An Insight into Differentially Expressed Genes and MicroRNAs in the Pituitary Glands of the Two Estrous Phases of Sheep with Different FecB Genotypes
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Animals and Sample Collection
2.3. RNA Extraction, Library Construction, and Sequencing
2.4. Sequencing Data Filtering and Comparative Analysis
2.5. miRNA Targets Prediction
2.6. Analysis of DE mRNA and miRNA
2.7. Perform GO and KEGG Analysis on Predicted Differential Target Genes of miRNAs
2.8. Reverse Transcription (RT)-qPCR Validation
2.9. Dual-Luciferase Reporter Assays
2.10. Statistical Analysis
3. Results
3.1. Library Sequencing and Quality Control
3.2. Screening of Differentially Expressed miRNA
3.3. Pathway Enrichment Analysis of miRNA Targets
3.4. Validation of RNA Sequencing Using RT-qPCR
3.5. Plasmid Construction and Dual-Luciferase Experimental Validation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Pellicer-Rubio, M.T.; Laignel, G.; Thomas, Y.; Prache, S.; Benoit, M.; Tournadre, H. Reproductive performance in two organic sheep farming systems differing by the number of mating sessions in and out of the breeding season. Theriogenology 2023, 195, 238–248. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.L.; Zhang, J.; Tuersuntuoheti, M.; Chang, Q.; Liu, S. Population structure, genetic diversity and prolificacy in Pishan red sheep under an extreme desert environment. Front. Genet. 2023, 14, 1092066. [Google Scholar] [CrossRef] [PubMed]
- Davis, G.H.; Montgomery, G.W.; Allison, A.J.; Kelly, R.W.; Bray, A.R. Segregation of a major gene influencing fecundity in progeny of Booroola Sheep. N. Z. J. Agric. Res. 1982, 25, 525–529. [Google Scholar] [CrossRef]
- Qi, M.Y.; Xu, L.Q.; Zhang, J.N.; Li, M.O.; Lu, M.H.; Yao, Y.C. Effect of the Booroola Fecundity (FecB) gene on the reproductive performance of ewes under assisted reproduction. Theriogenology 2020, 142, 246–250. [Google Scholar] [CrossRef]
- Wang, X.Y.; Guo, X.F.; He, X.Y.; Liu, Q.Y.; Di, R.; Hu, W.P.; Cao, X.H.; Zhang, X.S.; Zhang, J.L.; Chu, M.X. Effects of FecB mutation on estrus, ovulation, and endocrine characteristics in Small Tail Han Sheep. Front. Vet. Sci. 2021, 8, 709737. [Google Scholar] [CrossRef]
- Chu, M.X.; Jia, L.H.; Zhang, Y.J.; Jin, M.L.; Chen, H.Q.; Fang, L.; Di, R.; Cao, G.L.; Feng, T.; Tang, Q. Polymorphisms in BMPR-1B gene affect litter size in Chinese indigenous sheep breed. Mol. Biol. Rep. 2011, 38, 4071–4076. [Google Scholar] [CrossRef]
- Wang, X.; Guo, X.; He, X.; Di, R.; Zhang, X.; Zhang, J.; Chu, M. Integration Analysis of Pituitary Proteome and Transcriptome Reveals Fertility-Related Biomarkers in FecB Mutant Small Tail Han Sheep. Front. Endocrinol. 2024, 15, 1417530. [Google Scholar] [CrossRef]
- Mo, F.T.; Sun, W.B.; Zhang, L.P.; Zhang, X.Y.; La, Y.F.; Xiao, F.; Jia, J.L.; Jin, J.P. Polymorphisms in BMPRIB gene affect litter size in Chinese indigenous sheep breed. Anim. Biotechnol. 2023, 34, 538–545. [Google Scholar] [CrossRef]
- Zhang, Y.L.; Li, F.Z.; Feng, X.; Yang, H.; Zhu, A.X.; Pang, J.; Han, L.; Zhang, T.T.; Yao, X.L.; Wang, F. Genome-Wide Analysis of DNA Methylation Profiles on Sheep Ovaries Associated with Prolificacy Using Whole-Genome Bisulfite Sequencing. BMC Genom. 2017, 18, 759. [Google Scholar] [CrossRef]
- Ma, X.F.; Liu, A.J.; Zheng, Z.; Hu, B.X.; Zhi, Y.X.; Liu, C.; Tian, S.J. Resolving and Functional Analysis of RNA Editing Sites in Sheep Ovaries and Associations with Litter Size. Anim. Int. J. Anim. Biosci. 2024, 18, 101342. [Google Scholar] [CrossRef]
- Kaprara, A.; Huhtaniemi, I.T. The hypothalamus-pituitary-gonad axis: Tales of mice and men. Metabolism 2018, 86, 3–17. [Google Scholar] [CrossRef] [PubMed]
- Tang, J.S.; Hu, W.P.; Di, R.; Liu, Q.Y.; Wang, X.Y.; Zhang, X.S.; Zhang, J.L.; Chu, M.X. Expression analysis of the prolific candidate genes, BMPR-1B, BMPR-15, and GDF9 in Small Tail Han ewes with three fecundity (FecB gene) genotypes. Animals 2018, 8, 166. [Google Scholar] [CrossRef] [PubMed]
- Abbara, A.; Patel, A.; Hunjan, T.; Clarke, S.A.; Chia, G.; Eng, P.C.; Phylactou, M.; Comninos, A.N.; Lavery, S.; Trew, G.H.; et al. FSH requirements for follicle growth during controlled ovarian stimulation. Front. Endocrinol. 2019, 10, 579. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.; Kang, H. Nucleolin regulates pulmonary artery smooth muscle cell proliferation under hypoxia by modulating miRNA expression. Cells 2023, 12, 817. [Google Scholar] [CrossRef]
- Gong, Y.; Generali, M.; Renikunta, H.V.; Balbi, C.; Wang, Y.; Mohammed, S.A.; Gorica, E.; Mongelli, A.; Ruschitzka, F.; Landmesser, U.; et al. miRNA-519e promotes cardiomyocyte cell division accompanied by pro-angiogenic and anti-apoptotic effects. Eur. Heart. J. 2024, 45, ehae666.3719. [Google Scholar] [CrossRef]
- Yang, W.Y.; Liu, Z.Y.; Zhu, Y.; Xiao, Y.; Xiao, W.F.; Tang, L.; Dong, Z.Q.; Pan, M.H.; Lu, C.; Chen, P. MicroRNA bmo-miR-31-5p inhibits apoptosis and promotes BmNPV proliferation by targeting the CYP9e2 gene of Bombyx mori. Pest. Manag. Sci. 2024, 80, 4564–4574. [Google Scholar] [CrossRef]
- Wang, H.Q.; Wang, W.H.; Chen, C.Z.; Guo, H.X.; Jiang, H.; Yuan, B.; Zhang, J.B. Regulation of FSH synthesis by differentially expressed miR-488 in anterior adenohypophyseal cells. Animals 2021, 11, 3262. [Google Scholar] [CrossRef]
- Han, D.X.; Xiao, Y.; Wang, C.J.; Jiang, H.; Gao, Y.; Yuan, B.; Zhang, J.B. Regulation of FSH expression by differentially expressed miR-186-5p in rat anterior adenohypophyseal cells. PLoS ONE 2018, 13, e0194300. [Google Scholar] [CrossRef]
- Wang, C.J.; Guo, H.X.; Han, D.X.; Yu, Z.W.; Zheng, Y.; Jiang, H.; Gao, Y.; Yuan, B.; Zhang, J.B. Pituitary tissue-specific miR-7a-5p regulates FSH expression in rat anterior adenohypophyseal cells. PeerJ 2019, 7, e6458. [Google Scholar] [CrossRef]
- Hasuwa, H.; Ueda, J.; Ikawa, M.; Okabe, M. miR-200b and miR-429 function in mouse ovulation and are essential for female fertility. Science 2013, 341, 71–73. [Google Scholar] [CrossRef]
- Chang, C.; He, X.Y.; Di, R.; Wang, X.Y.; Han, M.C.; Liang, C.; Chu, M.X. Thyroid transcriptomics revealed the reproductive regulation of miRNA in the follicular and luteal phases in Small Tail Han sheep with different FecB genotypes. Genes 2023, 14, 2024. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Hu, W.; He, X.; Pan, Z.; Guo, X.; Feng, T.; Cao, G.; Huang, D.; He, J.; Cao, X. Establishment of high-throughput molecular detection methods for ovine high fecundity major gene FecB and their application. Acta Vet. Zootech. Sin. 2017, 48, 39–51. [Google Scholar] [CrossRef]
- Ciornei, Ş.G.; Drugociu, D.; Ciornei, L.; Roşca, P. Ovarian response to P4-PGF-FSH treatment in suffolk sheep and P4-PGF-PMSG synchronization in cross-bred ewes, for IVD and ET protocol. Vet. Med. Sci. 2022, 8, 726–734. [Google Scholar] [CrossRef] [PubMed]
- Xia, Q.; Chu, M.X.; He, X.Y.; Liu, Q.Y.; Zhang, X.S.; Zhang, J.L.; Guo, X.F.; Di, R. Identification of photoperiod-induced lncRNAs and mRNAs in pituitary pars tuberalis of sheep. Front. Vet. Sci. 2021, 8, 644474. [Google Scholar] [CrossRef]
- Culwick, M.D.; Endlich, Y.; Prineas, S.N. The Bowtie diagram: A simple tool for analysis and planning in anesthesia. Curr. Opin. Anaesthesiol. 2020, 33, 808–814. [Google Scholar] [CrossRef]
- Friedländer, M.R.; Chen, W.; Adamidi, C.; Maaskola, J.; Einspanier, R.; Knespel, S.; Rajewsky, N. Discovering microRNAs from Deep Sequencing Data Using miRDeep. Nat. Biotechnol. 2008, 26, 407–415. [Google Scholar] [CrossRef]
- Mu, H.; Chen, J.; Huang, W.; Huang, G.; Deng, M.; Hong, S.; Ai, P.; Gao, C.; Zhou, H. Om-icShare tools: A zero-code interactive online platform for biological data analysis and visualization. iMeta 2024, 3, e228. [Google Scholar] [CrossRef]
- Betel, D.; Koppal, A.; Agius, P.; Sander, C.; Leslie, C. Comprehensive modeling of microRNA targets predicts functional non-conserved and non-canonical sites. Genome Biol. 2010, 11, R90. [Google Scholar] [CrossRef]
- Lv, W.; An, R.; Li, X.; Zhang, Z.; Geri, W.; Xiong, X.; Yin, S.; Fu, W.; Liu, W.; Lin, Y.; et al. Multi-Omics approaches uncovered critical mRNA–miRNA–lncRNA networks regulating multiple birth traits in Goat Ovaries. Int. J. Mol. Sci. 2024, 25, 12466. [Google Scholar] [CrossRef]
- The Gene Ontology Consortium. The gene ontology resource: 20 years and still going strong. Nucleic Acids Res. 2019, 47, D330–D338. [Google Scholar] [CrossRef]
- Ristl, R.; Hothorn, L.; Ritz, C.; Posch, M. Simultaneous inference for multiple marginal generalized estimating equation models. Stat. Methods Med. Res. 2020, 29, 1746–1762. [Google Scholar] [CrossRef] [PubMed]
- Arocho, A.; Chen, B.; Ladanyi, M.; Pan, Q. Validation of the 2-DeltaDeltaCt calculation as an alternate method of data analysis for quantitative PCR of BCR-ABL P210 transcripts. Diagn. Mol. Pathol. 2006, 15, 56–61. [Google Scholar] [CrossRef] [PubMed]
- Fabre, S.; Pierre, A.; Mulsant, P.; Bodin, L.; Di Pasquale, E.; Persani, L.; Monget, P.; Monniaux, D. Regulation of ovulation rate in mammals: Contribution of sheep genetic models. Reprod. Biol. Endocrinol. 2006, 4, 20. [Google Scholar] [CrossRef] [PubMed]
- Hertel, J.; Bartschat, S.; Wintsche, A.; Otto, C.; Centre of Learning Transformation (COLT); Stadler, P.F. Evolution of the let-7 microRNA family. RNA Biol. 2012, 9, 231–241. [Google Scholar] [CrossRef] [PubMed]
- Pasquinelli, A.E.; Reinhart, B.J.; Slack, F.; Martindale, M.Q.; Kuroda, M.I.; Maller, B.; Hayward, D.C.; Ball, E.E.; Degnan, B.; Müller, P.; et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature 2000, 408, 86–89. [Google Scholar] [CrossRef]
- Zhang, H.J.; Qi, Q.; Chen, T.; Luo, J.Y.; Xi, Q.Y.; Jiang, Q.Y.; Sun, J.J.; Zhang, Y.L. Age-related changes in microRNA in the rat pituitary and potential role in GH regulation. Int. J. Mol. Sci. 2018, 19, 2058. [Google Scholar] [CrossRef]
- Jiao, Y.Y.; Hao, L.L.; Xia, P.J.; Cheng, Y.Y.; Song, J.; Chen, X.; Wang, Z.G.; Ma, Z.; Zheng, S.; Chen, T.; et al. Identification of potential miRNA-mRNA regulatory network associated with pig growth performance in the pituitaries of BAMA minipigs and Landrace Pigs. Animals 2022, 12, 3058. [Google Scholar] [CrossRef]
- Liu, Y.F.; Zhou, Z.Y.; He, X.Y.; Tao, L.; Jiang, Y.T.; Lan, R.; Hong, Q.H.; Chu, M.X. Integrated analyses of miRNA-mRNA expression profiles of ovaries reveal the crucial interaction networks that regulate the prolificacy of goats in the follicular phase. BMC Genom. 2021, 22, 812. [Google Scholar] [CrossRef]
- Sirotkin, A.V.; Ovcharenko, D.; Grossmann, R.; Lauková, M.; Mlyncek, M. Identification of microRNAs controlling human ovarian cell steroidogenesis via a genome-scale screen. J. Cell. Physiol. 2009, 219, 415–420. [Google Scholar] [CrossRef]
- Zhang, Y.Q.; Liu, C.G.; Wang, J.L.; Li, Q.L.; Ping, H.; Gao, S.C.; Wang, P.C. MiR-299-5p regulates apoptosis through autophagy in neurons and ameliorates cognitive capacity in APPswe/PS1dE9 mice. Sci. Rep. 2016, 6, 24566. [Google Scholar] [CrossRef]
- Qiao, L.Y.; Shen, S.; Liu, M.; Xia, C.; Kay, J.C.; Zhang, Q.L. Inflammation and activity augment brain-derived neurotrophic factor peripheral release. Neuroscience 2016, 318, 114–121. [Google Scholar] [CrossRef] [PubMed]
- Fiocco, A.J.; D’Amico, D.; de Beaumont, L.; Poirier, J.; Lupien, S. Association between BDNF polymorphism and hypothalamic-pituitary-adrenal activity in later adulthood. Gerontology 2020, 66, 131–137. [Google Scholar] [CrossRef] [PubMed]
- Zheng, X.; Chen, L.; Chen, T.; Cao, M.; Zhang, B.; Yuan, C.; Zhao, Z.; Li, C.; Zhou, X. The mechanisms of BDNF promoting the proliferation of porcine follicular granulosa cells: Role of miR-127 and involvement of the MAPK-ERK1/2 pathway. Animals 2023, 13, 1115. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Liu, Y.; Jiang, W.; Song, Y.; Zou, Y.; Wang, M.; Liu, Q.; Sun, G.; Gong, Y.; Jiang, B. Heterozygous deletion of CUL4B in female mice leads to ovulatory dysfunction and female infertility. Genes Dis. 2025, 12, 101381. [Google Scholar] [CrossRef]
- Ma, Y.Y.; Liu, X.L.; Zhou, M.; Sun, W.J.; Jiang, B.C.; Liu, Q.; Wang, M.L.; Zou, Y.X.; Liu, Q.J.; Gong, Y.Q.; et al. CUL4B mutations impair human cortical neurogenesis through PP2A-dependent inhibition of AKT and ERK. Cell Death Dis. 2024, 15, 121. [Google Scholar] [CrossRef]
- Chen, S.; Guo, X.F.; He, X.Y.; Di, R.; Zhang, X.S.; Zhang, J.L.; Wang, X.Y.; Chu, M.X. Insight into pituitary lncRNA and mRNA at two estrous stages in Small Tail Han sheep with different FecB genotypes. Front. Endocrinol. 2022, 12, 789564. [Google Scholar] [CrossRef]
- Okano, M.; Bell, D.W.; Haber, D.A.; Li, E. DNA methyltransferases DNMT3A and DNMT3B are essential for de novo methylation and mammalian development. Cell 1999, 99, 247–257. [Google Scholar] [CrossRef]
- Veland, N.; Lu, Y.; Hardikar, S.; Gaddis, S.; Zeng, Y.; Liu, B.; Estecio, M.R.; Takata, Y.; Lin, K.; Tomida, M.W.; et al. DNMT3L facilitates DNA methylation partly by maintaining DNMT3A stability in mouse embryonic stem cells. Nucleic Acids Res. 2019, 47, 152–167. [Google Scholar] [CrossRef]
- Lalonde-Larue, A.; Boyer, A.; Santos, E.C.D.; Boerboom, D.; Bernard, D.J.; Zamberlam, G. The hippo pathway effectors YAP and TAZ regulate LH release by pituitary gonadotrope cells in mice. Endocrinology 2022, 163, bqab238. [Google Scholar] [CrossRef]
- Yang, N.J.; Liu, Y.R.; Tang, Z.S.; Duan, J.A.; Yan, Y.F.; Song, Z.X.; Wang, M.G.; Zhang, Y.R.; Chang, B.-J.; Zhao, M.L.; et al. Poria cum radix pini rescues barium chloride-induced arrhythmia by regulating the cGMP-PKG signalling pathway involving ADORA1 in zebrafish. Front. Pharmacol. 2021, 12, 688746. [Google Scholar] [CrossRef]
- He, G.T.; Wu, J.; Kong, H.L.; Zhang, Y.; Li, Y.T.; Cai, M.T.; Shaduhan, G.; Yan, Y.T.; Zheng, Y.D.; Ding, J.T. Comparative analysis of miRNAs in exosomes released by sheeppox virus-infected ovine testicular cells. Comp. Immunol. Microbiol. Infect. Dis. 2019, 67, 101363. [Google Scholar] [CrossRef] [PubMed]
- Ji, J.X.; Jin, T.H.; Lou, A.G.; Zhang, R.; Chen, Y.Y.; Xiang, S.Y.; Cui, C.Y.; Yu, L.Z.; Guan, L.Z. The effect of miR-10b on growth hormone in pituitary cells of Yanbian yellow cattle by somatostatin receptor 2. Anim. Sci. J. 2020, 91, e13420. [Google Scholar] [CrossRef] [PubMed]
- Renthal, N.E.; Chen, C.C.; Williams, K.C.; Gerard, R.D.; Prange-Kiel, J.; Mendelson, C.R. miR-200 family and targets, ZEB1 and ZEB2, modulate uterine quiescence and contractility during pregnancy and labor. Proc. Natl. Acad. Sci. USA 2010, 107, 20828–20833. [Google Scholar] [CrossRef] [PubMed]
- Karin, M.; Lin, A. NF-kappaB at the crossroads of life and death. Nat. Immunol. 2002, 3, 221–227. [Google Scholar] [CrossRef]
- Lee, D.H.; Zhu, Y.N.; Colson, L.; Wang, X.R.; Chen, S.Y.; Tkacik, E.; Huang, L.; Qi, O.Y.; Goldberg, A.L.; Lu, Y. Molecular mechanism for activation of the 26S proteasome by ZFAND5. Mol. Cell 2023, 83, 2959–2975.e7. [Google Scholar] [CrossRef]
- Huang, J.; Teng, L.; Li, L.; Liu, T.; Li, L.; Chen, D.; Xu, L.G.; Zhai, Z.; Shu, H.B. ZNF216 Is an A20-like and IkappaB kinase gamma-interacting inhibitor of NFkappaB activation. J. Biol. Chem. 2004, 279, 16847–16853. [Google Scholar] [CrossRef]
- Alpsoy, A.; Wu, X.S.; Pal, S.; Klingbeil, O.; Kumar, P.; El Demerdash, O.; Nalbant, B.; Vakoc, C.R. IκBζ is a dual-use coactivator of NF-κB and POU transcription factors. Mol. Cell 2024, 84, 1149–1157.e7. [Google Scholar] [CrossRef]






| Gene Name | Primer Sequences (5′-3′) | Tm (°C) |
|---|---|---|
| Novel_207 | CTGACCTATGAATTGACAGCC | 53 |
| Novel_121 | CAGCAGCACACTGTGGTTTGT | 59 |
| Novel_294 | TAGCAGCACAGAAATGTTGGTA | 54 |
| oar-miR-377-3p | ATCACACAAAGGCAACTTTCGT | 55 |
| oar-miR-494-3p | TGAAACATACACGGGAAACCTCT | 56 |
| oar-miR-10b | ACCCTGTAGAACCGAATTTGTG | 55 |
| oar-miR-10a | TACCCTGTAGATCCGAATTTG | 51 |
| oar-miR-127 | ATCGGATCCGTCTGAGCTTGGCT | 63 |
| U6-F | AACGCTTCACGAATTTGCGT | 56 |
| U6-R | CTCGCTTCGGCAGCACA | 56 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; He, X.; Di, R.; Wang, X.; Chu, M. An Insight into Differentially Expressed Genes and MicroRNAs in the Pituitary Glands of the Two Estrous Phases of Sheep with Different FecB Genotypes. Animals 2025, 15, 392. https://doi.org/10.3390/ani15030392
Zhang Y, He X, Di R, Wang X, Chu M. An Insight into Differentially Expressed Genes and MicroRNAs in the Pituitary Glands of the Two Estrous Phases of Sheep with Different FecB Genotypes. Animals. 2025; 15(3):392. https://doi.org/10.3390/ani15030392
Chicago/Turabian StyleZhang, Yue, Xiaoyun He, Ran Di, Xiangyu Wang, and Mingxing Chu. 2025. "An Insight into Differentially Expressed Genes and MicroRNAs in the Pituitary Glands of the Two Estrous Phases of Sheep with Different FecB Genotypes" Animals 15, no. 3: 392. https://doi.org/10.3390/ani15030392
APA StyleZhang, Y., He, X., Di, R., Wang, X., & Chu, M. (2025). An Insight into Differentially Expressed Genes and MicroRNAs in the Pituitary Glands of the Two Estrous Phases of Sheep with Different FecB Genotypes. Animals, 15(3), 392. https://doi.org/10.3390/ani15030392

