Glycyrrhizin Alleviates the Damage Caused by Zearalenone and Protects the Glandular Stomach of Chickens
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Groups
2.2. Histopathology Staining
2.3. Cell Isolation Culture
2.4. TUNEL Analysis
2.5. Reactive Oxygen Species (ROS) Detection
2.6. Antioxidant Enzyme Detection
2.7. ELISA
2.8. qRT-PCR
2.9. Western Blotting
2.10. AO/EB
2.11. Statistical Analysis
3. Results
3.1. GA Alleviates ZEA-Induced Tissue Damage and Oxidative Stress
3.2. GA Relieved ZEA-Induced Interstitial Inflammation
3.3. GA Reduced ZEA-Induced Histiocytic Death
3.4. GA Inhibits ZEA-Induced Cellular Oxidative Stress
3.5. GA Protects Cells by Alleviating ZEA-Induced Inflammation Through the Nκb Pathway
3.6. GA Protects Cells and Reduces ZEA-Induced Cell Death
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ropejko, K.; Twarużek, M. Zearalenone and Its Metabolites-General Overview, Occurrence, and Toxicity. Toxins 2021, 13, 35. [Google Scholar] [CrossRef] [PubMed]
- Schothorst, R.C.; van Egmond, H.P. Report from SCOOP task 3.2.10 “collection of occurrence data of Fusarium toxins in food and assessment of dietary intake by the population of EU member states”. Subtask: Trichothecenes. Toxicol. Lett. 2004, 153, 133–143. [Google Scholar] [CrossRef]
- Han, X.; Huangfu, B.; Xu, T.; Xu, W.; Asakiya, C.; Huang, K.; He, X. Research Progress of Safety of Zearalenone: A Review. Toxins 2022, 14, 386. [Google Scholar] [CrossRef]
- Raj, J.; Farkaš, H.; Jakovčević, Z.; Medina, A.; Magan, N.; Čepela, R.; Vasiljević, M. Comparison of multiple mycotoxins in harvested maize samples in three years (2018-2020) in four continents. Food Addit. Contam. Part A 2022, 39, 599–608. [Google Scholar] [CrossRef] [PubMed]
- Zhu, F.; Zhu, L.; Xu, J.; Wang, Y.; Wang, Y. Effects of moldy corn on the performance, antioxidant capacity, immune function, metabolism and residues of mycotoxins in eggs, muscle, and edible viscera of laying hens. Poult. Sci. 2023, 102, 102502. [Google Scholar] [CrossRef]
- Bi, Z.; Gu, X.; Xiao, Y.; Zhou, Y.; Bao, W.; Wu, S.; Wang, H. Analysis of the Roles of the ISLR2 Gene in Regulating the Toxicity of Zearalenone Exposure in Porcine Intestinal Epithelial Cells. Toxins 2022, 14, 639. [Google Scholar] [CrossRef]
- Shen, T.; Miao, Y.; Ding, C.; Fan, W.; Liu, S.; Lv, Y.; Gao, X.; De Boevre, M.; Yan, L.; Okoth, S.; et al. Activation of the p38/MAPK pathway regulates autophagy in response to the CYPOR-dependent oxidative stress induced by zearalenone in porcine intestinal epithelial cells. Food Chem. Toxicol. 2019, 131, 110527. [Google Scholar] [CrossRef]
- Knapp BK, Bauer LL, Swanson KS, Tappenden KA, Fahey GC Jr, de Godoy MR. Soluble fiber dextrin and soluble corn fiber supplementation modify indices of health in cecum and colon of Sprague-Dawley rats. Nutrients 2013, 5, 396–410. [CrossRef] [PubMed]
- Debevere, S.; Cools, A.; De Baere, S.; Haesaert, G.; Rychlik, M.; Croubels, S.; Fievez, V. In Vitro Rumen Simulations Show a Reduced Disappearance of Deoxynivalenol, Nivalenol and Enniatin B at Conditions of Rumen Acidosis and Lower Microbial Activity. Toxins 2020, 12, 101. [Google Scholar] [CrossRef] [PubMed]
- Kemboi, D.C.; Antonissen, G.; Ochieng, P.E.; Croubels, S.; Okoth, S.; Kangethe, E.K.; Faas, J.; Lindahl, J.F.; Gathumbi, J.K. A Review of the Impact of Mycotoxins on Dairy Cattle Health: Challenges for Food Safety and Dairy Production in Sub-Saharan Africa. Toxins 2020, 12, 222. [Google Scholar] [CrossRef] [PubMed]
- Tardieu, D.; Travel, A.; Le Bourhis, C.; Metayer, J.-P.; Mika, A.; Cleva, D.; Boissieu, C.; Guerre, P. Fumonisins and zearalenone fed at low levels can persist several days in the liver of turkeys and broiler chickens after exposure to the contaminated diet was stopped. Food Chem. Toxicol. 2021, 148, 111968. [Google Scholar] [CrossRef]
- Fu, Y.; Jin, Y.; Tian, Y.; Yu, H.; Wang, R.; Qi, H.; Feng, B.; Zhang, J. Zearalenone Promotes LPS-Induced Oxidative Stress, Endoplasmic Reticulum Stress, and Accelerates Bovine Mammary Epithelial Cell Apoptosis. Int. J. Mol. Sci. 2022, 23, 10925. [Google Scholar] [CrossRef]
- Yi, Y.; Gao, K.; Zhang, L.; Lin, P.; Wang, A.; Jin, Y. Zearalenone Induces MLKL-Dependent Necroptosis in Goat Endometrial Stromal Cells via the Calcium Overload/ROS Pathway. Int. J. Mol. Sci. 2022, 23, 10170. [Google Scholar] [CrossRef] [PubMed]
- Zhang, P.; Jing, C.; Liang, M.; Jiang, S.; Huang, L.; Jiao, N.; Li, Y.; Yang, W. Zearalenone Exposure Triggered Cecal Physical Barrier Injury through the TGF-β1/Smads Signaling Pathway in Weaned Piglets. Toxins 2021, 13, 902. [Google Scholar] [CrossRef] [PubMed]
- Fan, W.; Shen, T.; Ding, Q.; Lv, Y.; Li, L.; Huang, K.; Yan, L.; Song, S. Zearalenone induces ROS-mediated mitochondrial damage in porcine IPEC-J2 cells. J. Biochem. Mol. Toxicol. 2017, 31, 10. [Google Scholar] [CrossRef] [PubMed]
- Guijarro-Muñoz, I.; Compte, M.; Álvarez-Cienfuegos, A.; Álvarez-Vallina, L.; Sanz, L. Lipopolysaccharide activates Toll-like receptor 4 (TLR4)-mediated NF-κB signaling pathway and proinflammatory response in human pericytes. J. Biol. Chem. 2014, 289, 2457–2468. [Google Scholar] [CrossRef]
- Pistol, G.C.; Gras, M.A.; Marin, D.E.; Israel-Roming, F.; Stancu, M.; Taranu, I. Natural feed contaminant zearalenone decreases the expressions of important pro- and anti-inflammatory mediators and mitogen-activated protein kinase/NF-κB signalling molecules in pigs. Br. J. Nutr. 2014, 111, 452–464. [Google Scholar] [CrossRef]
- Sun, L.; He, D.; Liu, Y.; Wei, Y.; Wang, L. Corynoline protects against zearalenone-induced liver injury by activating the SIRT1/Nrf2 signaling pathway. J. Biochem. Mol. Toxicol. 2023, 37, e23224. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Li, S.; Jiang, L.; Gao, X.; Liu, W.; Zhu, X.; Huang, W.; Zhao, H.; Wei, Z.; Wang, K.; et al. Baicalin protects against zearalenone-induced chicks liver and kidney injury by inhibiting expression of oxidative stress, inflammatory cytokines and caspase signaling pathway. Int. Immunopharmacol. 2021, 100, 108097. [Google Scholar] [CrossRef]
- Luo, J.-J.; Zhang, Y.; Sun, H.; Wei, J.-T.; Khalil, M.M.; Wang, Y.-W.; Dai, J.-F.; Zhang, N.-Y.; Qi, D.-S.; Sun, L.-H. The response of glandular gastric transcriptome to T-2 toxin in chicks. Food Chem. Toxicol. 2019, 132, 110658. [Google Scholar] [CrossRef]
- Heidari, S.; Mehri, S.; Hosseinzadeh, H. The genus Glycyrrhiza (Fabaceae family) and its active constituents as protective agents against natural or chemical toxicities. Phytother. Res. 2021, 35, 6552–6571. [Google Scholar] [CrossRef] [PubMed]
- Sharifi-Rad, J.; Quispe, C.; Herrera-Bravo, J.; Belén, L.H.; Kaur, R.; Kregiel, D.; Uprety, Y.; Beyatli, A.; Yeskaliyeva, B.; Kırkın, C.; et al. Glycyrrhiza Genus: Enlightening Phytochemical Components for Pharmacological and Health-Promoting Abilities. Oxid. Med. Cell Longev. 2021, 2021, 7571132. [Google Scholar] [CrossRef] [PubMed]
- Xu, R.; Han, F.X.; Wang, H.R.; Wang, J.J.; Cai, Z.L.; Guo, M.Y. Tea polyphenols alleviate TBBPA-induced inflammation, ferroptosis and apoptosis via TLR4/NF-κB pathway in carp gills. Fish. Shellfish. Immunol. 2024, 146, 109382. [Google Scholar] [CrossRef] [PubMed]
- Cui, J.; Zhu, M.; Sun, X.; Yang, J.; Guo, M. Microplastics induced endoplasmic reticulum stress to format an inflammation and cell death in hepatocytes of carp (Cyprinus carpio). Aquat. Toxicol. 2024, 269, 106870. [Google Scholar] [CrossRef]
- Wu, J.; Zhang, Y.; Liu, T.; Yang, J.; Sun, X.; Gao, X.J. The mechanism of selenium regulating the permeability of vascular endothelial cells through selenoprotein O. Redox Biol. 2024, 70, 103063. [Google Scholar] [CrossRef]
- Zhang, Q.; Wang, F.; Xu, S.; Cui, J.; Li, K.; Shiwen, X.; Guo, M.-Y. Polystyrene microplastics induce myocardial inflammation and cell death via the TLR4/NF-κB pathway in carp. Fish Shellfish. Immunol. 2023, 135, 108690. [Google Scholar] [CrossRef] [PubMed]
- Jia, S.; Ren, C.; Yang, P.; Qi, D. Effects of Intestinal Microorganisms on Metabolism and Toxicity Mitigation of Zearalenone in Broilers. Animals 2022, 12, 1962. [Google Scholar] [CrossRef]
- Król, A.; Pomastowski, P.; Rafińska, K.; Railean-Plugaru, V.; Walczak, J.; Buszewski, B. Microbiology neutralization of zearalenone using Lactococcus lactis and Bifidobacterium sp. Anal. Bioanal. Chem. 2018, 410, 943–952. [Google Scholar] [CrossRef] [PubMed]
- Xu, C.; Liang, C.; Sun, W.; Chen, J.; Chen, X. Glycyrrhizic acid ameliorates myocardial ischemic injury by the regulation of inflammation and oxidative state. Drug Des. Dev. Ther. 2018, 12, 1311–1319. [Google Scholar] [CrossRef]
- Wang, H.; Ge, X.; Qu, H.; Wang, N.; Zhou, J.; Xu, W.; Xie, J.; Zhou, Y.; Shi, L.; Qin, Z.; et al. Glycyrrhizic Acid Inhibits Proliferation of Gastric Cancer Cells by Inducing Cell Cycle Arrest and Apoptosis. Cancer Manag. Res. 2020, 12, 2853–2861. [Google Scholar] [CrossRef] [PubMed]
- Xia, S.; Yan, C.; Gu, J.; Yuan, Y.; Zou, H.; Liu, Z.; Bian, J. Resveratrol Alleviates Zearalenone-Induced Intestinal Dysfunction in Mice through the NF-κB/Nrf2/HO-1 Signalling Pathway. Foods 2024, 13, 1217. [Google Scholar] [CrossRef]
- Chen, Y.; Cheng, Y.; Wen, C.; Wang, W.; Kang, Y.; Wang, A.; Zhou, Y. The protective effects of modified palygorskite on the broilers fed a purified zearalenone-contaminated diet. Poult. Sci. 2019, 98, 3802–3810. [Google Scholar] [CrossRef]
- Ojha, S.; Javed, H.; Azimullah, S.; Abul Khair, S.B.; Haque, M.E. Glycyrrhizic acid Attenuates Neuroinflammation and Oxidative Stress in Rotenone Model of Parkinson’s Disease. Neurotox Res. 2016, 29, 275–287. [Google Scholar] [CrossRef]
- Lee, P.-Y.; Liu, C.-C.; Wang, S.-C.; Chen, K.-Y.; Lin, T.-C.; Liu, P.-L.; Chiu, C.-C.; Chen, I.-C.; Lai, Y.-H.; Cheng, W.-C.; et al. Mycotoxin Zearalenone Attenuates Innate Immune Responses and Suppresses NLRP3 Inflammasome Activation in LPS-Activated Macrophages. Toxins 2021, 13, 593. [Google Scholar] [CrossRef]
- Guerrero-Hue, M.; García-Caballero, C.; Palomino-Antolín, A.; Rubio-Navarro, A.; Vázquez-Carballo, C.; Herencia, C.; Martín-Sanchez, D.; Farré-Alins, V.; Egea, J.; Cannata, P.; et al. Curcumin reduces renal damage associated with rhabdomyolysis by decreasing ferroptosis-mediated cell death. FASEB J. 2019, 33, 8961–8975. [Google Scholar] [CrossRef]
- Manji, G.A.; Wang, L.; Geddes, B.J.; Brown, M.; Merriam, S.; Al-Garawi, A.; Mak, S.; Lora, J.M.; Briskin, M.; Jurman, M.; et al. PYPAF1, a PYRIN-containing Apaf1-like protein that assembles with ASC and regulates activation of NF-kappa B. J. Biol. Chem. 2002, 277, 11570–11575. [Google Scholar] [CrossRef]
- Thomas, P.G.; Dash, P.; Aldridge, J.R.; Ellebedy, A.H.; Reynolds, C.; Funk, A.J.; Martin, W.J.; Lamkanfi, M.; Webby, R.J.; Boyd, K.L.; et al. The intracellular sensor NLRP3 mediates key innate and healing responses to influenza A virus via the regulation of caspase-1. Immunity 2009, 30, 566–575. [Google Scholar] [CrossRef]
- Allen, I.C.; Scull, M.A.; Moore, C.B.; Holl, E.K.; McElvania-TeKippe, E.; Taxman, D.J.; Guthrie, E.H.; Pickles, R.J.; Ting, J.P.-Y. The NLRP3 inflammasome mediates in vivo innate immunity to influenza A virus through recognition of viral RNA. Immunity 2009, 30, 556–565. [Google Scholar] [CrossRef]
- Gross, O.; Poeck, H.; Bscheider, M.; Dostert, C.; Hannesschläger, N.; Endres, S.; Hartmann, G.; Tardivel, A.; Schweighoffer, E.; Tybulewicz, V.; et al. Syk kinase signalling couples to the Nlrp3 inflammasome for anti-fungal host defence. Nature 2009, 459, 433–436. [Google Scholar] [CrossRef]
- Kanneganti, T.-D.; Body-Malapel, M.; Amer, A.; Park, J.-H.; Whitfield, J.; Franchi, L.; Taraporewala, Z.F.; Miller, D.; Patton, J.T.; Inohara, N.; et al. Critical role for Cryopyrin/Nalp3 in activation of caspase-1 in response to viral infection and double-stranded RNA. J. Biol. Chem. 2006, 281, 36560–36568. [Google Scholar] [CrossRef]
- Bauernfeind, F.G.; Horvath, G.; Stutz, A.; Alnemri, E.S.; MacDonald, K.; Speert, D.; Fernandes-Alnemri, T.; Wu, J.; Monks, B.G.; Fitzgerald, K.A.; et al. Cutting edge: NF-kappaB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression. J. Immunol. 2009, 183, 787–791. [Google Scholar] [CrossRef]
- Dostert, C.; Pétrilli, V.; Van Bruggen, R.; Steele, C.; Mossman, B.T.; Tschopp, J. Innate immune activation through Nalp3 inflammasome sensing of asbestos and silica. Science 2008, 320, 674–677. [Google Scholar] [CrossRef]
- Cruz, C.M.; Rinna, A.; Forman, H.J.; Ventura, A.L.; Persechini, P.M.; Ojcius, D.M. ATP activates a reactive oxygen species-dependent oxidative stress response and secretion of proinflammatory cytokines in macrophages. J. Biol. Chem. 2007, 282, 2871–2879. [Google Scholar] [CrossRef]
- Ma, M.W.; Wang, J.; Dhandapani, K.M.; Brann, D.W. NADPH Oxidase 2 Regulates NLRP3 Inflammasome Activation in the Brain after Traumatic Brain Injury. Oxid. Med. Cell. Longev. 2017, 2017, 6057609. [Google Scholar] [CrossRef]
- Bao, L.; Huang, Y.; Gu, F.; Liu, W.; Guo, Y.; Chen, H.; Wang, K.; Wu, Z.; Li, J. Zearalenone induces liver injury in mice through ferroptosis pathway. Sci. Total Environ. 2024, 952, 175875. [Google Scholar] [CrossRef]
Name | Primer Sequence Forward (5′-3′) | Primer Sequence Reverse (5′-3′) |
---|---|---|
Caspase7 | AAATGAACACGGAAAACAAC | TTCTGTCTGGCTTTGCATC |
Caspase9 | CTCGTGGTCATCCTCTCCCAT | CCTCTCAAACTCGGGCACTGG |
Bcl2 | GAGTTCGGCGGCGTGATGTG | CTCGGTCATCCAGGTGGCAATG |
Bax | ACTCTGCTGCTGCTCTCCTCTC | ATCCACGCAGTGCCAGATGTAATC |
Caspase3 | AGCAGACAGTGGACCAGATGAAAC | GGCGTGTTCCTTCAGCATCCTAC |
Caspase1 | GGGCTGGCAGGACTCTGATAGG | TCTCTCCCGTGGCTGGTATATGTC |
NLRP3 | GCTCCTTGCGTGCTCTAAGACC | TTGTGCTTCCAGATGCCGTCAG |
ASC | CCAGCAAAGCCTCCGCCAAG | CAGCAATCCAGCCACCTCATACG |
NFκB | GCTCACAAAGGCAGTCTCACCAG | AGGTCTCTACGCCGCTGTCAC |
IκB-α | TGGCGATCATTCACGAGGAAAAGG | GTCTGGCTGAGGTTGTTCTGGAAG |
RIPK1 | GCCTGTTGAGAGCTGTGAGACTTC | AGGGGTGTATGGTGGAACTACTGG |
RIPK3 | CCCTCCATTCACTCATCCACAAGC | GCAGTGGCAGTCAGCAGGAAG |
MLKL | TGCGAGCACCGATACCAGGAG | TCCAGGTCAGCCAGCAAGTCC |
GAPDH | CAGAACATCATCCCAGCGTCCAC | CGGCAGGTCAGGTCAACAACAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, T.; Wang, F.; Qian, M.; Wang, J.; Guo, M. Glycyrrhizin Alleviates the Damage Caused by Zearalenone and Protects the Glandular Stomach of Chickens. Animals 2025, 15, 489. https://doi.org/10.3390/ani15040489
Sun T, Wang F, Qian M, Wang J, Guo M. Glycyrrhizin Alleviates the Damage Caused by Zearalenone and Protects the Glandular Stomach of Chickens. Animals. 2025; 15(4):489. https://doi.org/10.3390/ani15040489
Chicago/Turabian StyleSun, Tong, Fuhan Wang, Man Qian, Jingjing Wang, and Mengyao Guo. 2025. "Glycyrrhizin Alleviates the Damage Caused by Zearalenone and Protects the Glandular Stomach of Chickens" Animals 15, no. 4: 489. https://doi.org/10.3390/ani15040489
APA StyleSun, T., Wang, F., Qian, M., Wang, J., & Guo, M. (2025). Glycyrrhizin Alleviates the Damage Caused by Zearalenone and Protects the Glandular Stomach of Chickens. Animals, 15(4), 489. https://doi.org/10.3390/ani15040489