellfish Immunol. 2014, 38, 340–347. [Google Scholar] [CrossRef] [PubMed]
- Harris, E.D. Regulation of antioxidant enzymes. FASEB J. 1992, 6, 2675–2683. [Google Scholar] [CrossRef]
- Brouwer, M.; Hoexum Brouwer, T.; Grater, W.; Brown-Peterson, N. Replacement of a cytosolic copper/zinc superoxide dismutase by a novel cytosolic manganese superoxide dismutase in crustaceans that use copper (haemocyanin) for oxygen transport. Biochem. J. 2003, 374, 219–228. [Google Scholar] [CrossRef]
- Vaughan, M. Oxidative Modification of Macromolecules Minireview Series. J. Biol. Chem. 1997, 272, 18513. [Google Scholar] [CrossRef]
- Youn, H.D.; Kim, E.J.; Roe, J.H.; Hah, Y.C.; Kang, S.O. A novel nickel-containing superoxide dismutase from Streptomyces spp. Biochem. J. 1996, 318, 889–896. [Google Scholar] [CrossRef]
- Chung, J.S.; Bachvaroff, T.R.; Trant, J.; Place, A. A second copper zinc superoxide dismutase (CuZnSOD) in the blue crab Callinectes sapidus: Cloning and up-regulated expression in the hemocytes after immune challenge. Fish Shellfish Immunol. 2012, 32, 16–25. [Google Scholar] [CrossRef] [PubMed]
- Chakravarthy, N.; Aravindan, K.; Kalaimani, N.; Alavandi, S.V.; Poornima, M.; Santiago, T.C. Intracellular Copper Zinc Superoxide dismutase (icCuZnSOD) from Asian seabass (Lates calcarifer): Molecular cloning, characterization and gene expression with reference to Vibrio anguillarum infection. Dev. Comp. Immunol. 2012, 36, 751–755. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; He, J.; Chi, C.; Gu, Y. Identification and analysis of icCu/Zn-SOD, Mn-SOD and ecCu/Zn-SOD in superoxide dismutase multigene family of Pseudosciaena crocea. Fish Shellfish Immunol. 2015, 43, 491–501. [Google Scholar] [CrossRef]
- Wang, H.-J.; Lin, H.-D.; Zhang, L.-Y.; Ding, S.-X. Development and Characterization of 20 Microsatellite Markers for Chinese Black Sleeper, Bostrychus sinensis. Int. J. Mol. Sci. 2011, 12, 9570–9575. [Google Scholar] [CrossRef] [PubMed]
- Wei, K.; Ding, Y.; Yin, X.; Zhang, J.; Shen, B. Molecular cloning, expression analyses and functional characterization of a goose-type lysozyme gene from Bostrychus sinensis (family: Eleotridae). Fish Shellfish. Immunol. 2020, 96, 41–52. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Li, F.; Wang, B.; Zhang, J.; Liu, Y.; Zhou, Q.; Xiang, J. The mitochondrial manganese superoxide dismutase gene in Chinese shrimp Fenneropenaeus chinensis: Cloning, distribution and expression. Dev. Comp. Immunol. 2007, 31, 429–440. [Google Scholar] [CrossRef] [PubMed]
- Smith, M.W.; Doolittle, R.F. A comparison of evolutionary rates of the two major kinds of superoxide dismutase. J. Mol. Evol. 1992, 34, 175–184. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez-Trelles, F.; Tarrio, R. Erratic overdispersion of three molecular clocks: GPDH, SOD, and XDH. Proc. Natl. Acad. Sci. USA 2001, 98, 11405–11410. [Google Scholar] [CrossRef] [PubMed]
- Landa, A.; Vaca-Paniagua, F.; Torres-Rivera, A.; Parra-Unda, R. Taenia solium: Antioxidant Metabolism Enzymes as Targets for Cestocidal Drugs and Vaccines. Curr. Top. Med. Chem. 2008, 8, 393–399. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.W.; Li, Z.; Liang, H.W.; Li, L.; Luo, X.Z.; Zou, G.W. Molecular cloning and differential expression patterns of copper/zinc superoxide dismutase and manganese superoxide dismutase in Hypophthalmichthys molitrix. Fish Shellfish Immunol. 2011, 30, 473–479. [Google Scholar] [CrossRef]
- Wang, X.; Wang, L.; Ren, Q.; Yin, S.; Liang, F.; Jia, Y. Two superoxide dismutases (SODs) respond to bacterial challenge identified in the marbled eel Anguilla marmorata. Aquaculture 2016, 451, 316–325. [Google Scholar] [CrossRef]
- Lee, S.Y.; Kim, K.-Y.; Bang, I.-C.; Nam, Y.K. Characterization of Copper/Zinc-Superoxide Dismutase (Cu/Zn-SOD) Gene from an Endangered Freshwater Fish Species Hemibarbus mylodon (Teleostei, Cypriniformes). Fish. Aquat. Sci. 2011, 14, 43–54. [Google Scholar] [CrossRef]
- Sirisena, D.M.K.P.; Perera, N.C.N.; Godahewa, G.I.; Kwon, H.; Yang, H.; Nam, B.-H.; Lee, J. A manganese superoxide dismutase (MnSOD) from red lip mullet, Liza haematocheila: Evaluation of molecular structure, immune response, and antioxidant function. Fish & Shellfish Immunol. 2019, 84, 73–82. [Google Scholar] [CrossRef]
- Wu, J.; Bao, M.; Ge, D.; Huo, L.; Lv, Z.; Chi, C.; Liao, Z.; Liu, H. The expression of superoxide dismutase in Mytilus coruscus under various stressors. Fish Shellfish Immunol. 2017, 70, 361–371. [Google Scholar] [CrossRef]
- He, L.; He, T.; Farrar, S.; Ji, L.; Liu, T.; Ma, X. Antioxidants Maintain Cellular Redox Homeostasis by Elimination of Reactive Oxygen Species. Cell. Physiol. Biochem. Int. J. Exp. Cell. Physiol. Biochem. Pharmacol. 2017, 44, 532–553. [Google Scholar] [CrossRef] [PubMed]
- Mourente, G.; Díaz-Salvago, E.; Tocher, D.; Bell, J.G. Effects of dietary polyunsaturated fatty acid/vitamin E (PUFA/tocopherol ratio on antioxidant defence mechanisms of juvenile gilthead sea bream (Sparus aurata L., Osteichthyes, Sparidae). Fish Physiol. Biochem. 2000, 23, 337–351. [Google Scholar] [CrossRef]
- Pascoe, D.; Evans, S.A.; Woodworth, J. Heavy metal toxicity to fish and the influence of water hardness. Arch. Environ. Contam. Toxicol. 1986, 15, 481–487. [Google Scholar] [CrossRef]
- Orun, I.; Talas, Z.S.; Ozdemir, I.; Alkan, A.; Erdogan, K. Antioxidative role of selenium on some tissues of (Cd2+), Cr3+)-induced rainbow trout. Ecotoxicol. Environ. Saf. 2008, 71, 71–75. [Google Scholar] [CrossRef] [PubMed]
- Almeida, J.A.; Diniz, Y.S.; Marques, S.F.; Faine, L.A.; Ribas, B.O.; Burneiko, R.C.; Novelli, E.L. The use of the oxidative stress responses as biomarkers in Nile tilapia (Oreochromis niloticus) exposed to in vivo cadmium contamination. Environ. Int. 2002, 27, 673–679. [Google Scholar] [CrossRef]
- Huang, Y.H.; Shih, C.M.; Huang, C.J.; Lin, C.M.; Chou, C.M.; Tsai, M.L.; Liu, T.P.; Chiu, J.F.; Chen, C.T. Effects of cadmium on structure and enzymatic activity of Cu,Zn-SOD and oxidative status in neural cells. J. Cell. Biochem. 2006, 98, 577–589. [Google Scholar] [CrossRef] [PubMed]
- Atli, G.; Canli, M. Response of antioxidant system of freshwater fish Oreochromis niloticus to acute and chronic metal (Cd, Cu, Cr, Zn, Fe) exposures. Ecotoxicol. Environ. Saf. 2010, 73, 1884–1889. [Google Scholar] [CrossRef] [PubMed]
Primer | Sequences |
---|---|
For complete ORF sequence | |
BsCu/Zn-SOD-F | 5′ CTGCAAAGATGGTGCTGAAAGC 3′ |
BsCu/Zn-SOD-R | 5′ GCCAAGTTTAATTAGCGATGCCA 3′ |
BsMn-SOD-F | 5′GTATCTACCCTGTCCTGTTCCTGG 3′ |
BsMn-SOD-R | 5′ TATTTTGAATGCGTTTGTGGCTTG 3′ |
For qRT-PCR | |
qBsCu/Zn-SOD-F | 5′ CACAGGAGGGTGATTCG 3′ |
qBsCu/Zn-SOD-R | 5′ GTGTTTCTTGTCATAGGGAT 3′ |
qBsMn-SOD-F | 5′ GGCACTGGCTAAAGGAGATG 3′ |
qBsMn-SOD-R | 5′ TCCACTGGGAGAGAGATTCG 3 |
β-Bsactin-F | 5′ GACCCAGATTATGTTTGAGA 3′ |
β-Bsactin-R | 5′ CGTGGTGGTGAATGAGTAG 3′ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, H.; Ran, S.; Wang, X.; Shen, B.; Zhang, J. Molecular Characterization of BsCu/Zn-Superoxide Dismutases and BsMn-Superoxide Dismutases from Chinese Black Sleeper (Bostrychus sinensis). Animals 2025, 15, 653. https://doi.org/10.3390/ani15050653
Li H, Ran S, Wang X, Shen B, Zhang J. Molecular Characterization of BsCu/Zn-Superoxide Dismutases and BsMn-Superoxide Dismutases from Chinese Black Sleeper (Bostrychus sinensis). Animals. 2025; 15(5):653. https://doi.org/10.3390/ani15050653
Chicago/Turabian StyleLi, Haolin, Suzhen Ran, Xiaoyu Wang, Bin Shen, and Jianshe Zhang. 2025. "Molecular Characterization of BsCu/Zn-Superoxide Dismutases and BsMn-Superoxide Dismutases from Chinese Black Sleeper (Bostrychus sinensis)" Animals 15, no. 5: 653. https://doi.org/10.3390/ani15050653
APA StyleLi, H., Ran, S., Wang, X., Shen, B., & Zhang, J. (2025). Molecular Characterization of BsCu/Zn-Superoxide Dismutases and BsMn-Superoxide Dismutases from Chinese Black Sleeper (Bostrychus sinensis). Animals, 15(5), 653. https://doi.org/10.3390/ani15050653