Transcriptomic Analysis of Trachinotus ovatus Under Flow Velocity Stress
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Velocity Stress Experiment and Sample Collection
2.3. RNA Extraction, Library Construction, and Sequencingz
2.4. Quality Control and Read Alignment
2.5. Identification and Selection of Differentially Expressed Genes (DEGs)
2.6. Enrichment Analyses
2.7. STEM Analysis
2.8. Quantitative Real-Time PCR (qRT-PCR) Validation of Transcriptomic Data
3. Results
3.1. Sequencing Data Statistics and Quality Analysis
3.2. Differential Expression Analysis
3.3. GO and KEGG Enrichment Analyses
3.4. Gene Expression Trend Profiles and Enrichment Analysis
3.5. PPI Analysis
3.6. Validation of Gene Expression Patterns by qRT-PCR
4. Discussion
4.1. Effects of Flow Velocity Stress on Glucose and Lipid Metabolism
4.2. Effects of Flow Velocity Stress on Protein Synthesis
4.3. Protein Folding and Unfolded Protein Response (UPR)
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Palstra, A.P.; Planas, J.V. Fish under Exercise. Fish Physiol. Biochem. 2011, 37, 259–272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Merino, G.E.; Piedrahita, R.H.; Conklin, D.E. Effect of Water Velocity on the Growth of California Halibut (Paralichthys californicus) Juveniles. Aquaculture 2007, 271, 206–215. [Google Scholar] [CrossRef] [Scilit]
- Ibarz, A.; Felip, O.; Fernández-Borràs, J.; Martín-Pérez, M.; Blasco, J.; Torrella, J.R. Sustained Swimming Improves Muscle Growth and Cellularity in Gilthead Sea Bream. J. Comp. Physiol. B 2011, 181, 209–217. [Google Scholar] [CrossRef] [Scilit]
- Li, X.-M.; Yuan, J.-M.; Fu, S.-J.; Zhang, Y.-G. The Effect of Sustained Swimming Exercise on the Growth Performance, Muscle Cellularity and Flesh Quality of Juvenile Qingbo (Spinibarbus sinensis). Aquaculture 2016, 465, 287–295. [Google Scholar] [CrossRef] [Scilit]
- Anttila, K.; Jäntti, M.; Mänttäri, S. Effects of Training on Lipid Metabolism in Swimming Muscles of Sea Trout (Salmo trutta). J. Comp. Physiol. B 2010, 180, 707–714. [Google Scholar] [CrossRef] [Scilit]
- Blasco, J.; Moya, A.; Millán-Cubillo, A.; Vélez, E.J.; Capilla, E.; Pérez-Sánchez, J.; Gutiérrez, J.; Fernández-Borrás, J. Growth-Promoting Effects of Sustained Swimming in Fingerlings of Gilthead Sea Bream (Sparus aurata L.). J. Comp. Physiol. B 2015, 185, 859–868. [Google Scholar] [CrossRef] [Scilit]
- Zeng, J.; Liu, W.; Deng, Y.; Jiang, P.; Wang, Z.; Ou, Y.; Lu, H.; Hui, Y.; Xu, H.; Xu, P. Swimming Performance in Large Yellow Croaker: Effects of Group Size, Test Protocol, and Recovery Time on Critical Swimming Speed. Mar. Biotechnol. 2024, 26, 380–388. [Google Scholar] [CrossRef] [Scilit]
- Gao, Y.; Huang, X.; Liu, Y.; Lv, H.; Yin, X.; Li, W.; Chu, Z. Transcriptome Analysis of Large Yellow Croaker (Larimichthys crocea) at Different Growth Rates. Fish Physiol. Biochem. 2024, 50, 1745–1757. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiaolong, G.; Xian, L.; Mo, Z.; Fucun, W.; Ce, S.; Ying, L. Effects of Flow Velocity on Growth, Food Intake, Body Composition, and Related Gene Expression of Haliotis Discus Hannai Ino. Aquaculture 2017, 481, 48–57. [Google Scholar] [CrossRef] [Scilit]
- Yada, T.; Abe, M.; Miyamoto, K. Down-Regulation of Corticosteroid Receptor in Leucocytes of Stressed Rainbow Trout. Gen. Comp. Endocrinol. 2019, 280, 54–61. [Google Scholar] [CrossRef] [Scilit]
- Zhao, P.; Li, X.; Luo, Z.; Zhai, Q.; Tian, Y.; Zhang, K.; Guo, H. A Bio-Inspired Drag Reduction Method of Bionic Fish Skin Mucus Structure. Micromachines 2024, 15, 364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Solstorm, F.; Solstorm, D.; Oppedal, F.; Fernö, A.; Fraser, T.; Olsen, R. Fast Water Currents Reduce Production Performance of Post-Smolt Atlantic Salmon Salmo Salar. Aquacult. Environ. Interact. 2015, 7, 125–134. [Google Scholar] [CrossRef] [Scilit]
- Solstorm, F.; Solstorm, D.; Oppedal, F.; Olsen, R.; Stien, L.; Fernö, A. Not Too Slow, Not Too Fast: Water Currents Affect Group Structure, Aggression and Welfare in Post-Smolt Atlantic Salmon Salmo Salar. Aquacult. Environ. Interact. 2016, 8, 339–347. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Hu, C.S.; Liu, Q.; Dai, J.Y.; Wang, X.F.; Tang, B.G. Effect of flow velocity on swimming behavior and exercise physiology of Trachinotus ovatus. J. Fish. Sci. China 2024, 31, 381–390. [Google Scholar]
- Hoang, D.-H.; Ky, P.X.; Thi, V.H. Dietary Mannan Oligosaccharides Elevated Growth Performance, Gut Morphology, Microbiota, Body Composition, Feed and Nutrient Utilisation of Pompano, Trachinotus ovatus. Aquac. Rep. 2023, 32, 101720. [Google Scholar] [CrossRef] [Scilit]
- Baek, S.I.; Cho, S.H. Effects of Dietary Inclusion of a Crude Protein Source Exhibiting the Strongest Attractiveness to Red Sea Bream (Pagrus major) on Growth, Feed Availability, and Economic Efficiency. Animals 2024, 14, 771. [Google Scholar] [CrossRef] [Scilit]
- Lv, H.; Qu, X.; Chu, Z.; Li, W.; Yin, X.; Feng, D.; Park, J.; Hur, J.; Gao, Y. Integration of transcriptomics and Metabolomics Reveals the Effects of Sea Currents on Overwintering of Large Yellow Croaker Larimichthys crocea in Cage Culture. Aquaculture 2024, 578, 740054. [Google Scholar] [CrossRef] [Scilit]
- Tan, X.; Sun, Z.; Huang, Z.; Zhou, C.; Lin, H.; Tan, L.; Xun, P.; Huang, Q. Effects of Dietary Hawthorn Extract on Growth Performance, Immune Responses, Growth- and Immune-Related Genes Expression of Juvenile Golden Pompano (Trachinotus ovatus) and Its Susceptibility to Vibrio harveyi Infection. Fish Shellfish Immunol. 2017, 70, 656–664. [Google Scholar] [CrossRef] [Scilit]
- Ransangan, J.; Manin, B.O.; Abdullah, A.; Roli, Z.; Sharudin, E.F. Betanodavirus Infection in Golden Pompano, Trachinotus blochii, Fingerlings Cultured in Deep-Sea Cage Culture Facility in Langkawi, Malaysia. Aquaculture 2011, 315, 327–334. [Google Scholar] [CrossRef] [Scilit]
- He, Y.; Lin, G.; Rao, X.; Chen, L.; Jian, H.; Wang, M.; Guo, Z.; Chen, B. Microalga Isochrysis Galbana in Feed for Trachinotus ovatus: Effect on Growth Performance and Fatty Acid Composition of Fish Fillet and Liver. Aquacult. Int. 2018, 26, 1261–1280. [Google Scholar] [CrossRef] [Scilit]
- Liu, M.-J.; Guo, H.-Y.; Gao, J.; Zhu, K.-C.; Guo, L.; Liu, B.-S.; Zhang, N.; Jiang, S.-G.; Zhang, D.-C. Characteristics of Microplastic Pollution in Golden Pompano (Trachinotus ovatus) Aquaculture Areas and the Relationship between Colonized-Microbiota on Microplastics and Intestinal Microflora. Sci. Total Environ. 2023, 856, 159180. [Google Scholar] [CrossRef] [Scilit]
- Sun, L.Y.; Guo, H.Y.; Zhu, C.Y.; Ma, Z.H.; Jiang, S.G.; Zhang, D.C. Genetic polymorphism of breeding populations of golden pompano (Trachinotus ovatus). South China Fish. Sci. 2014, 10, 67–71. [Google Scholar] [CrossRef]
- Guo, S.; Mo, Z.; Wang, Z.; Xu, J.; Li, Y.; Dan, X.; Li, A. Isolation and Pathogenicity of Streptococcus iniae in Offshore Cage-Cultured Trachinotus ovatus in China. Aquaculture 2018, 492, 247–252. [Google Scholar] [CrossRef] [Scilit]
- Liang, Q.C.; Dai, J.H. Deep-sea, wave-resistant cage culture technology for golden pompano (Trachinotus ovatus). Sci. Fish Farming 2020, 5, 61–62. [Google Scholar]
- Li, Y.H.; Peng, S.F.; Zhou, Q.Y.; Meng, F.; Gui, H.; Zhang, T.H.; Qing, P.L. Study on deep-sea cage culture technology for golden pompano (Trachinotus ovatus). Sci. Fish Farming 2014, 5, 44–45. [Google Scholar]
- Nong, Z.; Wu, H.F.; Xie, Z.S.; Zheng, Y.H.; Wang, Q.Z.; Han, S.Y. Land-sea relay model for golden pompano (Trachinotus ovatus) aquaculture in Guangxi, China. Sci. Fish Farming 2024, 8, 70–71. [Google Scholar]
- Anonymous. Wave-resistant cage culture technology (cobia and golden pompano). Ocean. Fish. 2020, 6, 87–88. [Google Scholar]
- Sun, J.L.; Liu, Y.F.; Jiang, T.; Li, Y.Q.; Song, F.B.; Wen, X.; Luo, J. Golden Pompano (Trachinotus blochii) Adapts to Acute Hypoxic Stress by Altering the Preferred Mode of Energy Metabolism. Aquaculture 2021, 542, 736842. [Google Scholar] [CrossRef] [Scilit]
- Liu, Z.; Ma, A.; Yuan, C.; Zhao, T.; Chang, H.; Zhang, J. Transcriptome Analysis of Liver Lipid Metabolism Disorders of the Turbot Scophthalmus maximus in Response to Low Salinity Stress. Aquaculture 2021, 534, 736273. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Dai, J.Y.; Lai, X.W.; Liu, X.X.; Zhang, H.; Wang, X.F.; Tang, B.G. Metabolomic analysis of Trachinotus ovatus in response to flow velocity stress. Acta Oceanol. Sin. 2023, 45, 53–63. [Google Scholar]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An Ultra-Fast All-in-One FASTQ Preprocessor. Bioinformatics 2018, 34, I884–I890. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Langmead, B.; Salzberg, S.L. Fast Gapped-Read Alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, D.-C. Whole Genome Sequencing of Female Pompano (Trachinotus ovatus); Dataset; Figshare: London, UK, 2019. [Google Scholar] [CrossRef]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A Fast Spliced Aligner with Low Memory Requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ernst, J.; Bar-Joseph, Z. STEM: A tool for the analysis of short time series gene expression data. BMC Bioinformatics. 2006, 5, 7–191. [Google Scholar] [CrossRef] [Scilit]
- Waldrop, T.; Summerfelt, S.; Mazik, P.; Good, C. The Effects of Swimming Exercise and Dissolved Oxygen on Growth Performance, Fin Condition and Precocious Maturation of Early-Rearing Atlantic Salmon Salmo salar. Aquac. Res. 2018, 49, 801–808. [Google Scholar] [CrossRef] [Scilit]
- Zhu, T.; Li, D.; Xiang, K.; Zhao, J.; Zhu, Z.; Peng, Z.; Zhu, S.; Liu, Y.; Ye, Z. Effects of Acute Flow Velocity Stress on Oxygen Consumption Rate, Energy Metabolism and Transcription Level of Mandarin Fish (Siniperca chuatsi). Aquac. Rep. 2024, 38, 102293. [Google Scholar] [CrossRef] [Scilit]
- Johansson, D.; Laursen, F.; Fernö, A.; Fosseidengen, J.E.; Klebert, P.; Stien, L.H.; Vågseth, T.; Oppedal, F. The Interaction between Water Currents and Salmon Swimming Behaviour in Sea Cages. PLoS ONE 2014, 9, e97635. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Palstra, A.P.; Tudorache, C.; Rovira, M.; Brittijn, S.A.; Burgerhout, E.; Van Den Thillart, G.E.E.J.M.; Spaink, H.P.; Planas, J.V. Establishing Zebrafish as a Novel Exercise Model: Swimming Economy, Swimming-Enhanced Growth and Muscle Growth Marker Gene Expression. PLoS ONE 2010, 5, e14483. [Google Scholar] [CrossRef] [Scilit]
- Liang, Y.-S.; Wu, R.-X.; Niu, S.-F.; Miao, B.-B.; Liang, Z.-B.; Zhai, Y. Liver Transcriptome Analysis Reveals Changes in Energy Metabolism, Oxidative Stress, and Apoptosis in Pearl Gentian Grouper Exposed to Acute Hypoxia. Aquaculture 2022, 561, 738635. [Google Scholar] [CrossRef] [Scilit]
- Xu, Z.; Gan, L.; Li, T.; Xu, C.; Chen, K.; Wang, X.; Qin, J.G.; Chen, L.; Li, E. Transcriptome Profiling and Molecular Pathway Analysis of Genes in Association with Salinity Adaptation in Nile Tilapia Oreochromis niloticus. PLoS ONE 2015, 10, e0136506. [Google Scholar] [CrossRef] [Scilit]
- Yang, Q.-T.; Wu, R.-X.; Liang, Y.-S.; Niu, S.-F.; Miao, B.-B.; Liang, Z.-B.; Shen, Y.-X. Liver Transcriptome Changes in Pearl Gentian Grouper in Response to Acute High-Temperature Stress. Aquaculture 2024, 593, 741336. [Google Scholar] [CrossRef] [Scilit]
- Kersten, S. Integrated physiology and systems biology of PPARα. Mol. Metab. 2014, 6, 71–354. [Google Scholar] [CrossRef] [Scilit]
- Gorla-Bajszczak, A.; Juge-Aubry, C.; Pernin, A.; Burger, A.G.; Meier, C.A. Conserved amino acids in the ligand-binding and tau(i) domains of the peroxisome proliferator-activated receptor α are necessary for heterodimerization with RXR. Mol. Cell. Endocrinol. 1999, 147, 37–47. [Google Scholar] [CrossRef] [Scilit]
- Marion-Letellier, R.; Savoye, G.; Ghosh, S. Fatty Acids, Eicosanoids and PPAR Gamma. Eur. J. Pharmacol. 2016, 785, 44–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salmerón, C. Adipogenesis in Fish. J. Exp. Biol. 2018, 221, jeb161588. [Google Scholar] [CrossRef] [Scilit]
- Zimmermann, R.; Strauss, J.G.; Haemmerle, G.; Schoiswohl, G.; Birner-Gruenberger, R.; Riederer, M.; Lass, A.; Neuberger, G.; Eisenhaber, F.; Hermetter, A.; et al. Fat Mobilization in Adipose Tissue Is Promoted by Adipose Triglyceride Lipase. Science 2004, 306, 1383–1386. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ellis, J.M.; Li, L.O.; Wu, P.-C.; Koves, T.R.; Ilkayeva, O.; Stevens, R.D.; Watkins, S.M.; Muoio, D.M.; Coleman, R.A. Adipose Acyl-CoA Synthetase-1 Directs Fatty Acids toward β-Oxidation and Is Required for Cold Thermogenesis. Cell Metab. 2010, 12, 53–64. [Google Scholar] [CrossRef] [Scilit]
- Sánchez-Gurmaches, J.; Cruz-Garcia, L.; Ibarz, A.; Fernández-Borrás, J.; Blasco, J.; Gutiérrez, J.; Navarro, I. Insulin, IGF-I, and Muscle MAPK Pathway Responses after Sustained Exercise and Their Contribution to Growth and Lipid Metabolism Regulation in Gilthead Sea Bream. Domest. Anim. Endocrinol. 2013, 45, 145–153. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Li, X.; Yu, Y.; Zhang, L.; Dong, L.; Gan, J.; Mao, T.; Liu, T.; Peng, J.; He, L. Comparative Analyses of Liver Transcriptomes Reveal the Effect of Exercise on Growth-, Glucose Metabolism-, and Oxygen Transport-Related Genes and Signaling Pathways in Grass Carp (Ctenopharyngodon idella). Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2021, 262, 111081. [Google Scholar] [CrossRef] [Scilit]
- Massa, M.L.; Gagliardino, J.J.; Francini, F. Liver Glucokinase: An Overview on the Regulatorymechanisms of Its Activity. IUBMB Life 2011, 63, 1–6. [Google Scholar] [CrossRef] [Scilit]
- March, R.E.; Putt, W.; Hollyoake, M.; Ives, J.H.; Lovegrove, J.U.; Hopkinson, D.A.; Edwards, Y.H.; Whitehouse, D.B. The classical human phosphoglucomutase (PGM1) isozyme polymorphism is generated by intragenic recombination. Proc. Natl. Acad. Sci. USA 1993, 90, 10730–10733. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Glushakova, L.G.; Lisankie, M.J.; Eruslanov, E.B.; Ojano-Dirain, C.; Zolotukhin, I.; Liu, C.; Srivastava, A.; Stacpoole, P.W. AAV3-Mediated Transfer and Expression of the Pyruvate Dehydrogenase E1 Alpha Subunit Gene Causes Metabolic Remodeling and Apoptosis of Human Liver Cancer Cells. Mol. Genet. Metab. 2009, 98, 289–299. [Google Scholar] [CrossRef] [Scilit]
- Liu, M.J.; Wang, Z.J. Adaptive changes of Zebrafish (Danio rerio) to anaerobic exercise training. Zool. Res. 2013, 34, 190–195. [Google Scholar]
- Chen, Z.C.; Chen, P.M.; Yuan, H.R.; Feng, X.; Tong, F.; Zhang, H.M. Study on respiratory metabolism changes of juvenile Penaeus monodon following strenuous activity. South China Fish. Sci. 2016, 16, 75–83. [Google Scholar]
- Li, S.; Liu, Y.; Wang, Q.; Zhu, Z.; Li, W.; Li, C.; Li, C.; Fei, F.; Liu, B.; Shao, C. Flow velocity modulates growth, oxidative stress, and transcriptomic responses in spotted sea bass (Lateolabrax maculatus). Mar. Biotechnol. 2025, 27, 54. [Google Scholar] [CrossRef] [Scilit]
- Johnson, J.M.; Verkerke, A.R.P.; Maschek, J.A.; Ferrara, P.J.; Lin, C.-T.; Kew, K.A.; Neufer, P.D.; Lodhi, I.J.; Cox, J.E.; Funai, K. Alternative Splicing of UCP1 by Non-Cell-Autonomous Action of PEMT. Mol. Metab. 2020, 31, 55–66. [Google Scholar] [CrossRef] [Scilit]
- Bao, X.; Koorengevel, M.C.; Koerkamp, M.J.A.G.; Homavar, A.; Weijn, A.; Crielaard, S.; Renne, M.F.; Lorent, J.H.; Geerts, W.J.; Surma, M.A.; et al. Shortening of Membrane Lipid Acyl Chains Compensates for Phosphatidylcholine Deficiency in Choline-Auxotroph Yeast. Embo J. 2021, 40, e107966. [Google Scholar] [CrossRef] [Scilit]
- Guo, M.; Pegoraro, A.F.; Mao, A.; Zhou, E.H.; Arany, P.R.; Han, Y.; Burnette, D.T.; Jensen, M.H.; Kasza, K.E.; Moore, J.R.; et al. Cell Volume Change through Water Efflux Impacts Cell Stiffness and Stem Cell Fate. Proc. Natl. Acad. Sci. USA 2017, 114, E8618–E8627. [Google Scholar] [CrossRef] [Scilit]
- Zhao, T.; Ma, A.; Yang, S.; Huang, Z. Integrated Metabolome and Transcriptome Analyses Revealing the Effects of Thermal Stress on Lipid Metabolism in Juvenile Turbot Scophthalmus maximus. J. Therm. Biol. 2021, 99, 102937. [Google Scholar] [CrossRef] [Scilit]
- Watt, K.E.; Macintosh, J.; Bernard, G.; Trainor, P.A. RNA Polymerases I and III in Development and Disease. Semin. Cell Dev. Biol. 2023, 136, 49–63. [Google Scholar] [CrossRef] [Scilit]
- Caramori, G.; Casolari, P.; Adcock, I. Role of transcription factors in the pathogenesis of asthma and COPD. Cell Commun. Adhes. 2013, 20, 21–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fedorova, O.A.; Waldsich, C. Ribozyme structural elements: Group II introns and the spliceosome. In Encyclopedia of Biological Chemistry, 2nd ed.; Lennarz, W.J., Lane, M.D., Eds.; Academic Press: San Diego, CA, USA, 2013; pp. 147–153. [Google Scholar] [CrossRef] [Scilit]
- Wagner, E.; Lykke-Andersen, J. mRNA surveillance: The perfect persist. J. Cell Sci. 2002, 15, 3033–3038. [Google Scholar] [CrossRef] [Scilit]
- Brogna, S.; Wen, J. Nonsense-mediated mRNA decay (NMD) mechanisms. Nat. Struct. Mol. Biol. 2009, 16, 107–113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, X.; Li, Y.; Chengyan, C.; Shen, Y.; Wang, H.; Li, T. Spatial Expression of the Nonsense-Mediated mRNA Decay Factors UPF3A and UPF3B among Mouse Tissues. J. Zhejiang Univ. Sci. B 2023, 24, 1062–1068. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, S.; Tang, X.; Guo, Y.; Hu, J. Endoplasmic Reticulum Composition and Form: Proteins in and Out. Curr. Opin. Cell Biol. 2021, 71, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Hutchings, J.; Stancheva, V.G.; Brown, N.R.; Cheung, A.C.M.; Miller, E.A.; Zanetti, G. Structure of the complete, membrane-assembled COPII coat reveals a complex interaction network. Nat. Commun. 2021, 12, 2034. [Google Scholar] [CrossRef] [Scilit]
- Pan, Y.; Cao, F.; Guo, A.; Chang, W.; Chen, X.; Ma, W.; Gao, X.; Guo, S.; Fu, C.; Zhu, J. Endoplasmic reticulum ribosome-binding protein 1, RRBP1, promotes progression of colorectal cancer and predicts an unfavourable prognosis. Br. J. Cancer 2015, 113, 763–772. [Google Scholar] [CrossRef] [Scilit]
- Bravo, R.; Parra, V.; Gatica, D.; Rodriguez, A.E.; Torrealba, N.; Paredes, F.; Wang, Z.V.; Zorzano, A.; Hill, J.A.; Jaimovich, E.; et al. Chapter Five—Endoplasmic Reticulum and the Unfolded Protein Response: Dynamics and Metabolic Integration. Int. Rev. Cell Mol. Biol. 2013, 301, 215–290. [Google Scholar]
- Blanco-Herrera, F.; Moreno, A.A.; Tapia, R.; Reyes, F.; Araya, M.; D’Alessio, C.; Parodi, A.; Orellana, A. The UDP-Glucose: Glycoprotein Glucosyltransferase (UGGT), a Key Enzyme in ER Quality Control, Plays a Significant Role in Plant Growth as Well as Biotic and Abiotic Stress in Arabidopsis Thaliana. BMC Plant Biol. 2015, 15, 127. [Google Scholar] [CrossRef] [Scilit]
- Su, Y.; Wang, X.; Zhu, W.-G. DNA methyltransferases: The role in regulation of gene expression and biological processes. Yi Chuan 2009, 31, 1087–1093. [Google Scholar] [CrossRef] [Scilit]
- Strzyz, P. Methyl groups sink into phospholipids and histones. Nat. Rev. Mol. Cell Biol. 2017, 18, 342–343. [Google Scholar] [CrossRef] [Scilit]
- Giaimo, B.D.; Ferrante, F.; Borggrefe, T. Lysine and Arginine Methylation of Transcription Factors. Cell. Mol. Life Sci. 2024, 82, 5. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, S.; Su, Y.; Yao, Y. Progress in Protein Methylation. Acta Microbiol. Sin. 2017, 57, 1698–1707. [Google Scholar]
- Blanc, R.S.; Richard, S. Arginine Methylation: The Coming of Age. Mol. Cell 2017, 65, 8–24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vega, H.; Agellon, L.B.; Michalak, M. The Rise of Proteostasis Promoters: The Rise of Proteostasis Promoters. IUBMB Life 2016, 68, 943–954. [Google Scholar] [CrossRef] [Scilit]
- Yang, S.; Xiao, H.; Cao, L. Recent Advances in Heat Shock Proteins in Cancer Diagnosis, Prognosis, Metabolism and Treatment. Biomed. Pharmacother. 2021, 142, 112074. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buttacavoli, M.; Di Cara, G.; D’Amico, C.; Geraci, F.; Pucci-Minafra, I.; Feo, S.; Cancemi, P. Prognostic and Functional Significant of Heat Shock Proteins (HSPs) in Breast Cancer Unveiled by Multi-Omics Approaches. Biology 2021, 10, 247. [Google Scholar] [CrossRef] [Scilit]
- Xia, B.; Liu, Z.; Zhou, Y.; Wang, Y.; Huang, J.; Li, Y.; Kang, Y.; Wang, J.; Liu, X. Effects of Heat Stress on Biochemical Parameters and Heat Shock Protein Family A (Hsp70) Member 5 (HSPA5) mRNA Expression in Rainbow Trout (Oncorhynchus mykiss). Mar. Freshw. Res. 2018, 69, 1674. [Google Scholar] [CrossRef] [Scilit]
- Pobre, K.F.R.; Poet, G.J.; Hendershot, L.M. The Endoplasmic Reticulum (ER) Chaperone BiP Is a Master Regulator of ER Functions: Getting by with a Little Help from ERdj Friends. J. Biol. Chem. 2019, 294, 2098–2108. [Google Scholar] [CrossRef] [Scilit]
- Li, T.; Fu, J.; Cheng, J.; Elfiky, A.A.; Wei, C.; Fu, J. New Progresses on Cell Surface Protein HSPA5/BiP/GRP78 in Cancers and COVID-19. Front. Immunol. 2023, 14, 1166680. [Google Scholar] [CrossRef] [Scilit]
- Luo, B.; Lam, B.S.; Lee, S.H.; Wey, S.; Zhou, H.; Wang, M.; Chen, S.-Y.; Adams, G.B.; Lee, A.S. The Endoplasmic Reticulum Chaperone Protein GRP94 Is Required for Maintaining Hematopoietic Stem Cell Interactions with the Adult Bone Marrow Niche. PLoS ONE 2011, 6, e20364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anttila, K.; Eliason, E.J.; Kaukinen, K.H.; Miller, K.M.; Farrell, A.P. Facing Warm Temperatures during Migration: Cardiac mRNA Responses of Two Adult Oncorhynchus Nerka Populations to Warming and Swimming Challenges. J. Fish Biol. 2014, 84, 1439–1456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choi, J.-A.; Song, C.-H. Insights Into the Role of Endoplasmic Reticulum Stress in Infectious Diseases. Front. Immunol. 2020, 10, 3147. [Google Scholar] [CrossRef] [Scilit]
- Ong, G.; Ragetli, R.; Mnich, K.; Doble, B.W.; Kammouni, W.; Logue, S.E. IRE1 Signaling Increases PERK Expression during Chronic ER Stress. Cell Death Dis. 2024, 15, 276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, X.; Mao, W.; Lin, Z.; Ling, Q. Heat Stress Induced Hepatocyte Apoptosis in Largemouth Bass Micropterus salmoides via IRE1α/TRAF2/ASK1/JNK Pathway. J. Ocean. Limnol. 2024, 42, 988–1000. [Google Scholar] [CrossRef] [Scilit]









| Gene Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Amplicon Size (bp) |
|---|---|---|---|
| RPL32 | ACCAAGTACATGCTGCCAAC | CCTGTTCTTGGAGGAGACGT | 129 |
| APOEB | AGCTCTGATCCTTGCTCTGG | CTGCCAGAAACGATCCACAG | 109 |
| CYP2J2 | GACTCAACCTGCCCTACACT | ATGAAGTAACCACCCAGCGT | 118 |
| DMGDH | AAGGAGCTGTTTGAGTCGGA | TGGTCCAGACACGATGTTGA | 111 |
| CYP1A1 | AGCAAACCTTACCTGAGCCT | CCTGCAAACTCATCCCCTTG | 146 |
| GLUL | AGAAGTGATGCCTGCTCAGT | AGGGATTGGTTTGGGGTCAA | 148 |
| PRMT1 | GGTGACCATCATCAAGGGGA | GTTTCAGCCACTTGTCCCTG | 146 |
| GADL1 | TGTACATGGTGTCGGCTGAT | TCCAAGCACTGTAGTCCCTG | 131 |
| CANX | AAAGCCAAACATCACGCCAT | CAGTTTGACGTAGGCACCAC | 129 |
| TYR | GCCACTCAAGGAACAGCTTC | AGTGGGGAGGTGAGACATG | 131 |
| VCP | GACCAGACATCATCGACCCT | CTTGCTGATGGGACTCTTGC | 131 |
| Sample | Raw Reads | Raw Data (bp) | Clean Reads | Clean Data (bp) | Q20 (%) | Q30 (%) | GC (%) |
|---|---|---|---|---|---|---|---|
| LC-1 | 52,626,702 | 7,894,005,300 | 52,508,094 | 7,843,274,809 | 97.78 | 93.31 | 51.46 |
| LC-2 | 53,981,850 | 8,097,277,500 | 53,860,000 | 8,046,760,233 | 97.75 | 93.26 | 51.08 |
| LC-3 | 50,412,392 | 7,561,858,800 | 50,294,396 | 7,512,580,622 | 97.76 | 93.26 | 51.21 |
| LM-1 | 50,056,706 | 7,508,505,900 | 49,939,602 | 7,458,492,045 | 97.85 | 93.49 | 50.80 |
| LM-2 | 45,741,048 | 6,861,157,200 | 45,626,710 | 6,816,994,220 | 97.65 | 93.04 | 51.16 |
| LM-3 | 48,930,144 | 7,339,521,600 | 48,814,618 | 7,290,965,392 | 97.79 | 93.34 | 51.08 |
| LH-1 | 59,278,412 | 8,891,761,800 | 59,081,540 | 8,841,451,505 | 98.19 | 94.64 | 51.51 |
| LH-2 | 53,104,482 | 7,965,672,300 | 52,962,484 | 7,914,830,626 | 97.46 | 92.59 | 51.05 |
| LH-3 | 52,079,812 | 7,811,971,800 | 51,951,912 | 7,766,147,368 | 97.75 | 93.19 | 51.32 |
| Sample | High Quality Clean Reads | Unmapped (%) | Unique_Mapped (%) | Multiple_Mapped (%) | Total_Mapped (%) |
|---|---|---|---|---|---|
| LC-1 | 52,479,326 | 3,676,310 (7.01%) | 46,224,285 (88.08%) | 2,578,731 (4.91%) | 48,803,016 (92.99%) |
| LC-2 | 53,819,202 | 3,614,444 (6.72%) | 47,599,680 (88.44%) | 2,605,078 (4.84%) | 50,204,758 (93.28%) |
| LC-3 | 50,262,718 | 3,448,641 (6.86%) | 44,418,126 (88.37%) | 2,395,951 (4.77%) | 46,814,077 (93.14%) |
| LM-1 | 49,902,958 | 3,568,531 (7.15%) | 44,238,011 (88.65%) | 2,096,416 (4.20%) | 46,334,427 (92.85%) |
| LM-2 | 45,597,328 | 3,339,138 (7.32%) | 40,250,550 (88.27%) | 2,007,640 (4.40%) | 42,258,190 (92.68%) |
| LM-3 | 48,784,062 | 3,632,330 (7.45%) | 42,888,098 (87.91%) | 2,263,634 (4.64%) | 45,151,732 (92.55%) |
| LH-1 | 59,043,668 | 4,049,939 (6.86%) | 52,098,221 (88.24%) | 2,895,508 (4.90%) | 54,993,729 (93.14%) |
| LH-2 | 52,923,028 | 3,708,476 (7.01%) | 46,991,375 (88.79%) | 2,223,177 (4.20%) | 49,214,552 (92.99%) |
| LH-3 | 51,919,222 | 3,451,625 (6.65%) | 46,075,841 (88.75%) | 2,391,756 (4.61%) | 48,467,597 (93.35%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, J.; Liu, X.; Dai, J.; Niu, S.; Wang, X.; Tang, B. Transcriptomic Analysis of Trachinotus ovatus Under Flow Velocity Stress. Animals 2025, 15, 1932. https://doi.org/10.3390/ani15131932
Zhang J, Liu X, Dai J, Niu S, Wang X, Tang B. Transcriptomic Analysis of Trachinotus ovatus Under Flow Velocity Stress. Animals. 2025; 15(13):1932. https://doi.org/10.3390/ani15131932
Chicago/Turabian StyleZhang, Jing, Xixi Liu, Jiayue Dai, Sufang Niu, Xuefeng Wang, and Baogui Tang. 2025. "Transcriptomic Analysis of Trachinotus ovatus Under Flow Velocity Stress" Animals 15, no. 13: 1932. https://doi.org/10.3390/ani15131932
APA StyleZhang, J., Liu, X., Dai, J., Niu, S., Wang, X., & Tang, B. (2025). Transcriptomic Analysis of Trachinotus ovatus Under Flow Velocity Stress. Animals, 15(13), 1932. https://doi.org/10.3390/ani15131932

