Effect of Supplementation of Quercetagetin on the Antioxidant Function, Liver Mitochondrial Function and Gut Microbiota of Broilers at High Stocking Density
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals and Design
2.2. Rearing Management
2.3. Growth Performance Measurement
2.4. Sample Collection
2.5. Serum Hormone Measurement
2.6. Measurement of Immune and Antioxidant Parameters in Serum and Liver
2.7. Preparation of Liver Mitochondria and Measurement of Antioxidant Parameters
2.8. Measurement of Liver Mitochondrial Respiratory Chain Complexes and ATP Contents
2.9. Total RNA Isolation and Gene Expression Analysis
2.10. Analysis of Cecal Microbiota
2.11. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Serum Hormone Measurement
3.3. Serum and Liver Immunity Parameters
3.4. Serum and Liver Antioxidant Parameters
3.5. Antioxidant Parameters of Liver Mitochondria
3.6. Mitochondrial Respiratory Chain Complex Activity
3.7. Mitochondrial mtDNA and ATP Content in the Liver
3.8. Expression of Genes Related to Mitochondrial Biogenesis
3.9. Expression of Antioxidant-Related Genes in Liver Mitochondria
3.10. Cecal Microbial Community Diversity
3.11. Correlation Analysis of Growth Performance, Immune and Oxidative Function Indicators with Cecal Microbiota
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhang, H.J.; Zhang, Y.; Bai, D.Y.; Zhong, J.L.; Hu, X.D.; Zhang, R.L.; Zhen, W.R.; Ito, K.C.; Zhang, B.K.; Yang, Y.J.; et al. Effect of dietary aspirin eugenol ester on the growth performance, antioxidant capacity, intestinal inflammation, and cecal microbiota of broilers under high stocking density. Poult. Sci. 2024, 103, 103825. [Google Scholar] [CrossRef]
- Miao, Z.Q.; Dong, Y.Y.; Qin, X.; Yuan, J.M.; Han, M.M.; Zhang, K.K.; Shi, S.R.; Song, X.Y.; Zhang, J.Z.; Li, J.H. Dietary supplementation of methionine mitigates oxidative stress in broilers under high stocking density. Poult. Sci. 2021, 100, 101231. [Google Scholar] [CrossRef]
- Xin, X.Q.; Han, M.M.; Wu, Y.; Dong, Y.Y.; Miao, Z.Q.; Zhang, J.Z.; Song, X.Y.; Jia, R.; Su, Y.; Liu, C.; et al. Dietary supplemental chromium yeast improved the antioxidant capacity, immunity and liver health in broilers under high stocking density. Animals 2022, 12, 2216. [Google Scholar] [CrossRef]
- Hafez, M.H.; El-Kazaz, S.E.; Alharthi, B.; Ghamry, H.I.; Alshehri, M.A.; Sayed, S.; Shukry, M.; El-Sayed, Y.S. The Impact of curcumin on growth performance, growth-related gene expression, oxidative stress, and immunological biomarkers in broiler chickens at different stocking densities. Animals 2022, 12, 958. [Google Scholar] [CrossRef]
- Wu, Y.; Wang, Y.; Yin, D.; Wu, W.; Sun, X.; Zhang, Y.; Guo, X.; Chen, J.; Yuan, J. Effect of supplementation of nicotinamide and sodium butyrate on the growth performance, liver mitochondrial function and gut microbiota of broilers at high stocking density. Food. Funct. 2019, 10, 7081–7090. [Google Scholar] [CrossRef]
- Ouyang, J.X.; Zhang, C.; Deng, C.X.; Wen, A.; Zhou, H.; You, J.M.; Li, G.H. Dietary vitamin B6 supplementation alleviates heat stress-induced intestinal barrier impairment by regulating the gut microbiota and metabolites in broilers. Poult. Sci. 2024, 103, 104202. [Google Scholar] [CrossRef]
- Shakeri, M.; Kong, B.; Zhuang, H.; Bowker, B. Potential role of ribonucleotide reductase enzyme in mitochondria function and woody breast condition in broiler chickens. Animals 2023, 13, 2038. [Google Scholar] [CrossRef]
- Mishra, P.; Chan, D.C. Metabolic regulation of mitochondrial dynamics. J. Cell Biol. 2016, 212, 379–387. [Google Scholar] [CrossRef]
- Chen, W.H.; Shen, Z.L.; Dong, W.X.; Huang, G.W.; Yu, D.Y.; Chen, W.Z.; Yan, X.L.; Yu, Z. Polygonatum sibiricum polysaccharide ameliorates skeletal muscle aging via mitochondria-associated membrane-mediated calcium homeostasis regulation. Phytomedicine 2024, 129, 155567. [Google Scholar] [CrossRef]
- Xu, J.; Feng, Z.H. Role of oxidative stress in mitochondrial function: Relevance for liver function. Antioxidants 2023, 12, 1784. [Google Scholar] [CrossRef]
- Zhang, J.F.; Yang, Y.X.; Han, H.L.; Zhang, L.L.; Wang, T. Bisdemethoxycurcumin protects small intestine from lipopolysaccharide-induced mitochondrial dysfunction via activating mitochondrial antioxidant systems and mitochondrial biogenesis in broiler chickens. Oxid. Med. Cell. Longev. 2021, 2021, 9927864. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Yang, C.; Tang, D.F.; Yu, Q.L.; Zhang, L. Effects of dietary supplementation with selenium yeast and jujube powder on mitochondrial oxidative damage and apoptosis of chicken. Poult. Sci. 2022, 101, 102072. [Google Scholar] [CrossRef]
- Ouyang, Y.; Peng, Y.; Li, J.; Holmgren, A.; Lu, J. Modulation of thiol-dependent redox system by metal ions via thioredoxin and glutaredoxin systems. Metallomics 2018, 10, 218–228. [Google Scholar] [CrossRef]
- Scalcon, V.; Bindoli, A.; Rigobello, M.P. Significance of the mitochondrial thioredoxin reductase in cancer cells: An update on role, targets and inhibitors. Free. Radical. Bio. Med. 2018, 127, 62–79. [Google Scholar] [CrossRef]
- Emami, N.K.; Golian, A.; Mesgaran, M.D.; Authony, N.B. Mitochondrial biogenesis and PGC-1α gene expression in male broilers from ascites-susceptible and -resistant lines. J. Anim. Physiol. Anim. Nutr. 2017, 102, 12706. [Google Scholar] [CrossRef]
- Xie, Z.C.; Yu, G.; Yun, Y.; Zhang, X.; Shen, M.M.; Jia, M.H.; Li, A.Q.; Zhang, H.; Wang, T.; Zhang, J.F.; et al. Effects of bamboo leaf extract on energy metabolism, antioxidant capacity, and biogenesis of small intestine mitochondria in broilers. J. Anim. Sci. 2022, 101, skac391. [Google Scholar] [CrossRef]
- Wu, F.Y.; Wang, F.X.; Tang, Z.H.; Yang, X.Y.; Liu, Y.H.; Zhao, M.; Liu, S.D.; Han, S.J.; Zhang, Z.S.; Chen, B.J. Quercetagetin alleviates zearalenone-induced liver injury in rabbits through Keap1/Nrf2/ ARE signaling pathway. Front. Pharmacol. 2023, 14, 1271384. [Google Scholar] [CrossRef]
- Yang, S.; Huo, M.; Su, Z.X.; Wang, F.F.; Zhang, Y.Y.; Zhong, C.H.; Shi, Y.X. The impact of dietary supplementation of Quercetagetin on growth, antioxidant capacity, and gut microbiota of diquat-challenged broilers. Front. Microbiol. 2024, 15, 1453145. [Google Scholar] [CrossRef]
- Ministry of Agriculture of the People’s Republic of China. Feeding Standard of Chicken in China (NY/T 33–2004). Hunan Feed 2004, 4, 19–27. (In Chinese) [Google Scholar]
- Oliveira, G.D.; Lara, J.C. Lighting programmes and its implications for broiler chickens. World Poultry. Sci. J. 2016, 72, 735–742. [Google Scholar] [CrossRef]
- Michael, P.M. How mitochondria produce reactive oxygen species. Biochem. J. 2009, 417, 1–13. [Google Scholar] [CrossRef]
- Shakeri, M.; Zulkifli, I.; Soleimani, A.F.; O’Reilly, E.L.; Eckersall, P.D.; Anna, A.A.; Kumari, S.; Abdullah, F.F.J. Response to dietary supplementation of L-glutamine and L-glutamate in broiler chickens reared at different stocking densities under hot, humid tropical conditions. Poult. Sci. 2014, 93, 2700–2708. [Google Scholar] [CrossRef] [PubMed]
- Li, W.J.; Wei, F.X.; Xu, B.; Sun, Q.Y.; Deng, W.; Ma, H.H.; Bai, J.; Li, S.Y. Effect of stocking density and alpha-lipoic acid on the growth performance, physiological and oxidative stress and immune response of broilers. Asian-Australas. J Anim Sci. 2019, 32, 1914–1922. [Google Scholar] [CrossRef] [PubMed]
- Son, J.; Kim, H.J.; Hong, E.C.; Kang, H.K. Effects of Stocking Density on Growth Performance, Antioxidant Status, and Meat Quality of Finisher Broiler Chickens under High Temperature. Antioxidants 2022, 11, 871. [Google Scholar] [CrossRef] [PubMed]
- Goo, D.; Kim, J.H.; Choi, H.S.; Park, G.H.; Han, G.P.; Kil, D.Y. Effect of stocking density and sex on growth performance, meat quality, and intestinal barrier function in broiler chickens. Poult. Sci. 2019, 98, 1153–1160. [Google Scholar] [CrossRef]
- Li, X.M.; Zhang, H.M.; Liu, S.M.; Feng, J.H.; Ma, D.D.; Liu, Q.X.; Zhou, Y.; Wang, X.J.; Xing, S. Effects of stocking density on growth performance, growth regulatory factors, and endocrine hormones in broilers under appropriate environments. Poult. Sci. 2019, 98, 6611–6617. [Google Scholar] [CrossRef]
- Sanchez, C.R.; Sarmiento, F.L.; Phillips, C. The effects of outdoor access and stocking density on performance of broilers reared under tropical conditions. Brit. Poult. Sci. 2021, 62, 632–637. [Google Scholar] [CrossRef]
- Wang, Y.P.; Jin, T.H.; Zhang, N.B.; Li, J.K.; Wang, Y.; Kulyar, M.F.A.; Han, Z.Q.; Li, Y.Z. Effect of stocking density and age on physiological performance and dynamic gut bacterial and fungal communities in Langya hens. Microb. Cell. Fact. 2021, 20, 218–233. [Google Scholar] [CrossRef]
- Liang, H.Q.; Fan, D.F.; Hu, W.Y.; Wu, F.Y.; Tan, K.; Zhao, P.Y.; Han, S.J.; Chen, B.J. Effects of quercetagetin on the growth performance, nutrient digestibility, slaughter performance, meat quality, and antioxidant capacity of broiler chickens. Anim. Sci. J. 2024, 95, e70008. [Google Scholar] [CrossRef]
- Zhang, J.F.; Bai, K.W.; Su, W.P.; Wang, A.A.; Zhang, L.L.; Huang, K.H.; Wang, T. Curcumin attenuates heat-stress-induced oxidant damage by simultaneous activation of GSH-related antioxidant enzymes and Nrf2-mediated phase II detoxifying enzyme systems in broiler chickens. Poult. Sci. 2018, 97, 1209–1219. [Google Scholar] [CrossRef]
- Dunlop, B.W.; Wong, A. The hypothalamic-pituitary-adrenal axis in PTSD: Pathophysiology and treatment interventions. BMC Psychiatry 2018, 89, 361–379. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.W.; Zhou, Z.L.; Zhang, H.; Ma, R.S.; Hou, J.F. Bone response of broiler chickens (Gallus gallus domesticus) induced by corticosterone. Comp. Biochem. Phys. A. 2013, 164, 410–416. [Google Scholar] [CrossRef]
- Yang, S.; Huo, M.; Xu, Y.Q.; Xing, Y.Y.; Li, K.N.; Jin, X.; Yan, S.M.; Shi, B.L. Impacts of Artemisia argyi alcohol extract supplementation on lipopolysaccharide-induced oxidative stress in broilers and the underlying mechanism. J. Appl. Poultry. Res. 2024, 33, 100470. [Google Scholar] [CrossRef]
- Wu, F.; Wang, H.; Li, S.; Wei, Z.; Han, S.; Chen, B. Effects of dietary supplementation with quercetagetin on nutrient digestibility, intestinal morphology, immunity, and antioxidant capacity of broilers. Front. Vet. Sci. 2022, 9, 1060140. [Google Scholar] [CrossRef]
- Kareem, K.Y.; Loh, T.C.; Foo, H.L.; Akit, H.; Samsudin, A.A. Effects of dietary postbiotic and inulin on growth performance, IGF1 and GHR mRNA expression, faecal microbiota and volatile fatty acids in broilers. BMC Vet. Res. 2016, 12, 163–173. [Google Scholar] [CrossRef]
- Selvam, R.; Saravanakumar, M.; Suresh, S.; Sureshbabu, G.; Sasikumar, M.; Prashanth, D. Effect of vitamin E supplementation and high stocking density on the performance and stress parameters of broilers. Braz. J. Poult. Sci. 2017, 19, 587–594. [Google Scholar] [CrossRef]
- Simitzis, P.E.; Kalogeraki, E.; Goliomytis, M.; Charismiadou, M.A.; Triantaphyllopoulos, K.; Ayoutanti, A.; Niforou, K.; Hager-Theodorides, A.L.; Deligeorgis, S.G. Impact of stocking density on broiler growth performance, meat characteristics, behavioral components and indicators of physiological and oxidative stress. Brit. Poult. Sci. 2012, 53, 721–730. [Google Scholar] [CrossRef]
- Gao, X.L.; Gong, J.G.; Yang, B.W.; Liu, Y.C.; Xu, H.J.; Hao, Y.S.; Jing, J.L. Effect of classical music on growth performance, stress level, antioxidant index, immune function and meat quality in broilers at different stocking densities. Front. Vet. Sci. 2023, 10, 1227654. [Google Scholar] [CrossRef]
- Das, H.; Lacin, E. The effect of different photoperiods and stocking densities on fattening performance, carcass and some stress parameters in broilers. Isr. J. Vet. Med. 2014, 69, 211–220. [Google Scholar]
- Rambold, A.S.; Pearce, E.L. Mitochondrial dynamics at the interface of immune cell metabolism and function. Trends. Immunol. 2018, 39, 6–18. [Google Scholar] [CrossRef]
- Bottje, W.; Pumford, N.R.; Dirain, C.; Iqbal, M.; Lassiter, K. Feed efficiency and mitochondrial function. Poult. Sci. 2006, 85, 8–814. [Google Scholar] [CrossRef] [PubMed]
- Hunter, R.G.; Seligsohn, M.; Rubin, T.G.; Griffiths, B.B.; Ozdemir, Y.; Pfaff, D.W.; Datson, N.A.; McEwen, B.S. Stress and corticosteroids regulate rat hippocampal mitochondrial DNA gene expression via the glucocorticoid receptor. Proc. Natl. Acad. Sci. USA 2016, 113, 9099–9104. [Google Scholar] [CrossRef]
- Hirata, H.; Ueda, S.; Ichiseki, T.; Shimasaki, M.; Ueda, Y.; Kaneuji, A.; Kawahara, N. Taurine inhibits glucocorticoid-induced bone mitochondrial injury, preventing osteonecrosis in rabbits and cultured osteocytes. Int. J. Mol. Sci. 2020, 21, 6892. [Google Scholar] [CrossRef] [PubMed]
- Rahnert, J.A.; Zheng, B.; Hudson, M.B.; Woodworth-Hobbs, M.E.; Price, S.R. Glucocorticoids alter CRTC-CREB signaling in muscle cells: Impact on PGC-1α expression and atrophy markers. PLoS ONE 2016, 11, e0159181. [Google Scholar] [CrossRef]
- Ferver, A.; Greene, E.; Wideman, R.; Dridi, S. Evidence of mitochondrial dysfunction in bacterial chondronecrosis with osteomyelitis-affected broilers. Front. Vet. Sci. 2021, 8, 640901. [Google Scholar] [CrossRef]
- Choi, G.E.; Lee, H.J.; Chae, C.W.; Cho, J.H.; Jung, Y.H.; Kim, J.S.; Kim, S.Y.; Lim, J.R.; Han, H.J. BNIP3L/NIX-mediated mitophagy protects against glucocorticoid-induced synapse defects. Nat. Commun. 2021, 12, 487. [Google Scholar] [CrossRef]
- Alswat, A.S. The influence of the gut microbiota on host health: A focus on the gut–lung axis and therapeutic approaches. Life 2024, 14, 1279. [Google Scholar] [CrossRef]
- Sergeant, M.J.; Congstantinidou, C.; Cogan, T.A.; Michael, R.; Penn, C.W.; Pallen, M.J. Extensive microbial and functional diversity within the chicken cecal microbiome. PLoS ONE 2014, 9, e91941. [Google Scholar] [CrossRef]
- Jabeen, M.F.; Hinks, T.S.C. MAIT cells and the microbiome. Front. Immunol. 2023, 14, 1127588. [Google Scholar] [CrossRef]
- Ding, G.A.; Yang, X.Z.; Li, Y.; Wang, Y.; Du, Y.J.; Wang, M.; Ye, R.X.; Wang, J.J.; Zhang, Y.K.; Chen, Y.J.; et al. Gut microbiota regulates gut homeostasis, mucosal immunity and influences immune-related diseases. Mol. Cell Biochem. 2024, 2024, 39060829. [Google Scholar] [CrossRef]
- Wang, K.; Shen, D.; Dai, P.Y.; Li, C.M. Particulate matter in poultry house on poultry respiratory disease: A systematic review. Poult. Sci. 2023, 102, 102556. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.D.; Kong, L.L.; Hu, X.D.; Bai, H.; Wang, Z.X.; Jiang, Y.; Bi, Y.L.; Chang, G.B.; Chen, G.H. Effect of stocking density on performance, meat quality and cecal bacterial communities of yellow feather broilers. Anim. Biotechnol. 2022, 33, 1322–1332. [Google Scholar] [CrossRef]
- Dalile, B.; Oudenhove, L.V.; Vervliet, B.; Verbeke, K. The role of short-chain fatty acids in microbiota-gut-brain communication. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 461–478. [Google Scholar] [CrossRef]
- Shterzer, N.; Sbehat, Y.; Poudel, B.; Rothschild, N.; Oloko, O.E. Differences in gut bacterial community composition between modern and slower-growing broiler breeder lines: Implications of growth selection on microbiome composition. Front. Physiol. 2023, 14, 1151151. [Google Scholar] [CrossRef]
- GB/T 35892-2018; Laboratory Animal—Guideline for Ethical Review of Animal Welfare. National Standard of the People’s Republic of China: Beijing, China. Available online: https://www.chinesestandard.net/PDF.aspx/GBT35892-2018 (accessed on 23 January 2025).
Items | 1 to 21 Days of Age | 22 to 42 Days of Age |
---|---|---|
Ingredients | ||
Corn | 52.50 | 58.80 |
Soybean meal | 40.00 | 33.80 |
Soybean oil | 3.00 | 3.00 |
Dicalcium phosphate | 1.90 | 1.80 |
Limestone | 1.08 | 1.22 |
Salt | 0.37 | 0.37 |
Lysine | 0.05 | 0.03 |
Methionine | 0.19 | 0.07 |
Premix (1) | 0.80 | 0.80 |
Choline chloride | 0.11 | 0.11 |
Total | 100.00 | 100.00 |
Nutrient levels (2) | ||
Metabolic energy (MJ/kg) | 12.42 | 12.62 |
Crude protein | 21.77 | 19.65 |
Calcium | 1.00 | 1.02 |
Available phosphorus | 0.44 | 0.42 |
Lysine | 1.34 | 1.15 |
Methionine | 0.55 | 0.40 |
Cystine | 0.40 | 0.36 |
Genes | Gene Bank No. | Primer Sequences, 5′-3′ | Length (bp) |
---|---|---|---|
β-Actin | NM_205518 | F-GCCAACAGAGAGAAGATGACAC | 118 bp |
R-GTAACACCATCACCAGAGTCCA | |||
mtD-loop | XM_015291451.1 | F-AGGACTACGGCTTGAAAAGC | 198 bp |
R- CATCTTGGCATCTTCAGTGCC | |||
PGC-1α | AB170013.1 | F-GACGTATCGCCTTCTTGCTC | 157 bp |
R-CTCGATCGGGAATATGGAGA | |||
NRF1 | NM_001030646.1 | F-AAGAACACGGCGTGACTCAA | 274 bp |
R-TCGCTTCCGTTTCTTACCCG | |||
NRF2 | NM_001007858.1 | F-GAGCCCATGGCCTTTCCTAT | 212 bp |
R-CACAGAGGCCCTGACTCAAA | |||
TFAM | NM_204100.1 | F-GTGAAAGCCTGGCGAAACTG | 136 bp |
R- CACAGCTCAGGTTACACCGT | |||
GR | XM_040671422.1 | F-TCCTGACTACGGCTTCGAGA | 150 bp |
R-AACTTGCCGTAACCACGGAT | |||
MnSOD | NM_204211.2 | F-GTTACAGCTCAGGTGTCGCT | 115 bp |
R-CTCCTTTAGGCTCCCCTCCT | |||
Trx2 | NM_001031410.1 | F-AGTACGAGGTGTCAGCAGTG | 141 bp |
R-CACACGTTGTGAGCAGGAAG | |||
Trx2R | NM_001122691.1 | F-CCGGGTCCCTGACATCAAA | 94 bp |
R-TAGCTTCGCTGGCATCAACA |
Item | LD | HD | SEM | p-Value | ||||
---|---|---|---|---|---|---|---|---|
CON | QG | HSD | H_QG | QG | HD | QG × HD | ||
BW (kg) | 1.58 | 1.63 | 1.50 | 1.55 | 0.02 | 0.36 | 0.02 | 0.88 |
ADG (g/d) | 74.61 | 79.87 | 68.93 | 69.88 | 1.68 | 0.64 | 0.03 | 0.04 |
ADFI (g/d) | 128.11 | 134.43 | 124.69 | 126.52 | 1.97 | 0.46 | 0.02 | 0.59 |
F/G | 1.90 | 1.84 | 1.93 | 1.85 | 0.06 | 0.45 | 0.75 | 0.11 |
Item | LD | HD | SEM | p-Value | ||||
---|---|---|---|---|---|---|---|---|
CON | QG | HSD | H_QG | QG | HD | QG × HD | ||
CORT (ng/L) | 29.37 | 28.65 | 39.87 | 30.39 | 2.27 | 0.03 | 0.02 | 0.11 |
ACTH (pg/L) | 20.77 | 17.30 | 31.25 | 19.11 | 2.21 | 0.04 | 0.03 | 0.03 |
IGF-I (ng/L) | 40.31 | 36.40 | 38.70 | 37.15 | 2.52 | 0.33 | 0.89 | 0.67 |
GH (ng/L) | 4.28 | 5.01 | 3.42 | 3.93 | 0.33 | 0.34 | 0.04 | 0.41 |
Item | LD | HD | SEM | p-Value | ||||
---|---|---|---|---|---|---|---|---|
CON | QG | HSD | H_QG | QG | HD | QG × HD | ||
Serum | ||||||||
IL-1β (pg/mL) | 122.07 | 119.83 | 163.92 | 127.92 | 5.24 | 0.23 | <0.01 | 0.30 |
IL-6 (pg/mL) | 5.43 | 5.67 | 6.44 | 5.94 | 1.28 | 0.08 | 0.51 | 0.42 |
IgA (μg/mL) | 57.53 | 58.21 | 63.38 | 56.97 | 4.43 | 0.32 | 1.54 | 0.23 |
IgG (μg/mL) | 474.18 | 502.17 | 652.43 | 537.65 | 22.50 | 0.43 | <0.01 | 0.04 |
IgM (μg/mL) | 141.26 | 155.69 | 287.42 | 189.51 | 27.17 | 0.62 | 0.03 | 0.17 |
Liver | ||||||||
IL-1β (pg/mg prot.) | 15.62 | 14.71 | 32.95 | 13.45 | 3.23 | 0.04 | 0.03 | <0.01 |
IL-6 (pg/mg prot.) | 1.03 | 0.95 | 3.84 | 1.33 | 0.20 | 0.07 | <0.01 | <0.01 |
IgA (μg/mg prot.) | 4.83 | 5.07 | 5.25 | 5.26 | 0.44 | 0.27 | 0.13 | 0.21 |
IgG (μg/mg prot.) | 52.35 | 56.26 | 59.02 | 53.77 | 8.98 | 0.46 | 0.57 | 0.39 |
IgM (μg/mg prot.) | 10.03 | 11.57 | 20.17 | 11.79 | 1.58 | 0.43 | 0.03 | <0.01 |
Item | LD | HD | SEM | p-Value | ||||
---|---|---|---|---|---|---|---|---|
CON | QG | HSD | H_QG | QG | HD | QG × HD | ||
Serum | ||||||||
GSH-Px (U/mL) | 3957.4 | 3644.8 | 2981.8 | 3805.6 | 211.17 | 0.45 | 0.15 | 0.08 |
CAT (U/mL) | 5.85 | 6.23 | 2.74 | 4.72 | 0.52 | 0.65 | 0.03 | 0.30 |
T-SOD (U/mL) | 356.12 | 383.43 | 237.11 | 368.69 | 28.15 | 0.04 | 0.03 | 0.41 |
MDA (nmol/mL) | 3.53 | 2.95 | 4.91 | 3.96 | 0.31 | 0.23 | 0.08 | 0.25 |
Liver | ||||||||
GSH-Px (U/mg prot.) | 88.73 | 141.67 | 58.49 | 73.75 | 9.15 | 0.02 | 0.03 | <0.01 |
CAT (U/mg prot.) | 9.17 | 8.75 | 8.64 | 7.83 | 0.55 | 0.38 | 0.42 | 0.13 |
T-SOD (U/mg prot.) | 892.5 | 1422.9 | 593.5 | 764.7 | 107.4 | 0.04 | 0.02 | <0.01 |
MDA (nmol/mg prot.) | 1.78 | 2.37 | 6.11 | 1.85 | 0.82 | 0.04 | 0.02 | 0.02 |
Item | LD | HD | SEM | p-Value | ||||
---|---|---|---|---|---|---|---|---|
CON | QG | HSD | H_QG | QG | HD | QG × HD | ||
Liver mictochondria | ||||||||
GSH (mg/g prot.) | 13.57 | 15.62 | 8.47 | 7.69 | 0.67 | 0.42 | 0.02 | 0.04 |
MnSOD (U/mg prot.) | 16.55 | 19.38 | 15.96 | 18.73 | 0.39 | 0.02 | 0.27 | 0.69 |
MDA (nmol/mg prot.) | 2.46 | 1.98 | 7.35 | 4.22 | 0.19 | 0.04 | <0.01 | 0.03 |
Item | LD | HD | SEM | p-Value | ||||
---|---|---|---|---|---|---|---|---|
CON | QG | HSD | H_QG | QG | HD | QG × HD | ||
Liver mictochondria | ||||||||
Complex I (μmol NADH/min/mg prot.) | 10.06 | 9.83 | 4.39 | 9.02 | 0.35 | 0.02 | <0.01 | 0.03 |
Complex II (μmol NADH/min/mg prot.) | 7.89 | 8.54 | 7.02 | 6.97 | 0.22 | 0.12 | 0.04 | 0.37 |
Complex III (μmol cytochrome c/min/mg prot.) | 22.37 | 20.89 | 14.65 | 19.42 | 0.56 | 0.03 | <0.01 | 0.01 |
Complex IV (μmol CoQH2/min/mg prot.) | 47.33 | 45.09 | 38.76 | 42.15 | 1.45 | 0.16 | 0.09 | 0.16 |
Item | LD | HD | SEM | p-Value | ||||
---|---|---|---|---|---|---|---|---|
CON | QG | HSD | H_QG | QG | HD | QG × HD | ||
Phylum | ||||||||
Firmicutes | 0.89 | 0.83 | 0.97 | 0.96 | 0.15 | 0.07 | 0.03 | 0.28 |
Bacteroidota | 0.07 | 0.08 | 0.02 | 0.03 | 0.06 | 0.42 | 0.02 | 0.12 |
Genus | ||||||||
Faecalibacterium | 0.19 | 0.21 | 0.22 | 0.20 | 0.11 | 0.79 | 0.94 | 0.65 |
Lachnospiraceae_unclassified | 0.08 | 0.07 | 0.09 | 0.08 | 0.02 | 0.24 | 0.22 | 0.92 |
Clostridia_vadinBB60_group_norank | 0.05 | 0.09 | 0.05 | 0.11 | 0.06 | 0.03 | 0.07 | 0.72 |
Clostridia_UCG-014_norank | 0.04 | 0.03 | 0.06 | 0.06 | 0.03 | 0.77 | 0.02 | 0.35 |
Ruminococcaceae_unclassified | 0.04 | 0.02 | 0.05 | 0.02 | 0.02 | 0.41 | 0.02 | 0.95 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, S.; Su, Z.; Huo, M.; Zhong, C.; Wang, F.; Zhang, Y.; Song, Y.; Shi, Y. Effect of Supplementation of Quercetagetin on the Antioxidant Function, Liver Mitochondrial Function and Gut Microbiota of Broilers at High Stocking Density. Animals 2025, 15, 398. https://doi.org/10.3390/ani15030398
Yang S, Su Z, Huo M, Zhong C, Wang F, Zhang Y, Song Y, Shi Y. Effect of Supplementation of Quercetagetin on the Antioxidant Function, Liver Mitochondrial Function and Gut Microbiota of Broilers at High Stocking Density. Animals. 2025; 15(3):398. https://doi.org/10.3390/ani15030398
Chicago/Turabian StyleYang, Shuo, Zixuan Su, Min Huo, Cuihong Zhong, Fangfang Wang, Yongying Zhang, Yaqi Song, and Yuxiang Shi. 2025. "Effect of Supplementation of Quercetagetin on the Antioxidant Function, Liver Mitochondrial Function and Gut Microbiota of Broilers at High Stocking Density" Animals 15, no. 3: 398. https://doi.org/10.3390/ani15030398
APA StyleYang, S., Su, Z., Huo, M., Zhong, C., Wang, F., Zhang, Y., Song, Y., & Shi, Y. (2025). Effect of Supplementation of Quercetagetin on the Antioxidant Function, Liver Mitochondrial Function and Gut Microbiota of Broilers at High Stocking Density. Animals, 15(3), 398. https://doi.org/10.3390/ani15030398