Seasonal Temperature Differentially Modulates the Immunotranscriptomic Performance in Atlantic Salmon Skin in Response to Natural Caligus rogercresseyi Infestation in Open-Ocean Cages
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Fish and Sampling
2.3. RNA Extraction
2.4. RNA Sequencing and Analysis
2.5. Analysis of Differentially Expressed Genes (DEGs) and Interpretation by Functional Networks
2.6. DNAse Treatment and cDNA Synthesis
2.7. Primer Design and qPCR
2.8. Statistical Analysis
3. Results
3.1. Infestation Profile and Life Stage of C. rogercresseyi Across Seasons
3.2. Differential Transcriptomic Profiling of the Skin of Atlantic Salmon Infested with C. rogercresseyi Under Productive Conditions in Autumn and Spring
3.3. Functional Network Analysis
3.4. Validation of RNA-seq by Real-Time qPCR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Global Seafood Alliance’s 2023 Annual Report. Available online: https://info.globalseafood.org/2023-annual-report (accessed on 25 March 2025).
- FAO. El Estado Mundial de la Pesca y la Acuicultura 2024. 2024. Available online: https://openknowledge.fao.org/server/api/core/bitstreams/ac22c090-772a-4624-8265-43e289ac3743/content (accessed on 25 March 2025).
- SalmonChile & INTESAL. 9° informe de Sustentabilidad. 2023. Available online: https://www.salmonchile.cl/descargas/IX_Informe_Sustentabilidad_SalmonChile_2023.pdf (accessed on 25 March 2025).
- Mennerat, A.; Ugelvik, M.S.; Håkonsrud Jensen, C.; Skorping, A. Invest more and die faster: The life history of a parasite on intensive farms. Evol. Appl. 2017, 10, 890–896. [Google Scholar] [CrossRef]
- Valenzuela-Muñoz, V.; Boltaña, S.; Gallardo-Escárate, C. Comparative immunity of Salmo salar and Oncorhynchus kisutch during infestation with the sea louse Caligus rogercresseyi: An enrichment transcriptome analysis. Fish Shellfish Immunol. 2016, 59, 276–287. [Google Scholar] [CrossRef] [PubMed]
- Dresdner, J.; Chávez, C.; Quiroga, M.; Jiménez, D.; Artacho, P.; Tello, A. Impact of Caligus treatments on unit costs of heterogeneous salmon farms in Chile. Aquac. Econ. Manag. 2019, 23, 1–27. [Google Scholar] [CrossRef]
- Bravo, S.; Pozo, V.; Silva, M.T. Evaluación de la efectividad del tratamiento con agua dulce para el control del piojo de mar Caligus rogercresseyi Boxshall & Bravo, 2000. Lat. Am. J. Aquat. Res. 2015, 43, 322–328. [Google Scholar]
- Sernapesca. Informe Sanitario de Salmonicultura en Centros Marinos Año 2023. Available online: https://www.sernapesca.cl/app/uploads/2024/09/Informe-Sanitario-ANO-2023.pdf (accessed on 1 March 2025).
- González, L.; Carvajal, J. Life cycle of Caligus rogercresseyi, (Copepoda: Caligidae) parasite of Chilean reared salmonids. Aquaculture 2003, 220, 101–117. [Google Scholar] [CrossRef]
- Robledo, D.; Gutiérrez, A.P.; Barría, A.; Yáñez, J.M.; Houston, R.D. Gene expression response to sea lice in Atlantic salmon skin: RNA sequencing comparison between resistant and susceptible animals. Front. Genet. 2018, 9, 287. [Google Scholar] [CrossRef]
- Saraiva, J.L.; Arechavala-Lopez, P.; Castanheira, M.F.; Volstorf, J.; Heinzpeter Studer, B. A global assessment of welfare in farmed fishes: The FishEthoBase. Fishes 2019, 4, 30. [Google Scholar] [CrossRef]
- Abram, Q.H.; Dixon, B.; Katzenback, B.A. Impacts of low temperature on the teleost immune system. Biology 2017, 6, 39. [Google Scholar] [CrossRef]
- Tort, L. Stress and immune modulation in fish. Dev. Comp. Immunol. 2011, 35, 1366–1375. [Google Scholar] [CrossRef]
- Esteban, M.Á.; Cerezuela, R. Fish mucosal immunity: Skin. In Mucosal Health in Aquaculture; Academic Press: New York, NY, USA, 2015; pp. 67–92. [Google Scholar]
- Ugelvik, M.S.; Mæhle, S.; Dalvin, S. Temperature affects settlement success of ectoparasitic salmon lice (Lepeophtheirus salmonis) and impacts the immune and stress response of Atlantic salmon (Salmo salar). J. Fish Dis. 2022, 45, 975–990. [Google Scholar] [CrossRef]
- Rogozynski, N.P.; Cadonic, I.G.; Soto-Dávila, M.; Wong-Benito, V.; Rodriguez-Ramos, T.; Craig, P.; Dixon, B. Diploid and triploid Chinook salmon (Oncorhynchus tshawytscha) exhibit differential immunological responses to acute thermal stress. J. Fish Dis. 2024, 47, e13998. [Google Scholar] [CrossRef] [PubMed]
- Groves, L.; Whyte, S.K.; Purcell, S.L.; Michaud, D.; Cai, W.C.; Garber, A.F.; Fast, M.D. Temperature impacts Atlantic salmon’s (Salmo salar) immunological response to infectious salmon anemia virus (ISAv). Fish Shellfish Immunol. Rep. 2023, 4, 100099. [Google Scholar] [CrossRef] [PubMed]
- Maciuszek, M.; Pijanowski, L.; Kemenade, L.V.V.; Chadzinska, M. Season affects the estrogen system and the immune response of common carp. Fish Physiol. Biochem. 2024, 50, 797–812. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, A.C.M.; Gravato, C.; Silva, C.J.M.; Pires, S.F.S.; Costa, A.P.L.; Conceição, L.E.C.; Santos, P.; Costas, B.; Calheiros, J.; Castro-Cunha, M.; et al. Seasonal temperature fluctuations differently affect the immune and biochemical parameters of diploid and triploid Oncorhynchus mykiss cage-cultured in temperate latitudes. Sustainability 2020, 12, 8785. [Google Scholar] [CrossRef]
- Sveen, L.R.; Timmerhaus, G.; Krasnov, A.; Takle, H.; Handeland, S.; Ytteborg, E. Wound healing in post-smolt Atlantic salmon (Salmo salar L.). Sci. Rep. 2019, 9, 3565. [Google Scholar] [CrossRef]
- Sveen, L.R.; Timmerhaus, G.; Krasnov, A.; Takle, H.; Stefansson, S.O.; Handeland, S.O.; Ytteborg, E. High fish density delays wound healing in Atlantic salmon (Salmo salar). Sci. Rep. 2018, 8, 16907. [Google Scholar] [CrossRef]
- Parra, D.; Reyes-Lopez, F.E.; Tort, L. Mucosal immunity and B cells in teleosts: Effect of vaccination and stress. Front. Immunol. 2015, 6, 354. [Google Scholar] [CrossRef]
- Nigam, A.K.; Kumari, U.; Mittal, S.; Mittal, A.K. Comparative analysis of innate immune parameters of the skin mucous secretions from certain freshwater teleosts, inhabiting different ecological niches. Fish Physiol. Biochem. 2012, 38, 1245–1256. [Google Scholar] [CrossRef]
- Beck, B.H.; Peatman, E. Mucosal Health in Aquaculture; Academic Press: New York, NY, USA; Elsevier: Amsterdam, The Netherlands, 2015. [Google Scholar]
- Resseguier, J.; Nguyen-Chi, M.; Wohlmann, J.; Rigaudeau, D.; Salinas, I.; Oehlers, S.H.; Wiegertjes, G.F.; Johansen, F.; Qiao, S.; Koppang, E.O.; et al. Identification of a pharyngeal mucosal lymphoid organ in zebrafish and other teleosts: Tonsils in fish? Sci. Adv. 2023, 9, eadj0101. [Google Scholar] [CrossRef]
- Salinas, I. The mucosal immune system of teleost fish. Biology 2015, 4, 525–539. [Google Scholar] [CrossRef]
- Braden, L.M.; Koop, B.F.; Jones, S.R. Signatures of resistance to Lepeophtheirus salmonis include a TH2-type response at the louse-salmon interface. Dev. Comp. Immunol. 2015, 48, 178–191. [Google Scholar] [CrossRef]
- Fast, M.D.; Burka, J.F.; Johnson, S.C.; Ross, N.W. Enzymes released from Lepeophtheirus salmonis in response to mucus from different salmonids. J. Parasitol. 2003, 89, 7–13. [Google Scholar] [CrossRef]
- Fast, M.D.; Ross, N.W.; Mustafa, A.; Sims, D.E.; Johnson, S.C.; Conboy, G.A.; Speare, D.J.; Johnson, G.; Burka, J.F. Susceptibility of rainbow trout Oncorhynchus mykiss, Atlantic salmon Salmo salar and coho salmon Oncorhynchus kisutch to experimental infection with sea lice Lepeophtheirus salmonis. Dis. Aquat. Org. 2002, 52, 57–68. [Google Scholar] [CrossRef]
- Yamaguchi, T.; Takizawa, F.; Fischer, U.; Dijkstra, J.M. Along the axis between type 1 and type 2 immunity; principles conserved in evolution from fish to mammals. Biology 2015, 4, 814–859. [Google Scholar] [CrossRef] [PubMed]
- Valenzuela-Muñoz, V.; Gallardo-Escárate, C.; Valenzuela-Miranda, D.; Nuñez-Acuña, G.; Benavente, B.P.; Alert, A.; Arevalo, M. Transcriptome Signatures of Atlantic Salmon—Resistant Phenotypes against Sea Lice Infestation Are Associated with Tissue Repair. Genes 2023, 14, 986. [Google Scholar] [CrossRef] [PubMed]
- Sernapesca. Guía Vigilancia Caligus. Available online: https://www.sernapesca.cl/app/uploads/2023/11/guia_vigilancia_caligus.pdf (accessed on 2 April 2025).
- Reyes-López, F.E.; Ibarz, A.; Ordóñez-Grande, B.; Vallejos-Vidal, E.; Andree, K.B.; Balasch, J.C.; Fernández-Alacid, L.; Sanahuja, I.; Sánchez-Nuño, S.; Firmino, J.P.; et al. Skin multi-omics-based interactome analysis: Integrating the tissue and mucus exuded layer for a comprehensive understanding of the teleost mucosa functionality as model of study. Front. Immunol. 2021, 11, 613824. [Google Scholar] [CrossRef] [PubMed]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
- Liao, Y.; Smyth, G.K.; Shi, W. The Subread aligner: Fast, accurate and scalable read mapping by seed-and-vote. Nucleic Acids Res. 2013, 41, e108. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Bindea, G.; Galon, J.; Mlecnik, B. CluePedia Cytoscape plugin: Pathway insights using integrated experimental and in silico data. Bioinformatics 2013, 29, 661–663. [Google Scholar] [CrossRef]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Sernapesca. Informe Sanitario de Salmonicultura en Centros Marinos Año 2011. Available online: https://www.sernapesca.cl/app/uploads/2023/10/informe_sanitario_2011.pdf (accessed on 1 March 2025).
- Sernapesca. Informe Sanitario de Salmonicultura en Centros Marinos Año 2012. Available online: https://www.sernapesca.cl/app/uploads/2023/10/informe_sanitario_2012.pdf (accessed on 1 March 2025).
- Sernapesca. Informe Sanitario de Salmonicultura en Centros Marinos Año 2013. Available online: https://www.sernapesca.cl/app/uploads/2023/10/informe_sanitario_2013.pdf (accessed on 1 March 2025).
- Sernapesca. Informe Sanitario de Salmonicultura en Centros Marinos Año 2014. Available online: https://www.sernapesca.cl/app/uploads/2023/10/informe_sanitario_2014.pdf (accessed on 1 March 2025).
- Sernapesca. Informe Sanitario de Salmonicultura en Centros Marinos Año 2015. Available online: https://www.sernapesca.cl/app/uploads/2023/10/informe_sanitario_2015.pdf (accessed on 1 March 2025).
- Sernapesca. Informe Sanitario de Salmonicultura en Centros Marinos Año 2016. Available online: https://www.sernapesca.cl/app/uploads/2023/10/informe_sanitario_2016.pdf (accessed on 1 March 2025).
- Sernapesca. Informe Sanitario de Salmonicultura en Centros Marinos Año 2017. Available online: https://www.sernapesca.cl/app/uploads/2023/10/informe_sanitario_2017_0.pdf (accessed on 1 March 2025).
- Sernapesca. Informe Sanitario de Salmonicultura en Centros Marinos Año 2018. Available online: https://www.sernapesca.cl/app/uploads/2023/10/informe_sanitario_salmonicultura_en_centros_marinos_2018_final.pdf (accessed on 1 March 2025).
- Sernapesca. Informe Sanitario de Salmonicultura en Centros Marinos Año 2019. Available online: https://www.sernapesca.cl/app/uploads/2023/10/informe_sanitario_salmonicultura_2019_final_julio_2020.pdf (accessed on 1 March 2025).
- Sernapesca. Informe Sanitario de Salmonicultura en Centros Marinos Año 2020. Available online: https://www.sernapesca.cl/app/uploads/2023/10/informe_sanitario_salmonicultura_en_centros_marinos_2020v2.pdf (accessed on 1 March 2025).
- Sernapesca. Informe Sanitario de Salmonicultura en Centros Marinos Año 2021. Available online: https://www.sernapesca.cl/app/uploads/2023/10/informe_sanitario_salmonicultura_en_centros_marinos_1_semestre_2021.pdf (accessed on 1 March 2025).
- Sernapesca. Informe Sanitario de Salmonicultura en Centros Marinos Año 2022. Available online: https://www.sernapesca.cl/app/uploads/2023/10/informe_sanitario_con_informacion_sanitaria_de_agua_dulce_y_mar_ano_2022.pdf (accessed on 1 March 2025).
- Revie, C.W.; Gettinby, G.; Treasurer, J.W.; Grant, A.N.; Reid, S.W.J. Sea lice infestations on farmed Atlantic salmon in Scotland and the use of ectoparasitic treatments. Vet. Rec. 2002, 151, 753–757. [Google Scholar] [PubMed]
- Kragesteen, T.J.; Johannesen, T.T.; Sandvik, A.; Andersen, K.H.; Johnsen, I.A. Salmon lice dispersal and population model for management strategy evaluation. Aquaculture 2023, 575, 739759. [Google Scholar] [CrossRef]
- Rittenhouse, M.A.; Revie, C.W.; Hurford, A. A model for sea lice (Lepeophtheirus salmonis) dynamics in a seasonally changing environment. Epidemics 2016, 16, 8–16. [Google Scholar] [CrossRef]
- Chung, J.S.; Bonkobara, M.; Tomihari, M.; Cruz, P.D., Jr.; Ariizumi, K. The DC-HIL/syndecan-4 pathway inhibits human allogeneic T-cell responses. Eur. J. Immunol. 2009, 39, 965–974. [Google Scholar] [CrossRef]
- Braden, L.M.; Michaud, D.; Groman, D.; Byrne, P.; Hori, T.S.; Fast, M.D. Rejection of Lepeophtheirus salmonis driven in part by chitin sensing is not impacted by seawater acclimitization in Coho salmon (Oncorhynchus kisutch). Sci. Rep. 2023, 13, 9685. [Google Scholar] [CrossRef]
- Wilson, A.B. MHC and adaptive immunity in teleost fishes. Immunogenetics 2017, 69, 521–528. [Google Scholar] [CrossRef]
- Dijkstra, J.M.; Yamaguchi, T. Ancient features of the MHC class II presentation pathway, and a model for the possible origin of MHC molecules. Immunogenetics 2019, 71, 233–249. [Google Scholar] [CrossRef]
- Keller, A.N.; Corbett, A.J.; Wubben, J.M.; McCluskey, J.; Rossjohn, J. MAIT cells and MR1-antigen recognition. Curr. Opin. Immunol. 2017, 46, 66–74. [Google Scholar] [CrossRef]
- Chen, F.; Liu, Z.; Wu, W.; Rozo, C.; Bowdridge, S.; Millman, A.; Rooijen, N.V.; Urban, J.F., Jr.; Wynn, T.A.; Gause, W.C. An essential role for TH2-type responses in limiting acute tissue damage during experimental helminth infection. Nat. Med. 2012, 18, 260–266. [Google Scholar] [CrossRef] [PubMed]
- Ogulur, I.; Mitamura, Y.; Yazici, D.; Pat, Y.; Ardicli, S.; Li, M.; D’Avino, P.; Beha, C.; Babayev, H.; Zhao, B.; et al. Type 2 immunity in allergic diseases. Cell Mol. Immunol. 2025, 22, 211–242. [Google Scholar] [CrossRef] [PubMed]
- Ruffell, D.; Mourkioti, F.; Gambardella, A.; Kirstetter, P.; Lopez, R.G.; Rosenthal, N.; Nerlov, C. A CREB-C/EBPβ cascade induces M2 macrophage-specific gene expression and promotes muscle injury repair. Proc. Natl. Acad. Sci. USA 2009, 106, 17475–17480. [Google Scholar] [CrossRef]
- Forlenza, M.; Fink, I.R.; Raes, G.; Wiegertjes, G.F. Heterogeneity of macrophage activation in fish. Dev. Comp. Immunol. 2011, 35, 1246–1255. [Google Scholar] [CrossRef]
- Grayfer, L.; Kerimoglu, B.; Yaparla, A.; Hodgkinson, J.W.; Xie, J.; Belosevic, M. Mechanisms of fish macrophage antimicrobial immunity. Front. Immunol. 2018, 9, 1105. [Google Scholar] [CrossRef]
- Chakraborty, S.; Singh, A.; Wang, L.; Wang, X.; Sanborn, M.A.; Ye, Z.; Maienschein-Cline, M.; Mukhopadhyay, A.; Ganesh, B.B.; Malik, A.B.; et al. Trained immunity of alveolar macrophages enhances injury resolution via KLF4-MERTK-mediated efferocytosis. J. Exp. Med. 2023, 220, e20221388. [Google Scholar] [CrossRef]
- Fang, F.; Shangguan, A.J.; Kelly, K.; Wei, J.; Gruner, K.; Ye, B.; Wang, W.; Bhattacharyya, S.; Hinchcliff, M.E.; Tourtellotte, W.G.; et al. Early growth response 3 (Egr-3) is induced by transforming growth factor-β and regulates fibrogenic responses. Am. J. Pathol. 2013, 183, 1197–1208. [Google Scholar] [CrossRef]
- Taefehshokr, S.; Key, Y.A.; Khakpour, M.; Dadebighlu, P.; Oveisi, A. Early growth response 2 and Egr3 are unique regulators in immune system. Cent. Eur. J. Immunol. 2017, 42, 205–209. [Google Scholar] [CrossRef]
- Holowiecki, A.; O’Shields, B.; Jenny, M.J. Characterization of heme oxygenase and biliverdin reductase gene expression in zebrafish (Danio rerio): Basal expression and response to pro-oxidant exposures. Toxicol. Appl. Pharmacol. 2016, 311, 74–87. [Google Scholar] [CrossRef]
- Jiang, Y.; Han, K.; Cai, M.; Wang, Y.; Zhang, Z. Characterization and spatiotemporal expression of Klf4 in large yellow croaker Larimichthys crocea. DNA Cell Biol. 2017, 36, 655–671. [Google Scholar] [CrossRef]
- Huang, Y.S.; Huang, W.L.; Lin, W.F.; Chen, M.C.; Jeng, S.R. An endothelial-cell-enriched primary culture system to study vascular endothelial growth factor (VEGF A) expression in a teleost, the Japanese eel (Anguilla japonica). Comp. Biochem. Physiol. Part Mol. Integr. Physiol. 2006, 145, 33–46. [Google Scholar] [CrossRef]
- Álvarez, F.; Razquin, B.E.; Villena, A.J.; Zapata, A.G. Seasonal changes in the lymphoid organs of wild brown trout, Salmo trutta L.: A morphometrical study. Vet. Immunol. Immunopathol. 1998, 64, 267–278. [Google Scholar] [CrossRef]
- Bowden, T.J.; Thompson, K.D.; Morgan, A.L.; Gratacap, R.M.; Nikoskelainen, S. Seasonal variation and the immune response: A fish perspective. Fish Shellfish Immunol. 2007, 22, 695–706. [Google Scholar] [CrossRef]
- Egan, J.P.; Ma, J.; Myrsell, V.L.; Chen, Z.; Masingale, J.; Caudill, C.C.; Boyle, T.; Browning, J.; Narum, S.R.; Cain, K.D.; et al. Temperature-Related Effects on Disease Susceptibility and Immune Response in Redband Trout (Oncorhynchus mykiss gairdneri) Following Challenge with Flavobacterium columnare. J. Fish Dis. 2025, 48, e14046. [Google Scholar] [CrossRef] [PubMed]
- Núñez-Acuña, G.; Gonçalves, A.T.; Valenzuela-Muñoz, V.; Pino-Marambio, J.; Wadsworth, S.; Gallardo-Escárate, C. Transcriptome immunomodulation of in-feed additives in Atlantic salmon Salmo salar infested with sea lice Caligus rogercresseyi. Fish Shellfish Immunol. 2015, 47, 450–460. [Google Scholar] [CrossRef] [PubMed]
- Reyes-López, F.E.; Aerts, J.; Vallejos-Vidal, E.; Ampe, B.; Dierckens, K.; Tort, L.; Bossier, P. Modulation of innate immune-related genes and glucocorticoid synthesis in gnotobiotic full-sibling European sea bass (Dicentrarchus labrax) larvae challenged with Vibrio anguillarum. Front. Immunol. 2018, 9, 914. [Google Scholar] [CrossRef] [PubMed]
- Vallejos-Vidal, E.; Khansari, A.R.; Teles, M.; Reyes-Cerpa, S.; Mancera, J.M.; Tort, L.; Reyes-López, F.E. The insertion/deletion in the DNA-binding region allows the discrimination and subsequent identification of the glucocorticoid receptor 1 (gr1) and gr2 nucleotide sequences in gilthead sea bream (Sparus aurata): Standardizing the gr nomenclature for a better understanding of the stress response in teleost fish species. Front. Mar. Sci. 2022, 9, 1021046. [Google Scholar]
- Spörl, F.; Korge, S.; Jürchott, K.; Wunderskirchner, M.; Schellenberg, K.; Heins, S.; Specht, A.; Stoll, C.; Klemz, R.; Maier, B.; et al. Krüppel-like factor 9 is a circadian transcription factor in human epidermis that controls proliferation of keratinocytes. Proc. Natl. Acad. Sci. USA 2012, 109, 10903–10908. [Google Scholar] [CrossRef]
- Rynne, J.; Ortiz-Zapater, E.; Bagley, D.C.; Zanin, O.; Doherty, G.; Kanabar, V.; Ward, J.; Jackson, D.J.; Parsons, M.; Rosenblatt, J.; et al. The RNA binding proteins ZFP36L1 and ZFP36L2 are dysregulated in airway epithelium in human and a murine model of asthma. Front. Cell Dev. Biol. 2023, 11, 1241008. [Google Scholar] [CrossRef]
- Costa-Mattioli, M.; Walter, P. The integrated stress response: From mechanism to disease. Science 2020, 368, eaat5314. [Google Scholar] [CrossRef]
- Baird, T.D.; Wek, R.C. Eukaryotic initiation factor 2 phosphorylation and translational control in metabolism. Adv. Nutr. 2012, 3, 307–321. [Google Scholar] [CrossRef]
- Hunt, D.; Raivich, G.; Anderson, P.N. Activating transcription factor 3 and the nervous system. Front. Mol. Neurosci. 2012, 5, 7. [Google Scholar] [CrossRef]
- Aluru, N.; Vijayan, M.M. Stress transcriptomics in fish: A role for genomic cortisol signaling. Gen. Comp. Endocrinol. 2009, 164, 142–150. [Google Scholar] [CrossRef]
- Buckley, B.A. Acute heat stress and thermal acclimation induce CCAAT/enhancer-binding protein delta in the goby Gillichthys mirabilis. J. Comp. Physiol. B 2011, 181, 773–780. [Google Scholar] [CrossRef] [PubMed]
- Pokanti, V.K.; Rasal, K.D.; Acharya, A.; Dey, D.; Sonwane, A.A.; Reang, D.; Pawar, S.S.; Kurade, N.P.; Bhendarkar, M.P.; Krishnani, K.K.; et al. Muscle Transcriptome Sequencing Revealed Thermal Stress Responsive Regulatory Genes in Farmed Rohu, Labeo Rohita (Hamilton, 1822). Mar Biotechnol. 2023, 25, 1057–1075. [Google Scholar]
- Wang, Q.-H.; Wu, R.-X.; Ji, J.-N.; Zhang, J.; Niu, S.-F.; Tang, B.-G.; Miao, B.-B.; Liang, Z.-B. Integrated transcriptomics and metabolomics reveal changes in cell homeostasis and energy metabolism in Trachinotus ovatus in response to acute hypoxic stress. Int. J. Mol. Sci. 2024, 25, 1054. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Su, C.; Liu, Q.; Hao, X.; Han, S.; Doretto, L.B.; Rosa, I.F.; Yang, Y.; Shao, C.; Wang, Q. Transcriptome analysis revealed the early heat stress response in the brain of Chinese Tongue Sole (Cynoglossus semilaevis). Animals 2023, 14, 84. [Google Scholar] [CrossRef]
- Cao, Q.; Zhang, H.; Li, T.; He, L.; Zong, J.; Shan, H.; Huang, L.; Zhang, Y.; Liu, H.; Jiang, J. Profiling miRNAs of teleost fish in responses to environmental stress: A review. Biology 2023, 12, 388. [Google Scholar] [CrossRef]
- Suragani, R.N.; Zachariah, R.S.; Velazquez, J.G.; Liu, S.; Sun, C.W.; Townes, T.M.; Chen, J.J. Heme-regulated eIF2α kinase activated Atf4 signaling pathway in oxidative stress and erythropoiesis. Blood, J. Am. Soc. Hematol. 2012, 119, 5276–5284. [Google Scholar] [CrossRef]
- Harding, H.P.; Zhang, Y.; Zeng, H.; Novoa, I.; Lu, P.D.; Calfon, M.; Sadri, N.; Yun, C.; Popko, B.; Paules, R.; et al. An integrated stress response regulates amino acid metabolism and resistance to oxidative stress. Mol. Cell 2003, 11, 619–633. [Google Scholar] [CrossRef]
- Valenzuela-Muñoz, V.; Gallardo-Escárate, C. Iron metabolism modulation in Atlantic salmon infested with the sea lice Lepeophtheirus salmonis and Caligus rogercresseyi: A matter of nutritional immunity? Fish Shellfish Immunol. 2017, 60, 97–102. [Google Scholar] [CrossRef]
- Martínez-González, J.; Canes, L.; Alonso, J.; Ballester-Servera, C.; Rodríguez-Sinovas, A.; Corrales, I.; Rodriguez, C. NR4A3: A key nuclear receptor in vascular biology, cardiovascular remodeling, and beyond. Int. J. Mol. Sci. 2021, 22, 11371. [Google Scholar] [CrossRef]
- Liang, S.T.; Audira, G.; Juniardi, S.; Chen, J.R.; Lai, Y.H.; Du, Z.C.; Lin, D.; Hsiao, C. Zebrafish carrying pycr1 gene deficiency display aging and multiple behavioral abnormalities. Cells 2019, 8, 453. [Google Scholar] [CrossRef] [PubMed]
- Ramos Rego, I.; Santos Cruz, B.; Ambrósio, A.F.; Alves, C.H. TRAP1 in oxidative stress and neurodegeneration. Antioxidants 2021, 10, 1829. [Google Scholar] [CrossRef] [PubMed]
- Kowalczyk, P.; Sulejczak, D.; Kleczkowska, P.; Bukowska-Ośko, I.; Kucia, M.; Popiel, M.; Wietrak, E.; Kramkowski, K.; Wrzosek, K.; Kaczyńska, K. Mitochondrial oxidative stress—A causative factor and therapeutic target in many diseases. Int. J. Mol. Sci. 2021, 22, 13384. [Google Scholar] [CrossRef] [PubMed]
- Picard, M.; McEwen, B.S.; Epel, E.S.; Sandi, C. An energetic view of stress: Focus on mitochondria. Front. Neuroendocrinol. 2018, 49, 72–85. [Google Scholar] [CrossRef]
- Nikolic, A.; Fahlbusch, P.; Wahlers, N.; Riffelmann, N.K.; Jacob, S.; Hartwig, S.; Kettel, U.; Dille, M.; Al-Hasani, H.; Kotzka, J.; et al. Chronic stress targets mitochondrial respiratory efficiency in the skeletal muscle of C57BL/6 mice. Cell. Mol. Life Sci. 2023, 80, 108. [Google Scholar] [CrossRef]
- Boshra, H.; Li, J.; Sunyer, J.O. Recent advances on the complement system of teleost fish. Fish Shellfish Immunol. 2006, 20, 239–262. [Google Scholar] [CrossRef]
- Harris, P.D.; Soleng, A.; Bakke, T.A. Killing of Gyrodactylus salaris (Platyhelminthes, Monogenea) mediated by host complement. Parasitology 1998, 117, 137–143. [Google Scholar] [CrossRef]
- Cai, W.; Kumar, S.; Navaneethaiyer, U.; Caballero-Solares, A.; Carvalho, L.A.; Whyte, S.K.; Purcell, S.L.; Gagne, N.; Hori, T.S.; Allen, M.; et al. Transcriptome analysis of Atlantic salmon (Salmo salar) skin in response to sea lice and infectious Salmon Anemia Virus co-infection under different experimental functional diets. Front. Immunol. 2022, 12, 787033. [Google Scholar] [CrossRef]
- Zanuzzo, F.S.; Beemelmanns, A.; Hall, J.R.; Rise, M.L.; Gamperl, A.K. The innate immune response of Atlantic salmon (Salmo salar) is not negatively affected by high temperature and moderate hypoxia. Front. Immunol. 2020, 11, 1009. [Google Scholar] [CrossRef] [PubMed]
- de Souza, K.B.; Asker, N.; Jönsson, E.; Förlin, L.; Sturve, J. Increased activity of lysozyme and complement system in Atlantic halibut exposed to elevated CO2 at six different temperatures. Mar. Environ. Res. 2016, 122, 143–147. [Google Scholar] [CrossRef] [PubMed]
- Lange, S.; Bambir, S.; Dodds, A.W.; Magnadóttir, B. The ontogeny of complement component C3 in Atlantic cod (Gadus morhua L.)—An immunohistochemical study. Fish Shellfish Immunol. 2004, 16, 359–367. [Google Scholar] [CrossRef] [PubMed]
- Zarantonello, A.; Revel, M.; Grunenwald, A.; Roumenina, L.T. C3-dependent effector functions of complement. Immunol. Rev. 2023, 313, 120–138. [Google Scholar] [CrossRef]
- Zhong, L.; Carvalho, L.A.; Gao, S.; Whyte, S.K.; Purcell, S.L.; Fast, M.D.; Cai, W. Transcriptome analysis revealed immune responses in the kidney of Atlantic salmon (Salmo salar) co-infected with sea lice (Lepeophtheirus salmonis) and infectious salmon anemia virus. Fish Shellfish Immunol. 2023, 143, 109210. [Google Scholar] [CrossRef]
- Toapanta, F.R.; Ross, T.M. Complement-mediated activation of the adaptive immune responses: Role of C3d in linking the innate and adaptive immunity. Immunol. Res. 2006, 36, 197–210. [Google Scholar] [CrossRef]
- Zhang, H.; Peatman, E.; Liu, H.; Niu, D.; Feng, T.; Kucuktas, H.; Waldbieser, G.; Chen, L.; Liu, Z. Characterization of a mannose-binding lectin from channel catfish (Ictalurus punctatus). Res. Vet. Sci. 2012, 92, 408–413. [Google Scholar] [CrossRef]
- Rickert, R.C. Regulation of B lymphocyte activation by complement C3 and the B cell coreceptor complex. Curr. Opin. Immunol. 2005, 17, 237–243. [Google Scholar] [CrossRef]
- Arockiaraj, J.; Chaurasia, M.K.; Kumaresan, V.; Palanisamy, R.; Harikrishnan, R.; Pasupuleti, M.; Kasi, M. Macrobrachium rosenbergii mannose binding lectin: Synthesis of MrMBL-N20 and MrMBL-C16 peptides and their antimicrobial characterization, bioinformatics and relative gene expression analysis. Fish Shellfish Immunol. 2015, 43, 364–374. [Google Scholar] [CrossRef]
- Harðardóttir, H.M.; Male, R.; Nilsen, F.; Dalvin, S. Chitin synthases are critical for reproduction, molting, and digestion in the salmon louse (Lepeophtheirus salmonis). Life 2021, 11, 47. [Google Scholar] [CrossRef]
- Auriti, C.; Prencipe, G.; Moriondo, M.; Bersani, I.; Bertaina, C.; Mondì, V.; Inglese, R. Mannose-binding lectin: Biologic characteristics and role in the susceptibility to infections and ischemia-reperfusion related injury in critically ill neonates. J. Immunol. Res. 2017, 2017, 7045630. [Google Scholar] [CrossRef] [PubMed]
- Rieger, A.M.; Barreda, D.R. Antimicrobial mechanisms of fish leukocytes. Dev. Comp. Immunol. 2017, 35, 1238–1245. [Google Scholar] [CrossRef] [PubMed]
- Mueller-Ortiz, S.L.; Drouin, S.M.; Wetsel, R.A. The alternative activation pathway and complement component C3 are critical for a protective immune response against Pseudomonas aeruginosa in a murine model of pneumonia. Infect. Immun. 2004, 72, 2899–2906. [Google Scholar] [CrossRef] [PubMed]
- Ricklin, D.; Lambris, J.D. Complement in immune and inflammatory disorders: Pathophysiological mechanisms. J. Immunol. 2013, 190, 3831–3838. [Google Scholar] [CrossRef]
- Núñez-Acuña, G.; Gallardo-Escárate, C.; Fields, D.M.; Shema, S.; Skiftesvik, A.B.; Ormazábal, I.; Browman, H.I. The Atlantic salmon (Salmo salar) antimicrobial peptide cathelicidin-2 is a molecular host-associated cue for the salmon louse (Lepeophtheirus salmonis). Sci. Rep. 2018, 8, 13738. [Google Scholar] [CrossRef]
- Wolf, T.; Jin, W.; Zoppi, G.; Vogel, I.A.; Akhmedov, M.; Bleck, C.K.E.; Beltraminelli, T.; Rieckmann, J.C.; Ramirez, N.J.; Benevento, M.; et al. Dynamics in protein translation sustaining T cell preparedness. Nat. Immunol. 2020, 21, 927–937. [Google Scholar] [CrossRef]
- Buchtíková, S.; Šimková, A.; Rohlenová, K.; Flajšhans, M.; Lojek, A.; Lilius, E.M.; Hyršl, P. The seasonal changes in innate immunity of the common carp (Cyprinus carpio). Aquaculture 2011, 318, 169–175. [Google Scholar] [CrossRef]
- Raida, M.K.; Buchmann, K. Bath vaccination of rainbow trout (Oncorhynchus mykiss Walbaum) against Yersinia ruckeri: Effects of temperature on protection and gene expression. Vaccine 2008, 26, 1050–1062. [Google Scholar] [CrossRef]
- Collazos, M.E.; Barriga, C.; Ortega, E. Seasonal variations in the immune system of the cyprinid Tinca tinca. Phagocytic function. Comp. Immunol. Microbiol. Infect. Dis. 1995, 18, 105–113. [Google Scholar] [CrossRef]








| Gene Name | Acronym | GenBank No. | Primer Sequence (–) | Product Size (bp) | Primer Efficiency (%) | Season |
|---|---|---|---|---|---|---|
| FOS like 1, AP-1 transcription factor subunit a | fosl1 | XM_014212300.2 | Fw: AACCCTTCACCTTCCCAACC; Rv: CTGCGTCTCTCCAACTCCTC | 125 | 106.7 | autumn |
| fos-related antigen 2 | fosl2 | XM_014210013.2 | Fw: AGTGTGCTCCTCTTCCGCT; Rv: CCGTCCTCATCGTCCTCTTG | 103 | 100.6 | autumn |
| CCAAT Enhancer Binding Protein Beta | cebpb | NM_001139913.1 | Fw: GCATCCTCGTCTTCCTCCAG; Rv: TCGCTTCTTCCCCTTGACAC | 108 | 106.6 | autumn |
| transcription factor AP-1 | jun | XM_014169347.2 | Fw: AGGGCTTTGCGGAGGGATTT; Rv: GCTCACTGTCAAGGCGGAAAC | 152 | 99.8 | autumn |
| tribbles pseudokinase 3 | trib3 | XM_014167385.2 | Fw: TCTCTTACGGACAAGCACGG; Rv: TAGCGACCCACCAGCAT | 134 | 96.4 | autumn |
| dual specificity phosphatase 1 | dusp1 | XM_014198502.2 | Fw: TCTCTCAGGGGAGTATCAGTC; Rv: TGACGGCTTGGTACACATCT | 196 | 108.8 | autumn |
| translocase of inner mitochondrial membrane 8 homolog A | timm8A | XM_014199088.2 | Fw: AAGGTTTCAGCAGTTGGTCC; Rv: CTCTACACAGTTCACAAAGC | 117 | 111.1 | autumn |
| complement component 7b | c7 | XM_014134762.2 | Fw: CACTACTTGTCAGAGGGGGC; Rv: GCTTCTTCTTCGTAACACACCG | 124 | 105 | spring |
| heat shock protein 90, class B member 1 | hsp90A1 | NM_001123532.1 | Fw: GCTACCACAGTTCTCAGTCCG; Rv: TGCTCTCGCCAGTGATGT | 105 | 100.2 | spring |
| CD74 molecule, major histocompatibility complex, class II invariant chain a | cd74 | XM_014199898.2 | Fw: AAGGGTTTTGAGGCTTGGACAC; Rv: CTCGTCACACTGAGGGAGGTAG | 162 | 107.3 | spring |
| probable ribosome biogenesis protein RLP24 | rls24D1 | XP_013982426.1 | Fw: GGCACAGTTCATCTTCAACAG; Rv: GCACCATCTTCTCCTCCATAACCTT | 140 | 100.4 | spring |
| nucleolar RNA helicase 2 | hfm1 | XM_014213631.2 | Fw: TGTTGCCTAAGACTCCCAAGC; Rv: CTTTTTCCCCGTCACTGCC | 102 | 98.2 | spring |
| collagen, type II, alpha 1b | col2A1 | NC_059453.1 | Fw: CCTGGCGATACTGGTCCTCAA; Rv: AAGTCCCTTTTCTCCTCCCTTC | 171 | 93.7 | spring |
| tenascin Ca (tnca) | tnc | XM_014137401.2 | Fw: AGATTGTTTTCACCCACCGC; Rv: CAGAAGCCAGAGTCACCAGT | 157 | 104 | spring |
| cartilage intermediate layer protein, nucleotide pyrophosphohydrolase | cilp | XM_014175441.2 | Fw: TCTTTGTGTTGTCGTGCCTG; Rv: CTTGTGCCGTAGTGGTGACT | 145 | 101 | spring |
| lipoprotein lipase | lpl | NC_059455.1 | Fw: AGTGACGGGAAGTTTGCTCA; Rv: GCTCTGGTGATGGGGGTAAC | 196 | 100.7 | spring |
| adipocyte plasma membrane associated protein | apmap | NM_001140255.1 | Fw: TGAGCCGCCCCTTATGTCT; Rv: GCCGTGCCAGTGTAAATCAA | 132 | 101.9 | spring |
| 40s ribosomal protein | fau | NM_001146588.1 | Fw: TGCCCAGAACACTCACACC; Rv: CAGAGATGCCACAGTCCACC | 164 | 101.9 | reference gene |
| Actin Beta | actb | AF012125.1 | Fw: ACTCAACCCCAAAGCCAACA; Rv: GCAGAGCGTAACCCTCGTAG | 189 | 103.2 | reference gene |
| 18S ribosomal RNA | 18S | AJ427629.1 | Fw: AGGAATTGACGGAAGGGCAC; Rv: ACCAGACAAATCGCTCCACC | 172 | 94 | reference gene |
| Eukaryotic Translation Elongation Factor 1 Alpha 1 | ef1α-1 | NM_001141909.1 | Fw: CTGGTGGTGTGGGTGAGTTT; Rv: AAACCGCTTCTGGCTGTAGG | 152 | 98.9 | reference gene |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cerda-Celis, A.; Vidal, M.; Goldstein, M.; Santillán-Araneda, M.J.; Rivera, A.; Vargas, D.; Jerez, G.; Vallejos-Vidal, E.; Reyes-Cerpa, S.; Reyes-López, F.E. Seasonal Temperature Differentially Modulates the Immunotranscriptomic Performance in Atlantic Salmon Skin in Response to Natural Caligus rogercresseyi Infestation in Open-Ocean Cages. Animals 2025, 15, 2369. https://doi.org/10.3390/ani15162369
Cerda-Celis A, Vidal M, Goldstein M, Santillán-Araneda MJ, Rivera A, Vargas D, Jerez G, Vallejos-Vidal E, Reyes-Cerpa S, Reyes-López FE. Seasonal Temperature Differentially Modulates the Immunotranscriptomic Performance in Atlantic Salmon Skin in Response to Natural Caligus rogercresseyi Infestation in Open-Ocean Cages. Animals. 2025; 15(16):2369. https://doi.org/10.3390/ani15162369
Chicago/Turabian StyleCerda-Celis, Andrea, Mabel Vidal, Merari Goldstein, Maria Jesús Santillán-Araneda, Alexis Rivera, Daniela Vargas, Gabriel Jerez, Eva Vallejos-Vidal, Sebastian Reyes-Cerpa, and Felipe E. Reyes-López. 2025. "Seasonal Temperature Differentially Modulates the Immunotranscriptomic Performance in Atlantic Salmon Skin in Response to Natural Caligus rogercresseyi Infestation in Open-Ocean Cages" Animals 15, no. 16: 2369. https://doi.org/10.3390/ani15162369
APA StyleCerda-Celis, A., Vidal, M., Goldstein, M., Santillán-Araneda, M. J., Rivera, A., Vargas, D., Jerez, G., Vallejos-Vidal, E., Reyes-Cerpa, S., & Reyes-López, F. E. (2025). Seasonal Temperature Differentially Modulates the Immunotranscriptomic Performance in Atlantic Salmon Skin in Response to Natural Caligus rogercresseyi Infestation in Open-Ocean Cages. Animals, 15(16), 2369. https://doi.org/10.3390/ani15162369

