Generation of Codon-Optimized Fad3 Gene Transgenic Bovine That Produce More n-3 Polyunsaturated Fatty Acids
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Cell Primary Culture
2.3. Cell Transfection
2.4. DNA Extraction
2.5. RNA Extraction and Reversal
2.6. Preparation of Fad3 Transgenic Cattle
2.7. PUFA Analysis
2.8. Statistical Analysis
3. Results
3.1. Humanization of the Fad3 Gene
3.2. Vector Construction of the Fad3 Gene
3.3. Fad3 Vector Transfection and Screening of Positive Cells
3.4. Generation of Fad3 Transgenic Cattle
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Birch, E.E.; Garfield, S.; Castañeda, Y.; Hughbanks-Wheaton, D.; Uauy, R.; Hoffman, D. Visual acuity and cognitive outcomes at 4 years of age in a double-blind, randomized trial of long-chain polyunsaturated fatty acid-supplemented infant formula. Early. Hum. Dev. 2007, 83, 279–284. [Google Scholar] [CrossRef]
- Lee, J.M.; Lee, H.; Kang, S.; Park, W. Fatty Acid Desaturases, Polyunsaturated Fatty Acid Regulation, and Biotechnological Advances. Nutrients 2016, 8, 23. [Google Scholar] [CrossRef]
- Goodnight, S.H.; Harris, W.S.; Connor, W.E.; Illingworth, D.R. Polyunsaturated fatty acids, hyperlipidemia, and thrombosis. Arteriosclerosis 1982, 2, 87–113. [Google Scholar] [CrossRef] [PubMed]
- Neylan, K.A. Evaluating Schizochytrium Sp. As an Alternative Ingredient in Fish-Free Feeds for Sablefish (Anoplopoma fimbria). Aquaculture 2024, 578, 740000. [Google Scholar] [CrossRef]
- Mariamenatu, A.H.; Abdu, E.M. Overconsumption of Omega-6 Polyunsaturated Fatty Acids (PUFAs) versus Deficiency of Omega-3 PUFAs in Modern-Day Diets: The Disturbing Factor for Their “Balanced Antagonistic Metabolic Functions” in the Human Body. J. Lipids 2021, 2021, 8848161. [Google Scholar] [CrossRef]
- Subbaiah, P.V.; Dammanahalli, K.J.; Yang, P.; Bi, J.; O’Donnell, J.M. Enhanced incorporation of dietary DHA into lymph phospholipids by altering its molecular carrier. Biochim. Biophys. Acta 2016, 1861, 723–729. [Google Scholar] [CrossRef]
- Zaloga, G.P. Narrative Review of n-3 Polyunsaturated Fatty Acid Supplementation upon Immune Functions, Resolution Molecules and Lipid Peroxidation. Nutrients 2021, 13, 662. [Google Scholar] [CrossRef]
- Simopoulos, A.P. The importance of the ratio of omega-6/omega-3 essential fatty acids. Biomed. Pharmacother. 2002, 56, 365–379. [Google Scholar] [CrossRef] [PubMed]
- Crawford, M.A.; Sinclair, A.J.; Hall, B.; Ogundipe, E.; Wang, Y.; Bitsanis, D.; Djahanbakhch, O.B.; Harbige, L.; Ghebremeskel, K.; Golfetto, I.; et al. The imperative of arachidonic acid in early human development. Prog. Lipid. Res. 2023, 91, 101222. [Google Scholar] [CrossRef] [PubMed]
- Thambugala, D.; Cloutier, S. Fatty acid composition and desaturase gene expression in flax (Linum usitatissimum L.). J. Appl. Genet. 2014, 55, 423–432. [Google Scholar] [CrossRef]
- Kang, J.X.; Wang, J.; Wu, L.; Kang, Z.B. Transgenic mice: Fat-1 mice convert n-6 to n-3 fatty acids. Nature 2004, 427, 504. [Google Scholar] [CrossRef]
- Li, M.; Ouyang, H.; Yuan, H.; Li, J.; Xie, Z.; Wang, K.; Yu, T.; Liu, M.; Chen, X.; Tang, X.; et al. Site-Specific Fat-1 Knock-In Enables Significant Decrease of n-6PUFAs/n-3PUFAs Ratio in Pigs. G3 2018, 8, 1747–1754. [Google Scholar] [CrossRef]
- Tang, F.; Yang, X.; Liu, D.; Zhang, X.; Huang, X.; He, X.; Shi, J.; Li, Z.; Wu, Z. Co-expression of fat1 and fat2 in transgenic pigs promotes synthesis of polyunsaturated fatty acids. Transgenic Res. 2019, 28, 369–379. [Google Scholar] [CrossRef] [PubMed]
- Nowak, J.; Weylandt, K.H.; Habbel, P.; Wang, J.; Dignass, A.; Glickman, J.N.; Kang, J.X. Colitis-associated colon tumorigenesis is suppressed in transgenic mice rich in endogenous n-3 fatty acids. Carcinogenesis 2007, 28, 1991–1995. [Google Scholar] [CrossRef]
- Li, J.; Li, K.; Gao, J.; Lu, M.; Li, Z.; Li, D. Endogenously Synthesized n-3 Polyunsaturated Fatty Acids in Pregnant fat-1 Mice Decreases Mammary Cancer Risk of Female Offspring by Regulating Expression of Long Noncoding RNAs. Mol. Nutr. Food. Res. 2019, 63, e1801150. [Google Scholar] [CrossRef] [PubMed]
- Yu, Q.; Wang, T.; Wang, F.; Yang, Y.; He, C.; Yang, W.; Zhang, J.; Zou, Z. High n-3 fatty acids counteract hyperglycemia-induced insulin resistance in fat-1 mice via pre-adipocyte NLRP3 inflammasome inhibition. Food. Funct. 2021, 12, 230–240. [Google Scholar] [CrossRef] [PubMed]
- Rohwer, N.; Jelleschitz, J.; Höhn, A.; Weber, D.; Kühl, A.A.; Wang, C.; Ohno, R.I.; Kampschulte, N.; Pietzner, A.; Schebb, N.H.; et al. Prevention of colitis-induced liver oxidative stress and inflammation in a transgenic mouse model with increased omega-3 polyunsaturated fatty acids. Redox. Biol. 2023, 64, 102803. [Google Scholar] [CrossRef] [PubMed]
- Xu, Q.; Zhang, Z.; Tang, M.; Xing, C.; Chen, H.; Zheng, K.; Zhao, Z.; Zhou, S.; Zhao, A.Z.; Li, F.; et al. Endogenous production of ω-3 polyunsaturated fatty acids mitigates cisplatin-induced myelosuppression by regulating NRF2-MDM2-p53 signaling pathway. Free. Radic. Biol. Med. 2023, 201, 14–25. [Google Scholar] [CrossRef] [PubMed]
- Roškarić, P.; Šperanda, M.; Mašek, T.; Verbanac, D.; Starčević, K. Low Dietary n6/n3 Ratio Attenuates Changes in the NRF 2 Gene Expression, Lipid Peroxidation, and Inflammatory Markers Induced by Fructose Overconsumption in the Rat Abdominal Adipose Tissue. Antioxidants 2021, 10, 2005. [Google Scholar] [CrossRef]
- Sun, S.; Castro, F.; Monroig, Ó.; Cao, X.; Gao, J. fat-1 transgenic zebrafish are protected from abnormal lipid deposition induced by high-vegetable oil feeding. Appl. Microbiol. Biotechnol. 2020, 104, 7355–7365. [Google Scholar] [CrossRef] [PubMed]
- Starčević, K.; Filipović, N.; Galan, A.; Micek, V.; Gudan, K.A.; Mašek, T. Hepatic Lipogenesis and Brain Fatty Acid Profile in Response to Different Dietary n6/n3 Ratios and DHA/EPA Supplementation in Streptozotocin Treated Rats. Mol. Nutr. Food. Res. 2018, 62, e1701007. [Google Scholar] [CrossRef] [PubMed]
- Duan, B.; Cheng, L.; Gao, Y.; Yin, F.X.; Su, G.H.; Shen, Q.Y.; Liu, K.; Hu, X.; Liu, X.; Li, G.P. Silencing of fat-1 transgene expression in sheep may result from hypermethylation of its driven cytomegalovirus (CMV) promoter. Theriogenology 2012, 78, 793–802. [Google Scholar] [CrossRef]
- Liu, X.F.; Wei, Z.Y.; Bai, C.L.; Ding, X.B.; Li, X.; Su, G.H.; Cheng, L.; Zhang, L.; Guo, H.; Li, G.P. Insights into the function of n-3 PUFAs in fat-1 transgenic cattle. J. Lipid Res. 2017, 58, 1524–1535. [Google Scholar] [CrossRef]
- Song, L.; Yang, L.; Wang, J.; Liu, X.; Bai, L.; Di, A.; Li, G. Generation of Fad2 and Fad3 transgenic mice that produce n-6 and n-3 polyunsaturated fatty acids. Open Biol. 2019, 9, 190140. [Google Scholar] [CrossRef]
- Su, G.; Wang, L.; Gao, G.; Wu, S.; Yang, L.; Wu, M.; Liu, X.; Yang, M.; Wei, Z.; Bai, C.; et al. C23 gene regulates the nucleolin structure and biosynthesis of ribosomes in bovine intraspecific and interspecific somatic cell nuclear transfer embryos. FASEB J. 2021, 35, e21993. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.; Liu, Q.; Wu, Z.; Wang, Z.; Gou, K. Generation of fad2 transgenic mice that produce omega-6 fatty acids. Sci. China Life Sci. 2009, 52, 1048–1054. [Google Scholar] [CrossRef]
- Mokoena, N.Z.; Sebolai, O.M.; Albertyn, J.; Pohl, C.H. Synthesis and function of fatty acids and oxylipins, with a focus on Caenorhabditis elegans. Prostaglandins Other Lipid. Mediat. 2020, 148, 106426. [Google Scholar] [CrossRef]
- Kvavadze, E.; Bar-Yosef, O.; Belfer-Cohen, A.; Boaretto, E.; Jakeli, N.; Matskevich, Z.; Meshveliani, T. 30,000-year-old wild flax fibers. Science 2009, 325, 1359. [Google Scholar] [CrossRef] [PubMed]
- Kang, Z.B.; Ge, Y.; Chen, Z.; Cluette-Brown, J.; Laposata, M.; Leaf, A.; Kang, J.X. Adenoviral gene transfer of Caenorhabditis elegans n--3 fatty acid desaturase optimizes fatty acid composition in mammalian cells. Proc. Natl. Acad. Sci. USA 2001, 98, 4050–4054. [Google Scholar] [CrossRef] [PubMed]
- Romanatto, T.; Fiamoncini, J.; Wang, B.; Curi, R.; Kang, J.X. Elevated tissue omega-3 fatty acid status prevents age-related glucose intolerance in fat-1 transgenic mice. Biochim. Biophys. Acta 2014, 1842, 186–191. [Google Scholar] [CrossRef] [PubMed]
- Bidu, C.; Escoula, Q.; Bellenger, S.; Spor, A.; Galan, M.; Geissler, A.; Bouchot, A.; Dardevet, D.; Morio, B.; Cani, P.D.; et al. The Transplantation of ω3 PUFA-Altered Gut Microbiota of fat-1 Mice to Wild-Type Littermates Prevents Obesity and Associated Metabolic Disorders. Diabetes 2018, 67, 1512–1523. [Google Scholar] [CrossRef] [PubMed]
- Boyle, K.E.; Magill-Collins, M.J.; Newsom, S.A.; Janssen, R.C.; Friedman, J.E. Maternal Fat-1 Transgene Protects Offspring from Excess Weight Gain, Oxidative Stress, and Reduced Fatty Acid Oxidation in Response to High-Fat Diet. Nutrients 2020, 12, 767. [Google Scholar] [CrossRef]
- Mao, S.; Ma, H.; Chen, P.; Liang, Y.; Zhang, M.; Hinek, A. Fat-1 transgenic mice rich in endogenous omega-3 fatty acids are protected from lipopolysaccharide-induced cardiac dysfunction. ESC Heart Fail. 2021, 8, 1966–1978. [Google Scholar] [CrossRef]
- Yan, L.; Gu, M.Q.; Yang, Z.Y.; Xia, J.; Li, P.; Vasar, E.; Tian, L.; Song, C. Endogenous n-3 PUFAs attenuated olfactory bulbectomy-induced behavioral and metabolomic abnormalities in Fat-1 mice. Brain. Behav. Immun. 2021, 96, 143–153. [Google Scholar] [CrossRef] [PubMed]
- Lai, L.; Kang, J.X.; Li, R.; Wang, J.; Witt, W.T.; Yong, H.Y.; Hao, Y.; Wax, D.M.; Murphy, C.N.; Rieke, A.; et al. Generation of cloned transgenic pigs rich in omega-3 fatty acids. Nat. Biotechnol. 2006, 24, 435–436. [Google Scholar] [CrossRef] [PubMed]
- You, W.; Li, M.; Qi, Y.; Wang, Y.; Chen, Y.; Liu, Y.; Li, L.; Ouyang, H.; Pang, D. CRISPR/Cas9-Mediated Specific Integration of Fat-1 and IGF-1 at the pRosa26 Locus. Genes 2021, 12, 1027. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Ouyang, H.; Duan, B.; Pang, D.; Zhang, L.; Yuan, T.; Xue, L.; Ni, D.; Cheng, L.; Dong, S.; et al. Production of cloned transgenic cow expressing omega-3 fatty acids. Transgenic Res. 2012, 21, 537–543. [Google Scholar] [CrossRef] [PubMed]
- Lv, Y.; Wang, Y.; Sun, J.; Gong, C.; Chen, Y.; Su, G.; Gao, G.; Bai, C.; Wei, Z.; Zhang, L.; et al. MicroRNA profiles of fibroblasts derived from in vivo fertilized and fat-1 transgenic cattle. Gene 2017, 636, 70–77. [Google Scholar] [CrossRef] [PubMed]
- Zhang, P.; Liu, P.; Dou, H.; Chen, L.; Chen, L.; Lin, L.; Tan, P.; Vajta, G.; Gao, J.; Du, Y.; et al. Handmade cloned transgenic sheep rich in omega-3 Fatty acids. PLoS ONE 2013, 8, e55941. [Google Scholar] [CrossRef]
- Yang, C.; Shang, X.; Cheng, L.; Yang, L.; Liu, X.; Bai, C.; Wei, Z.; Hua, J.; Li, G. DNMT 1 maintains hypermethylation of CAG promoter specific region and prevents expression of exogenous gene in fat-1 transgenic sheep. PLoS ONE 2017, 12, e0171442. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Cui, M.L.; Nie, Y.W.; Dai, B.; Li, F.R.; Liu, D.J.; Liang, H.; Cang, M. CRISPR/Cas9-mediated specific integration of fat-1 at the goat MSTN locus. FEBS J. 2018, 285, 2828–2839. [Google Scholar] [CrossRef] [PubMed]
- Luo, R.; Zheng, Z.; Yang, C.; Zhang, X.; Cheng, L.; Su, G.; Bai, C.; Li, G. Comparative Transcriptome Analysis Provides Insights into the Polyunsaturated Fatty Acid Synthesis Regulation of Fat-1 Transgenic Sheep. Int. J. Mol. Sci. 2020, 21, 1121. [Google Scholar] [CrossRef] [PubMed]
- Indo, Y.; Tatemizo, A.; Suzuki, I.; Abe, Y.; Matsumoto, K.; Hosoi, Y.; Kinoshita, M.; Mikami, K.; Murata, N.; Iritani, A. Elevated level of n 3 fatty acids in bovine adipocytes transfected with a humanized FAD3 gene from scarlet flax. Chem. Phys. Lipids 2007, 149, S80. [Google Scholar] [CrossRef]
- Wei, Z.; Li, D.; Zhu, L.; Yang, L.; Chen, C.; Bai, C.; Li, G. Omega 3 polyunsaturated fatty acids inhibit cell proliferation by regulating cell cycle in fad3b transgenic mouse embryonic stem cells. Lipids Health Dis. 2018, 17, 210. [Google Scholar] [CrossRef]
- Chen, Y.; Mei, M.; Zhang, P.; Ma, K.; Song, G.; Ma, X.; Zhao, T.; Tang, B.; Ouyang, H.; Li, G.; et al. The generation of transgenic mice with fat1 and fad2 genes that have their own polyunsaturated fatty acid biosynthetic pathway. Cell. Physiol. Biochem. 2013, 32, 523–532. [Google Scholar] [CrossRef] [PubMed]
- Kami, D.; Gojo, S. Tuning cell fate: From insights to vertebrate regeneration. Organogenesis 2014, 10, 231–240. [Google Scholar] [CrossRef]
- Halley-Stott, R.P.; Pasque, V.; Gurdon, J.B. Nuclear reprogramming. Development 2013, 140, 2468–2471. [Google Scholar] [CrossRef] [PubMed]
- Matoba, S.; Zhang, Y. Somatic Cell Nuclear Transfer Reprogramming: Mechanisms and Applications. Cell Stem Cell 2018, 23, 471–485. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Liu, X.; Wang, C.; Gao, Y.; Gao, R.; Kou, X.; Zhao, Y.; Li, J.; Wu, Y.; Xiu, W.; et al. Identification of key factors conquering developmental arrest of somatic cell cloned embryos by combining embryo biopsy and single-cell sequencing. Cell Discov. 2016, 2, 16010. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Qu, J.; Li, J.; He, H.; Liu, Z.; Huan, Y. Epigenetic Reprogramming During Somatic Cell Nuclear Transfer: Recent Progress and Future Directions. Front. Genet. 2020, 11, 205. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.H.; Du, F.; Xu, J.; Chang, W.F.; Liu, C.C.; Su, H.Y.; Lin, T.A.; Ju, J.C.; Cheng, W.T.; Wu, S.C.; et al. Synergistic effect of trichostatin A and scriptaid on the development of cloned rabbit embryos. Theriogenology 2013, 79, 1284–1293. [Google Scholar] [CrossRef] [PubMed]
- Han, C.; Deng, R.; Mao, T.; Luo, Y.; Wei, B.; Meng, P.; Zhao, L.; Zhang, Q.; Quan, F.; Liu, J.; et al. Overexpression of Tet3 in donor cells enhances goat somatic cell nuclear transfer efficiency. FEBS J. 2018, 285, 2708–2723. [Google Scholar] [CrossRef] [PubMed]
- Matoba, S.; Wang, H.; Jiang, L.; Lu, F.; Iwabuchi, K.A.; Wu, X.; Inous, K.; Yang, L.; Press, W.; Lee, J.T.; et al. Loss of H3K27me3 Imprinting in Somatic Cell Nuclear Transfer Embryos Disrupts Post-Implantation Development. Cell Stem Cell 2018, 23, 343–354.e5. [Google Scholar] [CrossRef] [PubMed]
- Gao, R.; Wang, C.; Gao, Y.; Xiu, W.; Chen, J.; Kou, X.; Zhao, Y.; Liao, Y.; Bai, D.; Qiao, Z.; et al. Inhibition of Aberrant DNA Re-methylation Improves Post-implantation Development of Somatic Cell Nuclear Transfer Embryos. Cell Stem Cell 2018, 23, 426–435.e5. [Google Scholar] [CrossRef] [PubMed]
- Simmet, K.; Wolf, E.; Zakhartchenko, V. Manipulating the Epigenome in Nuclear Transfer Cloning: Where, When and How. Int. J. Mol. Sci. 2020, 22, 236. [Google Scholar] [CrossRef] [PubMed]
Site | Sequence | PAM Sequence | GC% |
---|---|---|---|
4844–4863 (F) | ACCACGATGAACCGAAAACT | CGG | 52% |
4851–4870 (F) | TGAACCGAAAACTCGGGTCA | AGG | 52% |
4347–4366 (F) | GAGCTGAACCACAAGACGTT | AGG | 52% |
4358–4377 (RC) | GGGTATGTCCTAACGTCTTG | TGG | 52% |
Gene Name | 5′-3′ Forward Primers | 5′-3′ Reverse Primers |
---|---|---|
Fad3 | AATGTGGAGAAGGATGAGTC | ATGTCGTGGTGGATGTTG |
Items | Cell | p Values | |
---|---|---|---|
PUFAs | Control (n = 3) | Positive (n = 3) | |
C18: 2n-6 | 1.40 ± 0.29 | 2.11 ± 0.09 * | 0.0306 |
C18: 3n-6 | 0.05 ± 0.05 | 1.05 ± 0.08 *** | 0.0001 |
C20: 4n-6 | 5.37 ± 0.31 | 3.48 ± 0.12 ** | 0.0014 |
n-6 total | 7.22 ± 0.15 | 6.42 ± 0.19 * | 0.0102 |
C18: 3n-3 | 0.52 ± 0.07 | 0.85 ± 0.10 * | 0.0190 |
C20: 5n-3 | 1.75 ± 0.22 | 2.05 ± 0.16 ns | 0.1928 |
C22: 6n-3 | 1.18 ± 0.16 | 1.63 ± 0.09 * | 0.0233 |
n-3 total | 3.257 ± 0.22 | 4.55 ± 0.27 * | 0.0065 |
n-6/n-3 | 2.26 ± 0.17 | 1.47 ± 0.09 ** | 0.0043 |
No. | No. of Cultured Oocytes | No. of Mature Oocytes (%) | No. of Nuclear Transfer Oocytes | No. of Fused Embryos (%) | No. of Activated Embryos | No. of Cleavage Embryos (%) | No. of Blastocysts (%) |
---|---|---|---|---|---|---|---|
1 | 305 | 242 (79.3) | 215 | 191 (88.9) | 180 | 142 (78.9) | 48 (26.7) |
2 | 361 | 260 (72.0) | 244 | 208 (85.2) | 196 | 170 (86.7) | 53 (27.0) |
3 | 372 | 261 (70.2) | 237 | 195 (82.3) | 185 | 155 (83.8) | 55 (29.7) |
4 | 353 | 257 (72.8) | 231 | 192 (83.5) | 184 | 139 (75.5) | 46 (25.0) |
Total | 1391 | 1020 (73.3) | 927 | 786 (84.8) | 745 | 606 (81.3) | 202 (27.1) |
No. | No. Blastocysts | No. Recipient Cattle | Pregnancy at 60 Days (%) | Pregnancy at 120 Days (%) | Pregnancy at 210 Days (%) | Birth (%) | Survival (%) |
---|---|---|---|---|---|---|---|
1 | 26 | 13 | 3 (23.1) | 2 (15.4) | 2 (15.4) | 2 (15.4) | 0 |
2 | 30 | 15 | 1 (6.7) | 0 | 0 | 0 | 0 |
3 | 28 | 14 | 4 (28.6) | 3 (21.4) | 1 (7.1) | 1 (7.1) | 1 (7.1) |
4 | 22 | 11 | 2 (18.2) | 2 (18.2) | 2 (9.5) | 2 (9.5) | 0 |
Total | 106 | 53 | 10 (18.8) | 7 (13.2) | 5 (9.4) | 5 (9.4) | 1 (1.9) |
Items | Cattle | p Value | |
---|---|---|---|
PUFAs | Control (n = 5) | Fad3 (n = 5) | |
C18: 2n-6t | 32.34 ± 3.93 | 71.262 ± 2.57 *** | 0.0000 |
C18: 2n-6c | 3.502 ± 0.43 | 6.02 ± 1.66 * | 0.0350 |
C18: 3n-6 | 1.304 ± 0.38 | 9.146 ± 2.20 *** | 0.0005 |
C20: 4n-6 | 5.94 ± 0.32 | 68.284 ± 1.91 *** | 0.0000 |
n-6 total | 44.292 ± 2.97 | 154.712 ± 5.53 *** | 0.0000 |
C20: 3n-3 | 3.62 ± 0.42 | 34.096 ± 1.90 *** | 0.0000 |
C20: 5n-3 | 5.22 ± 0.32 | 7.198 ± 1.10 *** | 0.0128 |
C22: 6n-3 | 5.36 ± 0.73 | 15.638 ± 2.27 *** | 0.0001 |
n-3 total | 15.016 ± 1.37 | 55.932 ± 4.53 *** | 0.0000 |
n-6/n-3 | 3.484 ± 0.46 | 2.78 ± 0.14 * | 0.0427 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Su, G.; Wei, Z.; Bai, C.; Li, D.; Zhao, X.; Liu, X.; Song, L.; Zhang, L.; Li, G.; Yang, L. Generation of Codon-Optimized Fad3 Gene Transgenic Bovine That Produce More n-3 Polyunsaturated Fatty Acids. Animals 2025, 15, 93. https://doi.org/10.3390/ani15010093
Su G, Wei Z, Bai C, Li D, Zhao X, Liu X, Song L, Zhang L, Li G, Yang L. Generation of Codon-Optimized Fad3 Gene Transgenic Bovine That Produce More n-3 Polyunsaturated Fatty Acids. Animals. 2025; 15(1):93. https://doi.org/10.3390/ani15010093
Chicago/Turabian StyleSu, Guanghua, Zhuying Wei, Chunling Bai, Danyi Li, Xiaoyu Zhao, Xuefei Liu, Lishuang Song, Li Zhang, Guangpeng Li, and Lei Yang. 2025. "Generation of Codon-Optimized Fad3 Gene Transgenic Bovine That Produce More n-3 Polyunsaturated Fatty Acids" Animals 15, no. 1: 93. https://doi.org/10.3390/ani15010093
APA StyleSu, G., Wei, Z., Bai, C., Li, D., Zhao, X., Liu, X., Song, L., Zhang, L., Li, G., & Yang, L. (2025). Generation of Codon-Optimized Fad3 Gene Transgenic Bovine That Produce More n-3 Polyunsaturated Fatty Acids. Animals, 15(1), 93. https://doi.org/10.3390/ani15010093