Next Article in Journal
Genome-Wide Association Study of Abdominal and Intramuscular Fat Deposition Traits in Huainan Yellow-Feathered Chickens
Previous Article in Journal
What Makes Us React to the Abuse of Pets, Protected Animals, and Farm Animals: The Role of Attitudes, Norms, and Moral Obligation
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 15
Issue 22
10.3390/ani15223340
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of Hydatigera Species in Wildcats (Felis silvestris) from Central Spain

by
Pablo Matas-Méndez
1,*,
Lorena Esteban-Sánchez
2,
Francisco Ponce-Gordo
2,* and
Marta Mateo-Barrientos
2
1
Facultad de Veterinaria, Universidad Alfonso X El Sabio, Villanueva de la Cañada, 28691 Madrid, Spain
2
Departamento de Microbiología y Parasitología, Facultad de Farmacia, Universidad Complutense de Madrid, 28040 Madrid, Spain
*
Authors to whom correspondence should be addressed.
Animals 2025, 15(22), 3340; https://doi.org/10.3390/ani15223340
Submission received: 2 October 2025 / Revised: 8 November 2025 / Accepted: 13 November 2025 / Published: 19 November 2025
(This article belongs to the Section Veterinary Clinical Studies)
Browse Figures
Review Reports Versions Notes

Simple Summary

The European wildcat (Felis silvestris) is a wild feline found in various regions of Spain, with a diet primarily consisting of mice and rabbits. These animals can become infected with intestinal parasites, such as tapeworms of the genus Hydatigera. Some of these parasites are very difficult to distinguish under a microscope but can be identified using DNA-based methods. In this study, 26 road-killed wildcats from central Spain were examined, and 73% were found to be infected with Hydatigera tapeworms. Using molecular tools, researchers identified two different Hydatigera species never before reported in Spanish wildcats. A rapid genetic test was also developed to differentiate them. This study extends the known geographical range of the species in the H. taeniaeformis complex (Hydatigera kamiyai and an unnamed Hydatigera sp.) in Europe and provides a reliable molecular tool for identifying them, which is essential for further epidemiological studies.

Abstract

The European wildcat (Felis silvestris) is a mesocarnivore widely distributed across Europe, with populations in the Iberian Peninsula experiencing decline due to habitat fragmentation, hybridization with domestic cats, and anthropogenic factors. Among the parasites commonly found in wildcats are cestodes of the genus Hydatigera, which includes cryptic species within the Hydatigera taeniaeformis complex. This study aimed to identify Hydatigera species within this complex infecting wildcats in central Spain using both morphological and molecular methods. A total of 26 road-killed wildcats were collected between 2021 and 2023 from Castilla and León and Castilla-La Mancha. Cestodes were recovered from 73% of individuals, yielding a total of 240 Hydatigera specimens. Molecular analysis of the mitochondrial cox1 gene and a newly developed multiplex PCR targeting cox1, cytb and nad4 genes enabled differentiation between Hydatigera kamiyai and European Hydatigera sp., confirming their presence in definitive hosts in Spain for the first time. Mixed infections were detected in 60% of infected wildcats. The high prevalence and parasite load observed highlight the role of rodents in the transmission cycle. This study expands the known distribution of the H. taeniaeformis complex species in Europe and provides a reliable molecular tool for their identification, essential for further epidemiological investigations.

1. Introduction

The European wildcat (Felis silvestris Schreber, 1777) is a mesocarnivore with a broad distribution across Europe, whose populations have been increasing in specific regions of Central Europe [1]. In Spain, two subspecies are recognized: the European subspecies (F. silvestris silvestris Miller, 1912), found in the northern part of the country, north of the Duero and Ebro rivers, and the Iberian subspecies (F. silvestris tartessia Miller, 1912), located in the southern part of the peninsula, specifically in Doñana National Park [2,3,4]. Populations on the Iberian Peninsula are in decline [5], due to multiple factors including habitat fragmentation, competition and hybridization with domestic cats (Felis catus Linnaeus, 1758), and anthropogenic pressures such as poisoning and roadkills [6]. The wildcat’s diet primarily consists of rodents (mice and voles) and lagomorphs (rabbits and hares) [7].
Among the most common parasites infecting these animals are nematodes and cestodes. Within the cestodes, the most frequently reported belong to the genus Hydatigera Lamarck, 1816 [8,9]. This genus was previously considered a synonym of Taenia by Verster in 1969 [10], but was reinstated by Nakao and coworkers in 2013 [11] to include the species Hydatigera krepkogorski (Schulz and Landa, 1934), Hydatigera parva (Baer, 1924), and Hydatigera taeniaeformis (Batsch, 1786). All of these species are found in felids; H. krepkogorski also occurs in canids, H. parva in herpestids, mustelids, and viverrids; and H. taeniaeformis also in viverrids and canids [10,12,13,14,15]. The latter species has long been regarded as a species complex based on the analysis of mitochondrial sequences, with isolates collected in Turkey, Finland and Japan showing genetic differences from others collected in Belgium, Australia, Kazahkstan, Malaysia, China, and also Japan [11,16,17]. The complete mitochondrial genome of T. taeniaeformis of Chinese origin [18] and of German origin [19] showed significant differences, and Galimberti et al. [20] identified three different putative species within H. taeniaeformis, which were ultimately named by Lavikainen et al. [21] as H. taeniaeformis sensu stricto (s.s.), Hydatigera kamiyai Lavikainen et al., 2016, and an undescribed species from European felids currently referred to as Hydatigera sp. Recently, two new putative species have been identified in China from rodent hosts [22,23]. However, these have only been described from larval stages, and the adult cestodes of the Asian Hydatigera spp. have not yet been described; therefore, their inclusion within the Hydatigera taeniaeformis complex remains uncertain.
The host range of H. taeniaeformis s.s., H. kamiyai and the European Hydatigera sp. based on genetic data include felids as hosts for all of them, while rodents (murids) are intermediate hosts of H. taeniaeformis, rodents (murids and other rodent groups) are intermediate hosts of H. kamiyai, and the intermediate host(s) are yet not determined for the European Hydatigera sp. (Table 1). Morphological differentiation of the adult cestodes among the three species described by Lavikainen et al. within the H. taeniaeformis sensu lato (s.l.) complex is extremely difficult [21], but molecular analyses enable their discrimination [16,20,21,24,25].
There are almost no previous data on cestode infections in wildcats in Spain; the only data available (referred to H. taeniaeformis s.l.) are those obtained more than 30 years ago by Torres et al. [26] in samples from all over Spain, who found a overall 60.3% prevalence; and those obtained between 2008–2015 by Gómez-Galindo et al. [27] in samples collected in the south-east of Spain, who found a 36.8% prevalence. Other cestodes found in these studies included Taenia pisiformis, Joyeuxiella pasqualei, Diplopylidium nolleri and Mesocestoides spp. In both studies, identifications were based on morphological characters. To date, no studies have described the clinical manifestations of Hydatigera infection in European wildcats, and data in domestic cats are also scarce; in general, as with most intestinal cestodes in felids, infections by adult Hydatigera tapeworms are considered largely subclinical [8,9]. However, a few isolated clinical cases have been reported in domestic cats, including an acute intestinal obstruction caused by (Taenia) Hydatigera taeniaeformis s.l., which required surgical removal of the tapeworms [28]. This highlights that, although rare, heavy infections may lead to clinical disease. From an epidemiological perspective, identifying Hydatigera species is important because they differ in their life cycles, intermediate hosts, and geographic distributions, thus providing insights into trophic relationships and potential transmission pathways between wild and domestic carnivores. There is an important gap in the literature on Hydatigera infections in Spanish wildcats, and the objective of this study is provide new, recent data on the presence and distribution of this cestode genus in the Spanish European wildcats.
Table 1. Available data on hosts and geographic distribution of Hydatigera taeniaeformis sensu stricto, Hydatigera kamiyai, and European Hydatigera sp.
Table 1. Available data on hosts and geographic distribution of Hydatigera taeniaeformis sensu stricto, Hydatigera kamiyai, and European Hydatigera sp.
Parasite SpeciesDefinitive HostIntermediate HostCountryReferences
H. taeniaeformis s.s. MuridaeJapan[16]
Felidae (Felis silvestris catus)Not indicatedAustralia[29]
MuridaeIndia[30,31]
Felidae (Felis silvestris catus) Korea[32]
Felidae (Prionailurus bengalensis)Not indicatedChina[24]
Canidae Switzerland[14]
Felidae Australia[33]
MuridaeIndia
Canidae (Canis lupus familiaris) Germany[34]
Felidae (Felis silvestris catus)
MuridaeKazakhstan, Turkey[17]
Canidae (Canis lupus familiaris) Japan[15]
Not indicatedBelgium[11]
Felidae (Felis silvestris catus)
Stool		 USA[35]
MuridaeSerbia[36]
Felidae (Felis silvestris catus) Mexico[37]
Felidae (Leopardus geoffroyi) Brazil[38]
Not indicated Finland[11]
Japan
MuridaeSenegal[39]
MuridaeSpain[21]
H. kamiyaiFelidae (Felis silvestris catus) Finland, France, Australia[21]
Felidae (Felis silvestris silvestris) Italy
Felidae (Prionailurus bengalensis) Russia
Muridae


Bosnia, Latvia, Russia, Cambodia, Laos, Thailand, Vietnam, Ethiopia, South Africa
Cricetidae
Finland, Norway,
Russian, Sweden
CricetidaePoland[40]
Cricetidae, Muridae,
Soricidae		Luxembourg[41]
Felidae (Felis silvestris silvestris) [42]
Cricetidae, MuridaeSerbia[36]
Felidae (Felis silvestris silvestris) Germany[43]
Felidae (Panthera leo) Namibia[44]
CricetidaeChina[45]
Cricetidae, MuridaeCzech Republic[46]
Not indicated France[47]
NesomyidaeUnited Kingdom[48]
Hydatigera sp.Felidae (Felis silvestris catus) France[21]
Felidae (Felis silvestris silvestris) Italy[20]

2. Materials and Methods

2.1. Sample Origin

Over a period of 36 months (January 2021–December 2023), a total of 26 road-killed European wildcats (F. silvestris) were collected from seven provinces across two autonomous communities (Castilla-La Mancha and Castilla y León) in central Spain. The carcasses were transported by environmental officers to regional wildlife recovery centers, where they were stored frozen at −20 °C to ensure proper preservation. The collection of these and other road-killed carnivores was conducted under authorization from the regional environmental departments (permits: DGPFEN/SEN/avp_21_103_bis for Castilla-La Mancha and AB/is. Exp.AUES/CYL/001/2021 for Castilla y León). Age estimation of the individuals was based on body size, weight, and dentition, and all specimens were classified as adults (>1 year). The classification of specimens as adults (over one year old) was based primarily on dental analysis, supplemented by body size and weight. Dental examination confirmed complete eruption of the permanent dentition. It is essential to note that the apical foramen of the canine root was closed and that the teeth showed incipient wear on the cusps of the canines and incisors. This level of dental wear, combined with evidence of a fully mature and closed tooth root, constitutes a non-invasive criterion established in the literature on wildcats for reliably classifying an individual in the >1 year age class [49,50].

2.2. Initial Processing and Cestode Recovery

Necropsies were performed on the 26 individuals. The intestinal package was extracted, and its contents were washed several times with distilled water using sieves. Cestodes retrieved from the small intestine were washed and preserved in 70% ethanol at 4 °C until morphological identification and DNA extraction.
As many strobilae were fragmented, the number of cestodes per individual was estimated by counting scoleces. All cestodes with identifiable scolex and strobila belonging to the family Taeniidae were selected using a Nikon SMZ-10 stereomicroscope (Nikon Co., Tokyo, Japan) at 6.6–40× magnification.

2.3. Staining and Morphological Identification

Morphological analyses were conducted only on cestodes with a scolex and a complete strobila, including gravid proglottids. The scolex (with adjacent immature segments), as well as several mature and gravid proglottids, were tried to stain using acetic carmine [51], with slight modifications. Briefly, specimens were rinsed with phosphate-buffered saline (PBS) and flattened between two glass slides for at least 24 h. They were then stained in carmine for 24 h, destained in 2% hydrochloric alcohol, dehydrated through an ethanol series (70%, 80%, 90%, 96%, 100%), cleared in xylene, and mounted on slides using Canada balsam. Once the mounting was set, morphological characteristics (number, size, and arrangement of rostellar hooks; morphology of mature and gravid segments) were examined in 20 individuals of each species (confirmed after genetic analysis) using identification keys [10,13,21,52] under a MOTIC BA210 microscope (Xiamen, China) with 4×–40× objectives.

2.4. DNA Extraction

For genetic analysis, proglottids were taken from all collected specimens, whether the strobila was complete or not. Proglottids were digested in 200 µL of TE buffer (100 µM Tris, 1 mM EDTA, pH 8.0), 200 µL of 10% SDS, and 15 µL of Proteinase K (1 µg/µL), incubated overnight at 70 °C in a Thermomixer Compact (Eppendorf, AG, Hamburg, Germany) with shaking. DNA was extracted using the phenol–chloroform method described 150 by Sambrook and Russell [53]. Total DNA was recovered in 100 µL of Milli-Q water 151 and stored frozen at −20 °C until use.

2.5. Molecular Identification of Hydatigera Species

A multiplex PCR assay was developed to identify H. kamiyai and Hydatigera sp. Based on distinct banding patterns. For optimization, 15 individuals were randomly selected and their species identified by PCR amplification and sequencing of a mitochondrial cytochrome c oxidase subunit 1 (cox1) fragment, using primers JB3 (5′-TTTTTTGGGCATCCTGAGGTTTAT) and JB4.5 (5′-TAAAGAAAGAACATAATGAAAATG) [54]. Reactions were made in 25 µL containing 5 µL of template DNA and 2 µL of 5 pmol/µL solution of each primer, using the PuReTaq Ready-To-Go PCR Beads kit (Merck KGaA, Darmstadt, Germany). Amplifications were conducted in a Mastercycler Gradient thermal cycler (Eppendorf AG, Hamburg, Germany) under the following conditions: initial denaturation at 94 °C for 10 min; 30 cycles of 94 °C for 1 min, 52 °C for 1 min, 72 °C for 1 min; and a final extension at 72 °C for 5 min. Amplified products were resolved on 1% agarose gels stained with Pronasafe (Condalab, Torrejón de Ardoz, Spain) and visualized under UV light using a Syngene transilluminator (NuGenius; Syngene, Cambridge, UK). PCR products were purified with the QIAquick PCR Purification Kit (QIAGEN, Hilden, Germany), and sequenced at the Genomics Unit of the Complutense University of Madrid using the JB3 primer on an AbiPrism 3730XL sequencer (Applied Biosystems, now Thermo Fisher Scientific, Waltham, MA, USA). Sequences were analyzed with ChromasPro v2.1.10.1 (Technelysium Pty Ltd., South Brisbane, Australia) and compared against sequences in GenBank/EMBL/DDBJ using the blastn algorithm on the NCBI website (https://blast.ncbi.nlm.nih.gov/Blast.cgi) (last accessed: 12 March 2025).
Once the species identity of each of the 15 selected samples was confirmed through molecular analysis, a multiplex PCR was optimized using these reference samples. Each reaction simultaneously amplified two distant regions of mitochondrial DNA: the cox1 gene, used as an internal control, and a diagnostic fragment including part of the cytochrome b gene (cytb, ~618 bp, for Hydatigera sp.), or encompassing the consecutive cytb-NADH dehydrogenase subunit 4 (nad4) genes (~1063 bp, for H. kamiyai). Based on complete mitochondrial DNA sequences of Hydatigera spp. available in GenBank (Table 2), a common forward primer for both species (HD; 5′-TATTACTGGTGATACATTAATGCGTG) and two species-specific reverse primers were designed: one for H. kamiyai (HKAR; 5′-AARTAAAAACGTACCCAACTAGACAG) and one for Hydatigera sp. (HSR; 5′-ATTAATCTTATCATAACGACAACTAATAATCC) (all primers’ solutions at 5 pmol/µL) (Table 3). The previously mentioned primers JB3 and JB4.5 were included in the reaction mix and used to amplify the cox1 fragment, serving as control of the reaction. Primer specificity was validated in silico using the NCBI Primer-BLAST tool on the NCBI website (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi) (last accessed: 12 March 2025).
As a negative control (to ensure absence of nonspecific amplification of diagnostic fragments), DNA from Hydatigera parva, obtained from adult cestodes recovered during necropsy of a genet (Genetta genetta), was included in the assay.
Following optimization, all collected cestode individuals were analyzed using the multiplex PCR. Reactions were performed in a final volume of 25 µL, containing 3 µL of template DNA, 2 µL each of the common primers JB3, JB4.5, and HD, and 1.5 µL of each species-specific primer (HKAR and HSR), all at a final concentration of 5 µM. Thermal cycling conditions were: initial denaturation at 94 °C for 10 min; 30 cycles of 94 °C for 1 min, 52 °C for 1 min, and 72 °C for 2 min; followed by a final extension at 72 °C for 10 min.
Under these conditions, HD-JB4.5 amplification (~6660 positions) is not feasible because of insufficient time to complete the amplification. Therefore, each positive sample should display a control band of 450 bp (cox1), along with a species-specific band of either 620 bp cytb (Hydatigera sp.) or 1060 bp nad4 (H. kamiyai). In the negative control, only the 450 bp control band should be present. If no species-specific band is observed, the PCR product (then containing only the cox1 band) were purified and sequenced as previously described to confirm species identity.

3. Results

The wildcats analyzed were primarily collected in Castilla y León (16 from Burgos, 1 from Salamanca, 4 from Soria and 1 from Valladolid), while 4 individuals originated from Castilla-La Mancha (2 from Toledo, 1 from Guadalajara, and 1 from Ciudad Real) (Figure 1). A total of 73.1% (19/26) of the animals were infected with Hydatigera spp., including two individuals that showed coinfections with Hydatigera and Joyeuxiella (family Dilepididae). One animal (3.8%) was infected exclusively with Joyeuxiella sp.
A total of 240 Hydatigera spp. specimens were recovered, with parasite burden ranging from 4 to 36 cestodes per individual (Table 4 and Figure 1). The infected wildcats included 14 males and 5 females, and Hydatigera infection was detected in animals from all provinces except Ciudad Real, where the only sampled individual was infected solely with Joyeuxiella.
Morphometric data were obtained from specimens of H. kamiyai and Hydatigera sp. that preserved the scolex and a complete strobila. Species identification was confirmed by molecular analysis of immature proglottids prior to morphological comparison. Morphological data on the mature proglottids were not obtained because almost all of them were partially degenerated and internal reproductive structures such as testes, cirrus sac, and ovary were not clearly defined. The measurements of the main morphological structures, including scolex width, sucker dimensions, rostellar diameter, and hook morphology (large and small hooks), as well as the number of uterine branches (Figure 2), are summarized in Table 5. The size range of the different parameters overlapped for both species.
Sequences of the mitochondrial cox1 marker from the initial 15 cestodes analyzed corresponded to H. kamiyai in 9 individuals and to Hydatigera sp. in 6, with sequence similarities of 99–100% compared to available GenBank records. The H. kamiyai sequences displayed minor variability, with three haplotypes identified, whereas all Hydatigera sp. sequences were identical. The H. parva sequence showed 100% similarity with GenBank sequence NC021141, obtained from a cysticercus in a wood mouse (Apodemus sylvaticus) from northwestern Spain [11]. The sequences of H. parva, and the haplotypes of H. kamiyai and Hydatigera sp. were submitted to the GenBank/EMBL/DDBJ databases under accession numbers PV973980–PV973984.
The multiplex PCR successfully confirmed the identification of all 15 sequenced samples (Figure 3). When applied to the remaining cestodes, the multiplex PCR identified 128 out of 240 specimens (53.3%) as H. kamiyai and 112 (46.7%) as Hydatigera sp. Mixed infections were observed in 12 animals (60%), while single infections by H. kamiyai were found in 3 individuals (20.0%), and by Hydatigera sp. in 4 individuals (20.0%) (Table 4).

4. Discussion

This study presents, for the first time, data on the species-level identification of cryptic species within the Hydatigera taeniaeformis complex in wildcats in Spain. In this country, H. taeniaeformis s.s has previously been reported in intermediate hosts [21], and adult H. taeniaeformis s.l. has been recorded (Table 1), but this is the first study to identify both H. kamiyai and the unnamed European Hydatigera sp. in definitive hosts in Spain. Hydatigera kamiyai is mainly distributed across Europe and parts of Asia, whereas H. taeniaeformis s.s. shows a much broader, nearly cosmopolitan distribution, occurring also in Asia, Africa, Oceania, and the Americas (Table 1). However, European Hydatigera sp. has so far been reported only in Italy and France (and now in Spain).
Some internal structures (e.g., testes, ovaries, cirrus sac) appeared partially degenerated, likely due to the hosts’ post-mortem condition and freezing prior to necropsy, although more robust features such as the scolex and uterine branches were well preserved and could be measured accurately. The morphological characteristics of these structures did not allow differencing the adult stages of H. kamiyai and the European Hydatigera sp., a result which is in accordance with previous studies that stated the three species comprising the H. taeniaeformis complex exhibit very similar morphology [21]. Our data with Hydatigera sp. and H. kamiyai overlapped in all cases between them and with data published for H. kamiyai and H. taeniaeformis (Table 5). Although variations have been described in the number of proglottids, average number of rostellar hooks, orientation of small hooks, length of the cirrus sac, and number and position of testes [25,55], their morphological differentiation remains extremely difficult. Some authors argue that reliable distinction is only possible based on the measurements of rostellar hooks [21]. However, identification of the three species is achievable using molecular analyses, primarily based on the cox1 gene and, to a lesser extent, other molecular markers (mitochondrial 12S rRNA, NADH, nuclear 28S rRNA) [16,21,24,25,36,37]. According to the results of the present study, additional mitochondrial genes such as cytb and nad4 can also be used for the rapid identification of H. kamiyai and Hydatigera sp. The multiplex PCR developed in this research allows for the rapid and reliable processing of large sample sets and enables clear discrimination between the two species. Al-Sabi and coworkers [56] developed a multiplex PCR for cestode larval identification, although their method only distinguished H. taeniaeformis s.l. from other Taenia and Versteria species. A limitation of the current study is the lack of H. taeniaeformis s.s. samples, which prevented optimization of the multiplex PCR for differentiation among all three species within the H. taeniaeformis complex. To overcome this problem, a control band (corresponding to the partial amplification of the cox1 gene) was included to detect when the organism did not correspond to neither of the two species for which specific primers were used. In our opinion, it is necessary to include such controls in analysis based on presence/absence of bands after DNA PCR amplification using species-specific primers, both to detect potential new species or variations of previously described ones that would affect primers’ binding. This design allowed identification of the individual cestodes without needing sequencing, this speeding the identification and lowering analytical costs (amplicon purification and sequencing); sequencing would be limited to the cases where no specific bands were observed. This system is only fully valid to the analysis of separate, individual organisms; if a mix of individuals is analysed (for example, eggs or detached proglottids from a faecal sample), the presence of the species-specific bands does not exclude the existence of cestodes for which no specific primers were included in the analysis. Having this limitation in mind (detection will be limited to the species for which specific primers are used), our multiplex PCR system, as well as future developments including specific bands for other species, can be applied to faecal samples for epidemiological studies and to detect mixed infections.
In other studies involving molecular analyses of Hydatigera spp., species-level identification has typically been performed on only a small number of specimens (Table 1) leaving the actual distribution, prevalence, and frequency of co-infections largely un known.
Hydatigera taeniaeformis s.l. is the most frequently detected cestode in both domestic and wild felids, including wildcats [8,9], with prevalence values that in some cases exceed 50% [57,58,59,60] (Table 6). The high prevalence in wildcats may be associated with the importance of rodents in their diet [7], which serve as intermediate hosts [9]; to the best of our knowledge, there are no records of Hydatigera metacestodes in lagomorphs. The prevalence of taeniid cysticerci (including H. taeniaeformis s.l. and H. parva) in rodents in Spain ranges between 0.39–32.14% [61,62,63]. In the necropsies conducted in this study, all wildcats had mice in their stomachs, with 2 to 7 individuals per cat. This high predation rate increases the likelihood of infection. It remains to be determined whether the same rodent species can be hosts to both H. kamiyai and Hydatigera sp., which would require targeted investigation. According to available data, H. taeniaeformis s.s. has only been found in murid rodents, while H. kamiyai has been identified in murids, cricetids, soricids, and nesomyids (Table 1).
The prevalence of the species of the H. taeniaeformis complex detected in wildcats in this study (78%) is higher than that reported in other felid studies (Table 6). Since those previous studies were based solely on morphological identification, which prevents species-level assignment, it is not possible to establish the correct species identified in them. Molecular analyses have confirmed the presence of all three species of the H. taeniaeformis complex in Europe (Table 1), but these studies have been focused on species identification rather than epidemiology, and thus lack data on species-specific prevalence.
The parasite burden observed in wildcats ranged from 4 to 36 Hydatigera spp. cestodes per individual, with H. kamiyai showing the widest range (1 to 16 cestodes per host). This finding is consistent with previous reports, in which infection intensities ranged from 1 to 79 adult cestodes in felids (Table 4). However, inter-study comparisons at the species level are not reliable, as previous identifications have relied exclusively on morphological criteria.

5. Conclusions

This study reports for the first time the presence of H. kamiyai and European Hydatigera sp. in wildcats from Spain, expanding current knowledge of the distribution of cryptic species within the H. taeniaeformis complex. Considering the results of Lavikainen et al. [21] and the present results, the three species in the H. taeniaeformis complex are present in Spain. The multiplex PCR developed herein proved to be a rapid and reliable tool for species identification, overcoming the limitations of morphological analysis. Nonetheless, further studies including H. taeniaeformis s.s. samples are required to enable comprehensive molecular identification of all species within the H. taeniaeformis s.l. complex. The high prevalence and infection intensity observed highlight the epidemiological significance of these cestodes and the potential role of rodents as key intermediate hosts in their transmission cycle. These findings underscore the importance of implementing large-scale molecular approaches to clarify the true distribution and frequency of these species across Europe.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani15223340/s1.

Author Contributions

Conceptualization, P.M.-M. and M.M.-B.; methodology, F.P.-G. and M.M.-B.; investigation, P.M.-M., L.E.-S., F.P.-G. and M.M.-B.; resources, P.M.-M. and M.M.-B.; data curation, M.M.-B.; writing—original draft preparation, P.M.-M., L.E.-S., F.P.-G. and M.M.-B.; writing—review and editing, P.M.-M., L.E.-S., F.P.-G. and M.M.-B. All authors have read and agreed to the published version of the manuscript.

Funding

This research was partially funded by Alfonso X el Sabio Foundation, project number 1.010.119 and by the Research Group nº 911120 on Epidemiology, Diagnostic and antiparasitic Therapy of the Complutense University.

Institutional Review Board Statement

Animals killed in road accidents and collected by the Wildlife Recovery Centres of the Regional Environmental Departments of the Autonomous Communities where this study was conducted were analyzed in accordance with the corresponding authorizations (reference DGPFEN/SEN/avp_21_103_bis in Castilla-La Mancha, AB/is. Exp.AUES/CYL/001/2021 in Castilla y León).

Informed Consent Statement

Not applicable.

Data Availability Statement

All new data are presented in this study; data sharing is not aplicable to this article.

Acknowledgments

We should acknowledge the General Direction of Natural Environment and Biodiversity, Ministry of Sustainable Development, Autonomous Community of Castilla-La Mancha, the General Direction of Natural Heritage and Forest Policy, Ministry of Development and Environment, Autonomous Community of Castilla y León, and the Wildlife Recovery Centres of both regions, for their assistance and collaboration in the completion of this study.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Anile, S.; Bizzarri, L.; Lacrimini, M.; Sforzi, A.; Ragni, B.; Devillard, S. Home-range size of the European wildcat (Felis silvestris silvestris): A report from two areas in Central Italy. Mammalia 2017, 82, 1–11. [Google Scholar] [CrossRef]
  2. Cabrera, A. Fauna Ibérica: Mamíferos, 1st ed.; Museo Nacional de Ciencias Naturales: Madrid, Spain, 1914; 441p. [Google Scholar]
  3. Palomo, L.J.; Gisbert, J.; Blanco, J.C. Atlas de los Mamíferos Terrestres de España; Dirección General de Conservación de la Naturaleza-SECEM-SECEMU: Madrid, Spain, 2007; 588p. [Google Scholar]
  4. López-Martín, J.M.; García, F.J.; Such, A.; Virgós, E.; Lozano, J.; Duarte, J.; España, A.J. Felis silvestris Schreber, 1777. In Atlas y Libro Rojo de los Mamíferos de España, 1st ed.; Palomo, J., Gisbert, J., Blanco, J.C., Eds.; Dirección General de Conservación de la Naturaleza-SECEM-SECEMU: Madrid, Spain, 2007; pp. 333–338. [Google Scholar]
  5. Gil-Sánchez, J.M.; Barea-Azcón, J.M.; Jaramillo, J.; Herrera-Sánchez, F.J.; Jiménez, J.; Virgós, E. Fragmentation and low density as major conservation challenges for the southernmost populations of the European wildcat. PLoS ONE 2020, 15, e0227708. [Google Scholar] [CrossRef] [PubMed]
  6. Gerngross, P. Felis silvestris: IUCN Red List Assessment; IUCN Red List Threat Species: Cambridge, UK, 2023; p. 8235. [Google Scholar]
  7. Malo, A.F.; Lozano, J.; Huertas, D.L.; Virgós, E. A change of diet from rodents to rabbits (Oryctolagus cuniculus). Is the wildcat (Felis silvestris) a specialist predator? J. Zool. 2004, 263, 401–407. [Google Scholar] [CrossRef]
  8. Zajac, A.M.; Conboy, G.A.; Little, S.E.; Reichard, M.V. Veterinary Clinical Parasitology, 9th ed.; Wiley Blackwell: Hoboken, NJ, USA, 2021. [Google Scholar]
  9. Bowman, D.D. Georgis’ Parasitology for Veterinarians, 11th ed.; Elsevier Inc.: St. Louis, MO, USA, 2021. [Google Scholar]
  10. Verster, A. A taxonomic revision of the genus Taenia Linnaeus, 1758 s. str. Onderstepoort J. Vet. Res. 1969, 36, 3–58. [Google Scholar] [PubMed]
  11. Nakao, M.; Lavikainen, A.; Iwaki, T.; Haukisalmi, V.; Konyaev, S.; Oku, Y.; Okamoto, M.; Ito, A. Molecular phylogeny of the genus Taenia (Cestoda: Taeniidae): Proposals for the resurrection of Hydatigera Lamarck, 1816 and the creation of a new genus Versteria. Int. J. Parasitol. 2013, 43, 427–437. [Google Scholar] [CrossRef] [PubMed]
  12. Bray, R.A. The cestode Taenia Krepkogorski (Schuld & Landa, 1934) in the Arabian sand-cat (Felis margarita Loche, 1858) in Bahrain. Bull. Br. Mus. Nat. Hist. Zool. 1972, 24, 183–197. [Google Scholar]
  13. Loos-Frank, B. An up-date of Verster’s (1969) Taxonomic revision of the genus Taenia Linnaeus’ (Cestoda) in table format. Syst. Parasitol. 2000, 45, 155–184. [Google Scholar] [CrossRef]
  14. Trachsel, D.; Deplazes, P.; Mathis, A. Identification of taeniid eggs in the faeces from carnivores based on multiplex PCR using targets in mitochondrial DNA. Parasitology 2007, 134, 911–920. [Google Scholar] [CrossRef]
  15. Kimura, A.; Morishima, Y.; Nagahama, S.; Horikoshi, T.; Edagawa, A.; Kawabuchi-Kurata, T.; Sugiyama, H.; Yamasaki, H. A coprological survey of intestinal helminthes in stray dogs captured in Osaka prefecture, Japan. J. Vet. Med. Sci. 2013, 75, 1409–1411. [Google Scholar] [CrossRef]
  16. Okamoto, M.; Bessho, Y.; Kamiya, M.; Kurosawa, T.; Horii, T. Phylogenetic relationships within Taenia taeniaeformis variants and other taeniid cestodes inferred from the nucleotide sequence of the cytochrome c oxidase subunit I gene. Parasitol. Res. 1995, 81, 451–458. [Google Scholar] [CrossRef]
  17. Lavikainen, A.; Haukisalmi, V.; Lehtinen, M.J.; Henttonen, H.; Oksanen, A.; Meri, S. A phylogeny of members of the family Taeniidae based on the mitochondrial cox1 and nad1 gene data. Parasitology 2008, 135, 1457–1467. [Google Scholar] [CrossRef]
  18. Liu, G.H.; Lin, R.Q.; Li, M.W.; Liu, W.; Liu, Y.; Yuan, Z.G.; Sun, H.Q.; Zhao, G.H.; Zhang, K.X.; Zhu, X.Q. The complete mitchodrial genomes of three cestode species of Taenia infecting animals and humans. Mol. Biol. Rep. 2011, 38, 2249–2256. [Google Scholar] [CrossRef]
  19. Jia, W.; Yan, H.; Lou, Z.; Ni, X.; Dyachenko, V.; Li, H.; Littlewood, D.T. Mitochondrial genes and genomes support a cryptic species of tapeworm within Taenia taeniaeformis. Acta Trop. 2012, 123, 154–163. [Google Scholar] [CrossRef] [PubMed]
  20. Galimberti, A.; Romano, D.F.; Genchi, M.; Paoloni, D.; Vercillo, F.; Bizzarri, L.; Sassera, D.; Bandi, C.; Genchi, C.; Ragni, B.; et al. Integrative taxonomy at work: DNA barcoding of taeniids harboured by wild and domestic cats. Mol. Ecol. Resour. 2012, 12, 403–413. [Google Scholar] [CrossRef] [PubMed]
  21. Lavikainen, A.; Iwaki, T.; Haukisalmi, V.; Konyaev, S.V.; Casiraghi, M.; Dokuchaev, N.E.; Galimberti, A.; Halajian, A.; Henttonen, H.; Ichikawa-Seki, M.; et al. Reappraisal of Hydatigera taeniaeformis (Batsch, 1786) (Cestoda: Taeniidae) sensu lato with description of Hydatigera kamiyai n. sp. Int. J. Parasitol. 2016, 46, 361–374. [Google Scholar] [CrossRef]
  22. Wu, Y.D.; Dai, G.D.; Li, L.; Littlewood, D.T.J.; Ohiolei, J.A.; Zhang, L.S.; Guo, A.M.; Wu, Y.T.; Ni, X.W.; Shumuye, N.A.; et al. Expansion of Cyclophyllidea Biodiversity in Rodents of Qinghai-Tibet Plateau and the “Out of Qinghai-Tibet Plateau” Hypothesis of Cyclophyllideans. Front. Microbiol. 2022, 13, 747484. [Google Scholar] [CrossRef]
  23. Rao, J.; Cui, X.; Gao, Y.; Hu, Y.; Shen, Y. Molecular identification of the potential fifth species within genus Hydatigera (Cestoda: Taeniidae) in rodents of Guangdong province, China. Int. J. Parasitol. Parasites Wildl 2025, 28, 101126. [Google Scholar] [CrossRef]
  24. Wang, H.M.; Li, R.; Deng, Y.P.; Liu, G.H.; Fu, Y.T. Comparative Mitochondrial Genomic Analysis Robustly Supported That Cat Tapeworm Hydatigera taeniaeformis (Platyhelminthes: Cestoda) Represents a Species Complex. Front. Vet. Sci. 2022, 9, 931137. [Google Scholar] [CrossRef] [PubMed]
  25. Iwaki, T.; Nonaka, N.; Okamoto, M.; Oku, Y.; Kamiya, M. Developmental and morphological characteristics of Taenia taeniaeformis (Batsch, 1786) in Clethrionomys rufocanus bedfordiae and Rattus norvegicus from different geographical locations. J. Parasitol. 1994, 80, 461–467. [Google Scholar] [CrossRef]
  26. Torres, J.; Casanova, J.C.; Feliú, C.; Gisbert, J.; Manfredi, M.T. Contribución al conocimiento de la cestodofauna de Felis silvestris en la Península Ibérica. RevIbér Parasotol 1989, 49, 307–312. [Google Scholar]
  27. Gómez-Galindo, M.; Martínez-Carrasco Pleite, C.; Pérez-García, J.M.; Candela, M.G. Helmintofauna del gato montés (Felis silvestris silvestris) en el Sureste de la península Ibérica. In Proceedings of the Comunications Scientifiques à lal 37èmes Rencontres du Groupe d’Étude sur l’Ecophatologie de la Faune Sauvage de Montagne, Etroubles, Italy, 13–16 June 2019; p. 18. Available online: https://www.geefsm.eu/fran%C3%A7ais/rencontres-geefsm/2019-etroubles-val-d-aoest-i/ (accessed on 25 February 2025).
  28. Wilcox, R.S.; Bowman, D.D.; Barr, S.C.; Euclid, J.M. Intestinal obstruction caused by Taenia taeniaeformis infection in a cat. J. Am. Anim. Hosp. Assoc. 2009, 45, 93–96. [Google Scholar] [CrossRef] [PubMed]
  29. Gasser, R.B.; Zhu, X.; McManus, D.P. NADH dehydrogenase subunit 1 and cytochrome c oxidase subunit I sequences compared for members of the genus Taenia (Cestoda). Int. J. Parasitol. 1999, 29, 1965–1970. [Google Scholar] [CrossRef]
  30. Mahesh Kumar, J.; Reddy, P.L.; Aparna, V.; Srinivas, G.; Nagarajan, P.; Venkatesan, R.; Sreekumar, C.; Sesikarian, B. Strobilocercus fasciolaris infection with hepatic sarcoma and gastroenteropathy in a Wistar colony. Vet. Parasitol. 2006, 141, 362–367. [Google Scholar] [CrossRef]
  31. Pan, D.; (Indian Veterinary Research Institute, Kolkata, India); Bera, A.K.; (Indian Veterinary Research Institute, Kolkata, India); Konar, A.; (Indian Veterinary Research Institute, Kolkata, India); Bera, B.C.; (Indian Veterinary Research Institute, Kolkata, India); Das, S.K.; Bhattacharya, D.; (Indian Veterinary Research Institute, Kolkata, India). Report of sequence of cytochrome oxidase subunit 1 (CO1) gene of Taenia taeniaeformis isolated from Indian Black Rat (Rattus ratus). GenBank record number EF090612–EF090613. Unpublished work. 2006. [Google Scholar]
  32. Lee, S.U.; Chun, H.C.; Huh, S. Molecular phylogeny of parasitic Platyhelminthes based on sequences of partial 28S rDNA D1 and mitochondrial cytochrome c oxidase subunit I. Korean J. Parasitol. 2007, 45, 181–189. [Google Scholar] [CrossRef] [PubMed]
  33. Zhang, L.; Hu, M.; Jones, A.; Allsopp, B.A.; Beveridg, I.; Schindler, A.R.; Gasser, R.B. Characterization of Taenia madoquae and Taenia regis from carnivores in Kenya using genetic markers in nuclear and mitochondrial DNA, and their relationships with other selected taeniids. Mol. Cell. Probes. 2007, 21, 379–385. [Google Scholar] [CrossRef] [PubMed]
  34. Dyachenko, V.; Pantchev, N.; Gawlowska, S.; Vrhovec, M.G.; Bauer, C. Echinococcus multilocularis infections in domestic dogs and cats from Germany and other European countries. Vet. Parasitol. 2008, 157, 244–253. [Google Scholar] [CrossRef] [PubMed]
  35. Hoggard, K.R.; Jarriel, D.M.; Bevelock, T.J.; Verocai, G.G. Prevalence survey of gastrointestinal and respiratory parasites of shelter cats in northeastern Georgia, USA. Vet. Parasitol. Reg. Stud. Rep. 2019, 16, 100270. [Google Scholar] [CrossRef] [PubMed]
  36. Miljević, M.; Rajičić, M.; Umhang, G.; Bajić, B.; Bjelić Čabrilo, O.; Budinski, I.; Blagojević, J. Cryptic species Hydatigera kamiyai and other taeniid metacestodes in the populations of small mammals in Serbia. Parasit. Vectors 2023, 16, 250. [Google Scholar] [CrossRef]
  37. Camacho-Giles, V.; Hortelano-Moncada, Y.; Torres-Carrera, G.; Gil-Alarcón, G.; Oceguera-Figueroa, A.; García-Prieto, L.; Osorio-Sarabia, D.; Cervantes, F.A.; Arenas, P. Helminths of free-ranging dogs and cats in an urban natural reserve in Mexico City and their potential risk as zoonotic agents. PLoS ONE. 2024, 19, e0310302. [Google Scholar] [CrossRef]
  38. Lignon, J.S.; dos Santos, T.S.; Meireles, G.R.; Martins, K.R.; Zoia, W.A.; Soares, M.P.; de Holleben Camozzato Fadrique, F.; Cunha, R.C.; Monteiro, S.G.; Pappen, F.G.; et al. First record of Hydatigera taeniaeformis in Geoffroy’s cat (Leopardus geoffroyi) in Brazil. Vet. Parasitol. Reg. Stud. Rep. 2024, 54, 101100. [Google Scholar] [CrossRef]
  39. Catalano, S.; Bâ, K.; Diouf, N.D.; Léger, E.; Verocai, G.G.; Webster, J.P. Rodents of Senegal and their role as intermediate hosts of Hydatigera spp. (Cestoda: Taeniidae). Parasitology 2019, 146, 299–304. [Google Scholar] [CrossRef]
  40. Bajer, A.; Alsarraf, M.; Dwuznik, D.; Mierzejewska, E.J.; Kolodziej-Sobocinska, M.; Behnke-Borowczyk, J.; Banasiak, L.; Grzybek, M.; Tolkacz, K.; Kartawik, N.; et al. Rodents as intermediate hosts of cestode parasites of mammalian carnivores and birds of prey in Poland, with the first data on the life-cycle of Mesocestoides melesi. Parasites Vectors 2020, 13, 95. [Google Scholar] [CrossRef] [PubMed]
  41. Martini, M.; Dumendiak, S.; Gagliardo, A.; Ragazzini, F.; La Rosa, L.; Giunchi, D.; Thielen, F.; Romig, T.; Massolo, A.; Wassermann, M. Echinococcus multilocularis and Other Taeniid Metacestodes of Muskrats in Luxembourg: Prevalence, Risk Factors, Parasite Reproduction, and Genetic Diversity. Pathogens 2022, 11, 1414. [Google Scholar] [CrossRef]
  42. Mederle, N.; Darabus, G.; Stancu, A.; Pentea, M.; Imre, M.; Luca, I.; Pavlovic, I.; Zdravković, N. Intestinal endo-parasitism in wild cat (Felis silvestris) from Banat area (Romania). Helminthologia 2023, 60, 161–165. [Google Scholar] [CrossRef]
  43. Bisterfeld, K.; Raulf, M.K.; Waindok, P.; Springer, A.; Lang, J.; Lierz, M.; Siebert, U.; Strube, C. Endoparasites of peritoneal organs and skeletal muscles of the European wildcat (Felis silvestris) in Germany. Parasit. Vectors 2024, 17, 473. [Google Scholar] [CrossRef] [PubMed]
  44. Dumendiak, S.; Halajian, A.; Mekonnen, Y.T.; Aschenborn, O.; Camacho, G.J.; Schuster, R.K.; Mackenstedt, U.; Roming, T.; Wassermann, M. Hidden diversity of cestodes in wild African carnivores: I. Non-taeniid cyclophyllideans. Int. J. Parasitol. Parasites Wildl 2024, 24, 100929. [Google Scholar] [CrossRef] [PubMed]
  45. Zhou, G.; Zhang, H.; Chen, W.; Li, Z.; Zhang, X.; Fu, Y. Morphological observation, molecular identification and evolutionary analysis of Hydatigera kamiyai found in Neodon fuscus from the Qinghai-Tibetan plateau. Infect. Genet. Evol. 2024, 123, 105629. [Google Scholar] [CrossRef]
  46. Husák, T.; Čadková, Z.; Máca, O.; Kouba, M.; Klimková, Z.; Sehnal, R.; Nápravníková, J.; Hrabětová, V.; Jankovská, I.; Vadlejch, J.; et al. Molecular identification of zoonotic taeniids metacestodes in several rodent species trapped in Central Europe. Front. Vet. Sci. 2025, 12, 1571082. [Google Scholar] [CrossRef]
  47. Ferte, H.; (Institut de Parasitologie et Pathologie tropicale, Strasbourg, France); Brunet, J.; (Institut de Parasitologie et Pathologie tropicale, Strasbourg, France). Hydatigera kamiyai isolate POC1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mi-tochondrial. GenBank record number PV414379. Unpublished work. 2025. [Google Scholar]
  48. Waeschenbach, A.; (Natural History Museum, London, UK); Griffin, C.; (Natural History Museum, London, UK); Littlewood, D.T.J.; (Natural History Museum, London, UK). Hydatigera kamiyai isolate Worm1_cox1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial. GenBank record number PQ463655–PQ463656, PA463695–PQ463696, PQ479104–PQ479105. Unpublished work. 2024. [Google Scholar]
  49. Oleinik, Y. Age determination of the wildcat (Felis silvestris): A case study of a sample from the North-Western Black Sea region (Ukraine). Theriol. Ukr. 2024, 28, 69–83. [Google Scholar] [CrossRef]
  50. García-Perea, R.; Baquero, R. Age estimation in Iberian wildcats Felis silvestris, by canine tooth sections. Acta Theriol. 1999, 44, 329–340. [Google Scholar] [CrossRef]
  51. Georgiev, B.; Biserkov, V.; Genov, T. In toto staining method for cestodes with iron acetocarmine. Helminthologia 1986, 23, 279–281. [Google Scholar]
  52. Khalil, L.F.; Jones, A.; Bray, R.A. Keys to the Cestode Parasites of Vertebrates, 1st ed.; CAB Int.: Wallingford, UK, 1994; p. 98. [Google Scholar]
  53. Sambrook, J.; Russell, D.W. The Condensed Protocols. From Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2006. [Google Scholar]
  54. Bowles, J.; Blair, D.; McManus, D.P. Genetic variants within the genus Echinococcus identified by mitochondrial sequencing. Mol. Biochem. Parasitol. 1992, 54, 165–174. [Google Scholar] [CrossRef]
  55. Azuma, H.; Okamoto, M.; Oku, Y.; Kamiya, M. Intraspecific variation of Taenia taeniaeformis as determined by various criteria. Parasitol. Res. 1995, 81, 103–108. [Google Scholar] [CrossRef]
  56. Al-Sabi, M.N.S.; Kapel, C.M.O. First report of Eucoleus boehmi in red foxes (Vulpes vulpes) in Denmark, based on coprological examination. Acta Parasitol. 2013, 58, 570–576. [Google Scholar] [CrossRef]
  57. Krone, O.; Guminsky, O.; Meinig, H.; Herrmann, M.; Trinzen, M.; Wibbelt, G. Endoparasite spectrum of wild cats (Felis silvestris Schreber, 1777) and domestic cats (Felis catus L.) from the Eifel, Pfalz region and Saarland, Germany. Eur. J. Wildl. Res. 2008, 54, 95–100. [Google Scholar] [CrossRef]
  58. Abu-Madi, M.A.; Pal, P.; Al-Thani, A.; Lewis, J.W. Descriptive epidemiology of intestinal helminth parasites from stray cat populations in Qatar. J. Helminthol. 2008, 82, 59–68. [Google Scholar] [CrossRef]
  59. Abu-Madi, M.A.; Behnke, J.M.; Prabhaker, K.S.; Al-Ibrahim, R.; Lewis, J.W. Intestinal helminths of feral cat populations from urban and suburban districts of Qatar. Vet. Parasitol. 2010, 168, 284–292. [Google Scholar] [CrossRef]
  60. Diakou, A.; Migli, D.; Dimzas, D.; Morelli, S.; Di Cesare, A.; Youlatos, D.; Lymberakis, P.; Traversa, D. Endoparasites of european wildcats (Felis silvestris) in Greece. Pathogens 2021, 10, 594. [Google Scholar] [CrossRef]
  61. Adalid, R.; Feliu, C.; Somoano, A.; Miñarro, M.; Ventura, J.; Torres, J.; Miquel, J.; Fuentes, M.V. Ecological analysis of the helminth community of Microtus lusitanicus (Gerbe, 1879) (rodentia) in asturias (nw spain). Animals 2021, 11, 3055. [Google Scholar] [CrossRef] [PubMed]
  62. Fuentes, M.V.; Puchades-Colera, P.; Gosálvez, C.; Sáez-Durán, S.; Cholvi-Simó, M.; Ruvira, S.; Sanxis-Furió, J.; Pascual, J.; Bueno-Marí, R.; Franco, S.; et al. The Role of the Norway Rat, Rattus norvegicus, as a Reservoir of Zoonotic Helminth Species in the City of Barcelona (Spain). Animals 2025, 15, 298. [Google Scholar] [CrossRef] [PubMed]
  63. Miljević, M.; Rajičić, M.; Marco, J.; Blagojević, J.; Rodríguez-Pastor, R.; Bajić, B.; Millán, J. Hydatigera parva population genetics in Iberian rodents provides insights into its introduction from Africa. Parasitology 2025, 152, 149–155. [Google Scholar] [CrossRef]
  64. Valdmann, H.; Moks, E.; Talvik, H. Helminth Fauna of Eurasian Lynx (Lynx lynx) in Estonia. J. Wildl. Dis. 2004, 40, 356–360. [Google Scholar] [CrossRef]
  65. Hutchison, W.M. Studies on Hydatigera taeniaeformis I. Growth of the Larval Stage. J. Parasitol. 1958, 44, 574–582. [Google Scholar] [CrossRef] [PubMed]
  66. Ramos, D.G.; Scheremeta, R.G.; de Oliveira, A.C.; Sinkoc, A.L.; Pacheco, R.C. Survey of helminth parasites of cats from the metropolitan area of Cuiabá, Mato Grosso, Brazil. Rev. Bras. Parasitol. Vet. 2013, 22, 201–206. [Google Scholar] [CrossRef] [PubMed]
  67. Cantó, G.J.; Guerrero, R.I.; Olvera-Ramírez, A.M.; Milián, F.; Mosqueda, J.; Aguilar-Tipacamú, G. Prevalence of Fleas and Gastrointestinal Parasites in Free-Roaming Cats in Central Mexico. PLoS ONE 2013, 8, 4–9. [Google Scholar] [CrossRef]
  68. El-Shabrawy, M.N.; Imam, E.A. Studies on cestodes ofdomestic cats in Egypt with particular reference to species belonging to genera Diplopylidium and Joyeuxiella. J. Egypt. Vet. Med. Assoc. 1978, 38, 19–27. [Google Scholar]
  69. Schuster, R.K.; Thomas, K.; Sivakumar, S.; O’Donovan, D. The parasite fauna of stray domestic cats (Felis catus) in Dubai, United Arab Emirates. Parasitol. Res. 2009, 105, 125–134. [Google Scholar] [CrossRef]
  70. Hassan, H.F.; Gaeib, S.Y. Isolation and Identification of different Intestinal Helminthes Groups from Stray Cats in Urban City of Kirkuk. Pakistan J. Med. Health Sci. 2021, 15, 1916–1921. [Google Scholar] [CrossRef]
  71. Arbabi, M.; Hooshyar, H. Gastrointestinal parasites of stray cats in Kashan, Iran. Trop. Biomed. 2009, 26, 16–22. [Google Scholar]
  72. Changizi, E.; Mobedi, I.; Salimi-Bejestani, M.R.; Rezaei-Doust, A. Gastrointestinal Helminthic Parasites in Stray Cats (Felis catus) from North of Iran. Iran. J. Parasitol. 2007, 2, 25–29. [Google Scholar]
  73. Zibaei, M.; Sadjjadi, S.M.; Sarkari, B. Prevalence of Toxocara cati and other intestinal helminths in stray cats in Shiraz, Iran. Trop. Biomed. 2007, 24, 39–43. [Google Scholar]
  74. Takeuchi-Storm, N.; Mejer, H.; Al-Sabi, M.N.; Olsen, C.S.; Thamsborg, S.M.; Enemark, H.L. Gastrointestinal parasites of cats in Denmark assessed by necropsy and concentration McMaster technique. Vet. Parasitol. 2015, 214, 327–332. [Google Scholar] [CrossRef]
  75. Waap, H.; Gomes, J.; Nunes, T. Parasite communities in stray cat populations from Lisbon, Portugal. J. Helminthol. 2014, 88, 389–395. [Google Scholar] [CrossRef]
  76. Mircean, V.; Titilincu, A.; Vasile, C. Prevalence of endoparasites in household cat (Felis catus) populations from Transylvania (Romania) and association with risk factors. Vet. Parasitol. 2010, 171, 163–166. [Google Scholar] [CrossRef] [PubMed]
  77. Rodríguez-Ponce, E.; González, J.F.; De Felipe, M.C.; Hernández, J.N.; Raduan Jaber, J. Epidemiological survey of zoonotic helminths in feral cats in Gran Canaria island (Macaronesian archipelago-Spain). Acta Parasitol. 2016, 61, 443–450. [Google Scholar] [CrossRef] [PubMed]
  78. Calvete, C.; Lucientes, J.; Castillo, J.A.; Estrada, R.; Gracia, M.J.; Peribáñez, M.A.; Ferrer, M. Gastrointestinal helminth parasites in stray cats from the mid-Ebro Valley, Spain. Vet. Parasitol. 1998, 75, 235–240. [Google Scholar] [CrossRef] [PubMed]
  79. Kitchener, A.; Breitenmoser, C.; Eizirik, E.; Gentry, A.; Werdelin, L.; Wilting, A.; Yamaguchi, N.; Abramov, A.V.; Christiansen, P.; Driscoll, C.; et al. A revised taxonomy of the Felidae. The final report of the Cat Classification Task Force of the IUCN/SSC Cat Specialist Group. Cat News 2017, 11, 3–79. [Google Scholar]
Animals 15 03340 g001
Figure 1. Geographic distribution of the Hydatigera species found in the analyzed European wildcats (Felis silvestris) in central Spain (country location shown in the inset, in red). The numbers in the circles indicate the number of wildcats non-infected/infected with one or more Hydatigera species according to the following color key: Grey: Hydatigera spp.-negative; Blue: H. kamiyai-positive; Yellow: Hydatigera sp.-positive; Green: Mix infections (Hydatigera sp. + H. kamiyai); Orange backgroupd: Castilla y León Autonomous Community; Dark Brown background: Castilla-La Mancha Autonomous Community.
Figure 1. Geographic distribution of the Hydatigera species found in the analyzed European wildcats (Felis silvestris) in central Spain (country location shown in the inset, in red). The numbers in the circles indicate the number of wildcats non-infected/infected with one or more Hydatigera species according to the following color key: Grey: Hydatigera spp.-negative; Blue: H. kamiyai-positive; Yellow: Hydatigera sp.-positive; Green: Mix infections (Hydatigera sp. + H. kamiyai); Orange backgroupd: Castilla y León Autonomous Community; Dark Brown background: Castilla-La Mancha Autonomous Community.
Animals 15 03340 g001
Animals 15 03340 g002
Figure 2. Scolex, mature and gravid proglottids of Hydatigera sp. (A–C) and H. kamiyai (D–F) and obtained from wildcats.
Figure 2. Scolex, mature and gravid proglottids of Hydatigera sp. (A–C) and H. kamiyai (D–F) and obtained from wildcats.
Animals 15 03340 g002
Animals 15 03340 g003
Figure 3. PCR multiplex band pattern on 1% agarose gel electrophoresis. From left to right: lane 1, Ladder (bp); lanes 2, 8, 10, 14, 15 and 16, Hydatigera sp. (Hsp); lanes 3, 4, 5, 6, 7, 9, 11, 12 and 13, Hydatigera kamiyai (Hk); lane 17, Hydatigera parva (Hp).
Figure 3. PCR multiplex band pattern on 1% agarose gel electrophoresis. From left to right: lane 1, Ladder (bp); lanes 2, 8, 10, 14, 15 and 16, Hydatigera sp. (Hsp); lanes 3, 4, 5, 6, 7, 9, 11, 12 and 13, Hydatigera kamiyai (Hk); lane 17, Hydatigera parva (Hp).
Animals 15 03340 g003
Table 2. GenBank sequences utilized for multiplex PCR primer design.
Table 2. GenBank sequences utilized for multiplex PCR primer design.
Hydatigera SpeciesStageHost SpeciesGenBank Accession No.
H. taeniaeformis s.s.AdultFelis catusFJ597547
AdultPrionailurus bengalensisON055368
AdultNot indicatedJQ663994
H. kamiyaiAdultNot indicatedNC037071
AdultNot indicatedPP104554
AdultFelis catusLC008533
Hydatigera sp.LarvaEospolax fontanieriiNC061206
LarvaEospolax fontanieriiMW808981
H. parvaLarvaNot indicatedNC021141
H. krepkogorskiLarvaNot indicatedNC021142
Table 3. Complete mitochondrial sequences retrieved from GenBank utilized for multiplex PCR primer design. Primer location is shown in Supplementary File S1.
Table 3. Complete mitochondrial sequences retrieved from GenBank utilized for multiplex PCR primer design. Primer location is shown in Supplementary File S1.
PrimerSequence (5′-3′)Expected
Amplicon Size (bp)		Primer
Location in mtDNA
CestodesJB3 TTTTTTGGGCATCCTGAGGTTTAT450cox1
JB4.5 TAAAGAAAGAACATAATGAAAATG
H. kamiyaiHDTATTACTGGTGATACATTAATGCGTG 1063cytb
nad4
HKARAARTAAAAACGTACCCAACTAGACAG
Hydatigera sp.HDTATTACTGGTGATACATTAATGCGTG 618cytb
HSRATTAATCTTATCATAACGACAACTAATAATCC
Table 4. Prevalence of Hydatigera kamiyai and Hydatigera sp. in wildcats (Felis silvestris) from different locations in Spain.
Table 4. Prevalence of Hydatigera kamiyai and Hydatigera sp. in wildcats (Felis silvestris) from different locations in Spain.
Wildcat IDSexLocationHydatigera kamiyaiHydatigera sp.Total
147HBurgos-44
180MBurgos11617
198MBurgos11-11
199MBurgos6410
211MBurgos7-7
212MBurgos8-8
236HBurgos246
237HSoria156
262MBurgos19120
263MSalamanca11415
268MBurgos111122
272MValladolid261036
275MBurgos3710
317MBurgos-3030
365MBurgos-1313
366MSoria235
367HBurgos7310
376HBurgos325
412MToledo-55
Total5 H/14 M 128112240
Abbreviations: F = Female; M = Male.
Table 5. Comparative morphometric measurements of Hydatigera kamiyai and Hydatigera sp. from wildcats in Spain, with reference data for H. kamiyai and H. taeniaeformis sensu stricto [21]. Values are given as mean ± standard deviation (range), in µm.
Table 5. Comparative morphometric measurements of Hydatigera kamiyai and Hydatigera sp. from wildcats in Spain, with reference data for H. kamiyai and H. taeniaeformis sensu stricto [21]. Values are given as mean ± standard deviation (range), in µm.
Adults of Our Study (Mean)Reference Values
H. kamiyaiHydatigera sp.H. kamiyaiH. taeniaeformis s.s.
Scolex width1270 ± 2001470 ± 1001960 ± 2001300 ± 125
(1100–1580)(1420–1550)(1770–2170)(1190–1440)
Rostellum diameter791 ± 82.7846 ± 21824 ± 89.5736 ± 38
(700–902)(817–863)(731–910)(703–779)
Number of hooks32 ± 3.235 ± 0.933 ± 538 ± 3
(28–36)(34–36)(30–40)(36–42)
Length of large hooks421 ± 29409 ± 25426 ± 30429 ± 37
(380–458)(375–434)(396–456)(393–467)
Length of small hooks269 ± 18254 ± 14253 ± 31266 ± 16
(266–286)(247–273)(213–275)(249–281)
TL421 ± 29409 ± 25426 ± 30425 ± 37
(380–458)(375–434)(396–456)(393–467)
TW169 ± 22167 ± 18162 ± 10.5181 ± 12
Large (145–205)(142–184)(150–171)(170–194)
hooksBL280 ± 41293 ± 9265 ± 14286 ± 29
(224–322)(281–302)(249–277)(256–314)
AL191 ± 18178 ± 27192 ± 15.5202 ± 8
(161–208)(140–203)(179–210)(193–209)
GL71 ± 1678 ± 1575 ± 3.583 ± 11.5
(54–88)(56–88)(71–78)(72–95)
GW66 ± 776 ± 862 ± 468 ± 13
(55–75)(67–86)(58–66)(59–85)
BC40 ± 441 ± 537 ± 5.541 ± 7
(37–43)(39–47)(32–43)(35–49)
HW53 ± 1551 ± 748 ± 6.564 ± 12.5
(32–74)(41–56)(42–55)(53–78)
TL269 ± 18254 ± 14253 ± 31266 ± 16
(266–286)(247–273)(213–275)(249–281)
TW122 ± 8130 ± 8114 ± 4123 ± 13
Small (114–132)(121–140)(110–118)(111–137)
hooksBL155 ± 18156 ± 4126 ± 22150 ± 7
(140–185)(150–160)(111–155)(145–159)
AL142 ± 13145 ± 1141 ± 8.5154 ± 10
(124–161)(144–146)(131–148)(146–166)
GL55 ± 661 ± 155 ± 655 ± 6
(47–64)(59–62)(50–62)(48–60)
GW56 ± 551 ± 1144 ± 1150 ± 11
(49–62)(39–65)(35–57)(40–62)
BC32 ± 632 ± 227 ± 738 ± 6
(23–38)(29–34)(20–34)(32–44)
HW34 ± 233 ± 631 ± 534 ± 5.5
(33–37)(25–40)(25–35)(29–40)
Sucker size (height ×
width)		401 ± 52 × 350 ± 96
(320–460) × (246–456)		381 ± 14 × 349 ± 38
(365–400) × (295–378)		445 ± 57 × 399 ± 65
(396–510) × (333–463)		300 ± 16.5 × 248 ± 20
(288–321) × (228–268)
Number of uterine9 ± 1.59 ± 0.948 ± 2.59 ± 3.5
branches (unilateral)(8–11)(8–10)(6–11)(5–12)
Hook parameters following Lavikainen et al. [21]. TL: Total length; TW: Total width; BL: Basal length; AL: Apical length; GL: Guard length; GW: Guard width; BC: Blade curvature; HW: Handle width.
Table 6. Epidemiological data of Taenia taeniaeformis/Hydatigera taeniaeformis s.l. across Felidae species.
Table 6. Epidemiological data of Taenia taeniaeformis/Hydatigera taeniaeformis s.l. across Felidae species.
Host Species *PrevalenceOriginMean Intensity (Range)Reference
Lynx pardinus2/8 (25%)Spain1.50 (1–2)[26]
Lynx lynx1/37 (3%)Estonia1[64]
Felis silvestris8/15 (53%)Germany8 (2–20)[57]
17/23 (73.9%)Greece-[60]
7.7%Scotland-[65]
21/27 (78%)Spain12.6 (1–30)This study
Felis catus1/146 (0.68%)Brazil1[66]
14/358 (4%)Mexico3[67]
20/51 (39%)Egypt-[68]
370/488 (75.8%)Qatar-[58]
484/658 (73.6%)Qatar33.3[59]
40/240 (16.7%)United Arab
Emirates		4 (1–79)[69]
3/25 (12%)Irak-[70]
17/113 (15%)Iran0.35[71]
1/50 (2%)Iran-[72]
13/114 (12.3%)Iran-[73]
36/99 (36.4%)Denmark8.1 (1–57)[74]
5/162 (3.1%)Portugal(1–5)[75]
11/414 (2.7%)Romania-[76]
36/48 (75%)Spain-[77]
5/58 (8.6%)Spain-[78]
Prionailurus bengalensis1/1 (100%)China1[79]
* Species named as Felis silvestris catus and Felis silvestris silvestris have been included as Felis catus or F. silvestris following the classification of Kitchener and coworkers (46) (Kitchener, 2017 [79]).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Matas-Méndez, P.; Esteban-Sánchez, L.; Ponce-Gordo, F.; Mateo-Barrientos, M. Identification of Hydatigera Species in Wildcats (Felis silvestris) from Central Spain. Animals 2025, 15, 3340. https://doi.org/10.3390/ani15223340

AMA Style

Matas-Méndez P, Esteban-Sánchez L, Ponce-Gordo F, Mateo-Barrientos M. Identification of Hydatigera Species in Wildcats (Felis silvestris) from Central Spain. Animals. 2025; 15(22):3340. https://doi.org/10.3390/ani15223340

Chicago/Turabian Style

Matas-Méndez, Pablo, Lorena Esteban-Sánchez, Francisco Ponce-Gordo, and Marta Mateo-Barrientos. 2025. "Identification of Hydatigera Species in Wildcats (Felis silvestris) from Central Spain" Animals 15, no. 22: 3340. https://doi.org/10.3390/ani15223340

APA Style

Matas-Méndez, P., Esteban-Sánchez, L., Ponce-Gordo, F., & Mateo-Barrientos, M. (2025). Identification of Hydatigera Species in Wildcats (Felis silvestris) from Central Spain. Animals, 15(22), 3340. https://doi.org/10.3390/ani15223340

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop