Kaempferol and Vitamin E Improve Production Performance by Linking the Gut–Uterus Axis Through the Reproductive Hormones and Microbiota of Late-Laying Hens
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Moral Statement
2.2. Birds, Experimental Design, and Management
2.3. Sample Collection
2.4. Determination of Egg Quality Parameters
2.5. Serum Reproductive Hormone Determination
2.6. RNA Extraction and Quantitative PCR
2.7. 16S rRNA Sequencing to Analyze the Microbiota Structure of Cecum Contents and Uterus Mucus
2.8. Statistical Analysis
3. Results
3.1. Production Performance
3.2. Egg Quality
3.3. Serum Reproductive Hormones
3.4. Reproductive Hormone Receptor Gene Expression Levels
3.5. Cecum Microbiota
3.6. Uterus Microbiota
4. Discussion
4.1. Effects of KAE and VE on Egg Laying Performance and Egg Quality in Late-Laying Hens
4.2. Effects of KAE and VE on the Expression of Reproductive Hormones and Receptors in Late-Laying Hens
4.3. Effects of KAE and VE on Cecal Microbiota in Late-Laying Hens
4.4. Effects of KAE and VE on the Uterus Microbiota in Late-Laying Hens
4.5. Effects of KAE and VE on the Gut–Uterus Axis in Late-Laying Hens
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Amevor, F.K.; Cui, Z.; Ning, Z.; Du, X.; Jin, N.; Shu, G.; Deng, X.; Zhu, Q.; Tian, Y.; Li, D.; et al. Synergistic effects of quercetin and vitamin E on egg production, egg quality, and immunity in aging breeder hens. Poult. Sci. 2021, 100, 101481. [Google Scholar] [CrossRef]
- Su, Y.; Tian, S.; Li, D.; Zhu, W.; Wang, T.; Mishra, S.K.; Wei, R.; Xu, Z.; He, M.; Zhao, X.; et al. Association of female reproductive tract microbiota with egg production in layer chickens. Gigascience 2021, 10, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Cryan, J.F.; O’Riordan, K.J.; Cowan, C.S.M.; Sandhu, K.V.; Bastiaanssen, T.F.S.; Boehme, M.; Codagnone, M.G.; Cussotto, S.; Fulling, C.; Golubeva, A.V.; et al. The Microbiota-Gut-Brain Axis. Physiol. Rev. 2019, 99, 1877–2013. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Zhong, H.; Huang, Z.; Chen, X.; You, J.; Zou, T. A Critical Review of Kaempferol in Intestinal Health and Diseases. Antioxidants 2023, 12, 1642. [Google Scholar] [CrossRef]
- Yani, S.; Opik, T.; Siti, R.; Ida, K.; Epa, P. In silico analysis of kaempferol as a competitor of estrogen on estrogen receptor alpha of endometrial cancer. J. Phys. Conf. Ser. 2019, 1402, 066109. [Google Scholar] [CrossRef]
- Becker, E.M.; Ntouma, G.; Skibsted, L.H. Synergism and antagonism between quercetin and other chain-breaking antioxidants in lipid systems of increasing structural organisation. J. Food Chem. 2006, 103, 1288–1296. [Google Scholar] [CrossRef]
- Ferri, P.; Angelino, D.; Gennari, L.; Benedetti, S.; Ambrogini, P.; Del Grande, P.; Ninfali, P. Enhancement of flavonoid ability to cross the blood-brain barrier of rats by co-administration with α-tocopherol. Food Funct. 2015, 6, 394–400. [Google Scholar] [CrossRef]
- Sohn, H.Y.; Son, K.H.; Kwon, C.S.; Kwon, G.S.; Kang, S.S. Antimicrobial and cytotoxic activity of 18 prenylated flavonoids isolated from medicinal plants: Morus alba L., Morus mongolica Schneider, Broussnetia papyrifera (L.) Vent, Sophora flavescens Ait and Echinosophora koreensis Nakai. Phytomedicine 2004, 11, 666–672. [Google Scholar] [CrossRef] [PubMed]
- Sahin, N.; Sahin, K.; Onderci, M. Vitamin E and selenium supplementation to alleviate cold-stress-associated deterioration in egg quality and egg yolk mineral concentrations of Japanese quails. Biol. Trace Elem. Res. 2003, 96, 179–189. [Google Scholar] [CrossRef]
- Shu, G.; Kong, F.; Xu, D.; Yin, L.; He, C.; Lin, J.; Fu, H.; Wang, K.; Tian, Y.; Zhao, X. Bamboo leaf flavone changed the community of cecum microbiota and improved the immune function in broilers. Sci. Rep. 2020, 10, 12324. [Google Scholar] [CrossRef]
- Zhao, L.; Zhang, Q.; Ma, W.; Tian, F.; Shen, H.; Zhou, M. A combination of quercetin and resveratrol reduces obesity in high-fat diet-fed rats by modulation of gut microbiota. Food Funct. 2017, 8, 4644–4656. [Google Scholar] [CrossRef]
- Mitsuzane, R.; Okubo, R.; Nishikawa, M.; Ikushiro, S.; Munemasa, S.; Murata, Y.; Nakamura, Y.; Nakamura, T. Enhancing effect of the coexisting alpha-tocopherol on quercetin absorption and metabolism. Free Radic. Res. 2024, 58, 88–97. [Google Scholar] [CrossRef] [PubMed]
- Jafari Khorchani, M.; Samare-Najaf, M.; Abbasi, A.; Vakili, S.; Zal, F. Effects of quercetin, vitamin E, and estrogen on Metabolic-Related factors in uterus and serum of ovariectomized rat models. Gynecol. Endocrinol. 2021, 37, 764–768. [Google Scholar] [CrossRef] [PubMed]
- Pirgozliev, V.R.; Mansbridge, S.C.; Westbrook, C.A.; Woods, S.L.; Rose, S.P.; Whiting, I.M.; Yovchev, D.G.; Atanasov, A.G.; Kljak, K.; Staykova, G.P.; et al. Feeding dihydroquercetin and vitamin E to broiler chickens reared at standard and high ambient temperatures. Arch. Anim. Nutr. 2020, 74, 496–511. [Google Scholar] [CrossRef] [PubMed]
- Amevor, F.K.; Cui, Z.; Du, X.; Ning, Z.; Shu, G.; Jin, N.; Deng, X.; Tian, Y.; Zhang, Z.; Kang, X.; et al. Combination of Quercetin and Vitamin E Supplementation Promotes Yolk Precursor Synthesis and Follicle Development in Aging Breeder Hens via Liver-Blood-Ovary Signal Axis. Animals 2021, 11, 1915. [Google Scholar] [CrossRef] [PubMed]
- Amevor, F.K.; Cui, Z.; Du, X.; Feng, J.; Shu, G.; Ning, Z.; Xu, D.; Deng, X.; Song, W.; Wu, Y.; et al. Synergy of Dietary Quercetin and Vitamin E Improves Cecal Microbiota and Its Metabolite Profile in Aged Breeder Hens. Front. Microbiol. 2022, 13, 851459. [Google Scholar] [CrossRef] [PubMed]
- Jiang, W.; Zhang, L.; Shan, A. The effect of vitamin E on laying performance and egg quality in laying hens fed corn dried distillers grains with solubles. Poult. Sci. 2013, 92, 2956–2964. [Google Scholar] [CrossRef] [PubMed]
- NY/T 33-2004; Chicken Feeding Standards. Ministry of Agriculture and Rural Affairs: Beijing, China, 2004.
- NY/T 823-2004; Poultry Production Performance Terminology and Measurement Calculation Method. Ministry of Agriculture and Rural Affairs: Beijing, China, 2004.
- Harshitha, R.; Arunraj, D.R. Real-time quantitative PCR: A tool for absolute and relative quantification. Biochem. Mol. Biol. Educ. 2021, 49, 800–812. [Google Scholar] [CrossRef] [PubMed]
- Patra, S.; Gorai, S.; Pal, S.; Ghosh, K.; Pradhan, S.; Chakrabarti, S. A review on phytoestrogens: Current status and future direction. Phytother. Res. 2023, 37, 3097–3120. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Ding, X.M.; Bai, S.P.; Wang, J.P.; Zeng, Q.F.; Peng, H.W.; Xuan, Y.; Su, Z.W.; Zhang, K.Y. Effects of dietary vitamin E supplementation on laying performance, hatchability, and antioxidant status in molted broiler breeder hens. J. Appl. Poult. Res. 2021, 30, 100184. [Google Scholar] [CrossRef]
- Xiaodi, E.; Shao, D.; Li, M.; Shi, S.; Xiao, Y. Supplemental dietary genistein improves the laying performance and antioxidant capacity of Hy-Line brown hens during the late laying period. Poult. Sci. 2023, 102, 102573. [Google Scholar] [CrossRef]
- Liu, Y.; Li, Y.; Liu, H.N.; Suo, Y.L.; Hu, L.L.; Feng, X.A.; Zhang, L.; Jin, F. Effect of quercetin on performance and egg quality during the late laying period of hens. Br. Poult. Sci. 2013, 54, 510–514. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Zhong, G.; Gu, W.; Yin, N.; Chen, L.; Shi, S. Dietary supplementation with daidzein and Chinese herbs, independently and combined, improves laying performance, egg quality and plasma hormone levels of post-peak laying hens. Poult. Sci. 2021, 100, 101115. [Google Scholar] [CrossRef] [PubMed]
- Maini, S.; Rastogi, S.K.; Korde, J.P.; Madan, A.K.; Shukla, S.K. Evaluation of Oxidative Stress and its Amelioration through Certain Antioxidants in Broilers during Summer. J. Poult. Sci. 2007, 44, 339–347. [Google Scholar] [CrossRef]
- Bollengier-Lee, S.; Mitchell, M.A.; Utomo, D.B.; Williams, P.E.; Whitehead, C.C. Influence of high dietary vitamin E supplementation on egg production and plasma characteristics in hens subjected to heat stress. Br. Poult. Sci. 1998, 39, 106–112. [Google Scholar] [CrossRef]
- Jiang, Y.H.; McGeachin, R.B.; Bailey, C.A. Alpha-tocopherol, beta-carotene, and retinol enrichment of chicken eggs. Poult. Sci. 1994, 73, 1137–1143. [Google Scholar] [CrossRef]
- Saleh, A.A.; Ahmed, E.A.M.; Ebeid, T.A. The impact of phytoestrogen source supplementation on reproductive performance, plasma profile, yolk fatty acids and antioxidative status in aged laying hens. Reprod. Domest. Anim. 2019, 54, 846–854. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Zhou, J.; Schroyen, M.; Zhang, H.; Wu, S.; Qi, G.; Wang, J. Decreased eggshell strength caused by impairment of uterine calcium transport coincide with higher bone minerals and quality in aged laying hens. J. Anim. Sci. Biotechnol. 2024, 15, 37. [Google Scholar] [CrossRef]
- Huang, Z.; Dai, H.; Jiang, J.; Ye, N.; Zhu, S.; Wei, Q.; Lv, Z.; Shi, F. Dietary mulberry-leaf flavonoids improve the eggshell quality of aged breeder hens. Theriogenology 2022, 179, 177–186. [Google Scholar] [CrossRef]
- Miljeteig, C.; Gabrielsen, G.W.; Strøm, H.; Gavrilo, M.V.; Lie, E.; Jenssen, B.M. Eggshell thinning and decreased concentrations of vitamin E are associated with contaminants in eggs of ivory gulls. Sci. Total Environ. 2012, 431, 92–99. [Google Scholar] [CrossRef]
- Haoran, Z.; Yueping, C.; Shiqi, W.; Chao, W.; Yanmin, Z. Effects of dietary natural vitamin E supplementation on laying performance, egg quality, serum biochemical indices, tocopherol deposition and antioxidant capacity of laying hens %J Italian Journal of Animal Science. Ital. J. Anim. Sci. 2021, 20, 2254–2262. [Google Scholar] [CrossRef]
- Alagawany, M.; Elnesr, S.S.; Farag, M.R.; Tiwari, R.; Yatoo, M.I.; Karthik, K.; Michalak, I.; Dhama, K. Nutritional significance of amino acids, vitamins and minerals as nutraceuticals in poultry production and health—A comprehensive review. Vet. Q. 2020, 41, 1–29. [Google Scholar] [CrossRef]
- Cui, Z.; Amevor, F.K.; Feng, Q.; Kang, X.; Song, W.; Zhu, Q.; Wang, Y.; Li, D.; Zhao, X. Sexual Maturity Promotes Yolk Precursor Synthesis and Follicle Development in Hens via Liver-Blood-Ovary Signal Axis. Animals 2020, 10, 2348. [Google Scholar] [CrossRef] [PubMed]
- Critchlow, A.J.; Hiam, D.; Williams, R.; Scott, D.; Lamon, S. The role of estrogen in female skeletal muscle aging: A systematic review. Maturitas 2023, 178, 107844. [Google Scholar] [CrossRef] [PubMed]
- Cui, Y.M.; Wang, J.; Hai-Jun, Z.; Feng, J.; Wu, S.G.; Qi, G.H. Effect of photoperiod on ovarian morphology, reproductive hormone secretion, and hormone receptor mRNA expression in layer ducks during the pullet phase. Poult. Sci. 2019, 98, 2439–2447. [Google Scholar] [CrossRef]
- Long, C.; Wang, J.; Zhang, H.J.; Wu, S.G.; Qi, G.H. Effects of dietary rapeseed meal supplementation on cecal microbiota in laying hens with different flavin-containing monooxygenase 3 genotypes. Poult. Sci. 2017, 96, 1748–1758. [Google Scholar] [CrossRef] [PubMed]
- Yin, Z.Z.; Dong, X.Y.; Cao, H.Y.; Mao, H.G.; Ma, Y.Z. Effects of rearing systems on reproductive hormones secretion and their receptors gene expression in Xianju chickens under summer conditions. Poult. Sci. 2018, 97, 3092–3096. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Shimada, K.; Saito, N.; Kansaku, N. Expression of messenger ribonucleic acids of luteinizing hormone and follicle-stimulating hormone receptors in granulosa and theca layers of chicken preovulatory follicles. Gen. Comp. Endocrinol. 1997, 105, 402–409. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Z.; Wu, J.; Liu, Y.; Zhuang, Y.; Yan, H.; Xiao, M.; Zhang, L.; An, L. Dietary Canthaxanthin Supplementation Promotes the Laying Rate and Follicular Development of Huaixiang Hens. Biology 2023, 12, 1375. [Google Scholar] [CrossRef]
- Dai, D.; Qi, G.H.; Wang, J.; Zhang, H.J.; Qiu, K.; Wu, S.G. Intestinal microbiota of layer hens and its association with egg quality and safety. Poult. Sci. 2022, 101, 102008. [Google Scholar] [CrossRef] [PubMed]
- Hou, Q.; Huang, J.; Zhao, L.; Pan, X.; Liao, C.; Jiang, Q.; Lei, J.; Guo, F.; Cui, J.; Guo, Y.; et al. Dietary genistein increases microbiota-derived short chain fatty acid levels, modulates homeostasis of the aging gut, and extends healthspan and lifespan. Pharmacol. Res. 2023, 188, 106676. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Xu, G.; Dong, Y.; Li, M.; Yang, L.; Lu, W. Quercetin Protects Against Lipopolysaccharide-Induced Intestinal Oxidative Stress in Broiler Chickens through Activation of Nrf2 Pathway. Molecules 2020, 25, 1053. [Google Scholar] [CrossRef]
- Choi, Y.; Lee, S.; Kim, S.; Lee, J.; Ha, J.; Oh, H.; Lee, Y.; Kim, Y.; Yoon, Y. Vitamin E (α-tocopherol) consumption influences gut microbiota composition. Int. J. Food Sci. Nutr. 2020, 71, 221–225. [Google Scholar] [CrossRef] [PubMed]
- Dai, D.; Wang, J.; Zhang, H.; Wu, S.; Qi, G. Uterine microbial communities and their potential role in the regulation of epithelium cell cycle and apoptosis in aged hens. Microbiome 2023, 11, 251. [Google Scholar] [CrossRef] [PubMed]
- Peng, L.; Li, Z.R.; Green, R.S.; Holzman, I.R.; Lin, J. Butyrate enhances the intestinal barrier by facilitating tight junction assembly via activation of AMP-activated protein kinase in Caco-2 cell monolayers. J. Nutr. 2009, 139, 1619–1625. [Google Scholar] [CrossRef]
- Sheremet, A.; Jones, G.M.; Jarett, J.; Bowers, R.M.; Bedard, I.; Culham, C.; Eloe-Fadrosh, E.A.; Ivanova, N.; Malmstrom, R.R.; Grasby, S.E.; et al. Ecological and genomic analyses of candidate phylum WPS-2 bacteria in an unvegetated soil. Environ. Microbiol. 2020, 22, 3143–3157. [Google Scholar] [CrossRef] [PubMed]
- Khan, S.; Moore, R.J.; Stanley, D.; Chousalkar, K.K. The Gut Microbiota of Laying Hens and Its Manipulation with Prebiotics and Probiotics To Enhance Gut Health and Food Safety. Appl. Environ. Microbiol. 2020, 86, e00600-20. [Google Scholar] [CrossRef]
- Kim, Y.B.; Park, J.; Lee, H.G.; Song, J.Y.; Kim, D.H.; Ji, W.; Joo, S.S.; Kim, M.; Jung, J.Y.; Kim, M.; et al. Dietary probiotic Lacticaseibacillus paracasei NSMJ56 modulates gut immunity and microbiota in laying hens. Poult. Sci. 2024, 103, 103505. [Google Scholar] [CrossRef] [PubMed]
- Vieira, D.A.P.; Cabral, L.; Noronha, M.F.; Júnior, G.V.L.; Sant’Ana, A.S. Microbiota of eggs revealed by 16S rRNA-based sequencing: From raw materials produced by different suppliers to chilled pasteurized liquid products. Food Control 2019, 96, 194–204. [Google Scholar] [CrossRef]
- Wen, C.; Li, Q.; Lan, F.; Li, X.; Li, G.; Yan, Y.; Wu, G.; Yang, N.; Sun, C. Microbiota continuum along the chicken oviduct and its association with host genetics and egg formation. Poult. Sci. 2021, 100, 101104. [Google Scholar] [CrossRef]
- Long, L.; Wu, S.G.; Yuan, F.; Zhang, H.J.; Wang, J.; Qi, G.H. Effects of dietary octacosanol supplementation on laying performance, egg quality, serum hormone levels, and expression of genes related to the reproductive axis in laying hens. Poult. Sci. 2017, 96, 894–903. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; La, T.M.; Lee, H.J.; Choi, I.S.; Song, C.S.; Park, S.Y.; Lee, J.B.; Lee, S.W. Characterization of microbial communities in the chicken oviduct and the origin of chicken embryo gut microbiota. Sci. Rep. 2019, 9, 6838. [Google Scholar] [CrossRef] [PubMed]
- Mariat, D.; Firmesse, O.; Levenez, F.; Guimarăes, V.; Sokol, H.; Doré, J.; Corthier, G.; Furet, J.P. The Firmicutes/Bacteroidetes ratio of the human microbiota changes with age. BMC Microbiol. 2009, 9, 123. [Google Scholar] [CrossRef]
- Murphy, E.F.; Cotter, P.D.; Healy, S.; Marques, T.M.; O’Sullivan, O.; Fouhy, F.; Clarke, S.F.; O’Toole, P.W.; Quigley, E.M.; Stanton, C.; et al. Composition and energy harvesting capacity of the gut microbiota: Relationship to diet, obesity and time in mouse models. Gut 2010, 59, 1635–1642. [Google Scholar] [CrossRef]
- Baker, J.M.; Al-Nakkash, L.; Herbst-Kralovetz, M.M. Estrogen-gut microbiome axis: Physiological and clinical implications. Maturitas 2017, 103, 45–53. [Google Scholar] [CrossRef] [PubMed]
- Takada, K.; Melnikov, V.G.; Kobayashi, R.; Komine-Aizawa, S.; Tsuji, N.M.; Hayakawa, S. Female reproductive tract-organ axes. Front. Immunol. 2023, 14, 1110001. [Google Scholar] [CrossRef] [PubMed]
- De Filippo, C.; Cavalieri, D.; Di Paola, M.; Ramazzotti, M.; Poullet, J.B.; Massart, S.; Collini, S.; Pieraccini, G.; Lionetti, P. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proc. Natl. Acad. Sci. USA 2010, 107, 14691–14696. [Google Scholar] [CrossRef] [PubMed]
- Amabebe, E.; Anumba, D.O.C. Female Gut and Genital Tract Microbiota-Induced Crosstalk and Differential Effects of Short-Chain Fatty Acids on Immune Sequelae. Front. Immunol. 2020, 11, 2184. [Google Scholar] [CrossRef]
- Ashonibare, V.J.; Akorede, B.A.; Ashonibare, P.J.; Akhigbe, T.M.; Akhigbe, R.E. Gut microbiota-gonadal axis: The impact of gut microbiota on reproductive functions. Front. Immunol. 2024, 15, 1346035. [Google Scholar] [CrossRef]
- Flores, R.; Shi, J.; Fuhrman, B.; Xu, X.; Veenstra, T.D.; Gail, M.H.; Gajer, P.; Ravel, J.; Goedert, J.J. Fecal microbial determinants of fecal and systemic estrogens and estrogen metabolites: A cross-sectional study. J. Transl. Med. 2012, 10, 253. [Google Scholar] [CrossRef] [PubMed]
- Baker, J.M.; Chase, D.M.; Herbst-Kralovetz, M.M. Uterine Microbiota: Residents, Tourists, or Invaders? Front. Immunol. 2018, 9, 208. [Google Scholar] [CrossRef] [PubMed]
- Qi, X.; Yun, C.; Pang, Y.; Qiao, J. The impact of the gut microbiota on the reproductive and metabolic endocrine system. Gut Microbes 2021, 13, 1894070. [Google Scholar] [CrossRef]
- Wang, J.; Li, Z.; Ma, X.; Du, L.; Jia, Z.; Cui, X.; Yu, L.; Yang, J.; Xiao, L.; Zhang, B.; et al. Translocation of vaginal microbiota is involved in impairment and protection of uterine health. Nat. Commun. 2021, 12, 4191. [Google Scholar] [CrossRef] [PubMed]






| Ingredients (%) | Content |
|---|---|
| Corn | 62.00 |
| Soybean meal | 26.00 |
| CaHPO4 | 1.00 |
| Limestone | 8.00 |
| Premix 1 | 3.00 |
| Total | 100.00 |
| Nutrient composition 2 (%) | |
| Metabolic energy, ME (MJ/kg) | 11.20 |
| Crude protein, CP | 16.80 |
| Lysine, Lys | 0.78 |
| Methionine + Cysteine, Met + Cys | 0.66 |
| Calcium, Ca | 3.70 |
| Available phosphorus, AP | 0.26 |
| Target Gene | Primer Sequence (5′ → 3′) | Accession No. | Size (Bp) |
|---|---|---|---|
| GAPDH | F: AGTGAAGGCTGCTGCTGATGG R: TCAAAGGTGGAGGAATGGCTGTC | NM_204305.2 | 105 |
| ESR1 | F: GTTCCGCTCTACGACCTCTTACTG R: AGTTGGTTTCGGTTCTCCTCTTCC | NM_205183.2 | 104 |
| ESR2 | F: CCAGCTACCAATCAATGCACGATAG R: AGCCACATTTCATCATTCCCACTTC | NM_204794.3 | 100 |
| FSHR | F: AATGGAACCTGCCTGGATGAGC R: CCCGATGGCTCCTTGGAAGAC | XM_040696841.2 | 87 |
| LHR | F: CTCGTCCTCATAACCAGCCACTAC R: CACCGAAGCAATGAGCACCAAG | XM_010706641.2 | 111 |
| Items | Groups | p-Value | |||
|---|---|---|---|---|---|
| CON | VE | KAE | KAE + VE | ||
| Egg laying rate (%) | 89.56 ± 4.56 C | 91.50 ± 4.35 B | 91.89 ± 4.53 AB | 93.11 ± 3.45 A | <0.001 |
| Average daily feed intake (g) | 120.55 ± 1.94 | 120.36 ± 1.60 | 120.29 ± 2.11 | 120.28 ± 1.51 | 0.817 |
| Average daily egg weight (g) | 57.12 ± 3.12 b | 58.22 ± 2.53 a | 58.48 ± 2.51 a | 58.73 ± 2.25 a | 0.025 |
| Feed/egg ratio 1 | 2.14 ± 0.15 A | 2.09 ± 0.11 B | 2.06 ± 0.11 B | 2.06 ± 0.09 B | 0.004 |
| Qualified egg rate (%) | 99.59 ± 0.90 | 99.83 ± 0.73 | 99.80 ± 0.64 | 99.80 ± 0.65 | 0.192 |
| Items | Groups | p-Value | |||
|---|---|---|---|---|---|
| CON | VE | KAE | KAE + VE | ||
| Egg Shape Index | 1.31 ± 0.05 | 1.32 ± 0.06 | 1.30 ± 0.05 | 1.32 ± 0.04 | 0.563 |
| Haugh Unit | 90.92 ± 4.84 b | 93.13 ± 4.73 ab | 94.46 ± 8.52 ab | 96.50 ± 7.89 a | 0.048 |
| Eggshell Strength (kg/cm2) | 3.68 ± 0.45 b | 3.95 ± 0.57 a | 4.03 ± 0.32 a | 4.10 ± 0.36 a | 0.017 |
| Eggshell Relative Weight (g) | 12.30 ± 1.08 b | 12.99 ± 0.90 a | 13.01 ± 0.95 a | 13.21 ± 1.13 a | 0.032 |
| Eggshell Thickness (mm) | 0.31 ± 0.03 b | 0.33 ± 0.03 a | 0.33 ± 0.02 a | 0.34 ± 0.02 a | 0.010 |
| Yolk Color | 6.48 ± 0.60 B | 6.93 ± 0.68 A | 7.12 ± 0.85 A | 7.18 ± 0.59 A | 0.002 |
| Yolk Relative Weight (g) | 25.54 ± 1.64 B | 26.84 ± 1.70 A | 27.09 ± 1.97 A | 27.11 ± 1.40 A | 0.008 |
| Yolk-To-White Ratio | 40.90 ± 4.13 | 41.92 ± 4.46 | 42.74 ± 5.02 | 44.85 ± 6.31 | 0.058 |
| Items | Groups | p-Value | |||
|---|---|---|---|---|---|
| CON | VE | KAE | KAE + VE | ||
| ACE | 1157.00 ± 258.40 | 1044.00 ± 141.80 | 1133.00 ± 254.80 | 1083.00 ± 331.60 | 0.867 |
| Chao1 | 1143.00 ± 266.60 | 1029.00 ± 133.40 | 1120.00 ± 256.90 | 1067.00 ± 321.20 | 0.927 |
| Sobs | 1062.00 ± 160.40 | 1013.00 ± 122.10 | 1058.00 ± 161.40 | 1004.00 ± 214.80 | 0.936 |
| Shannon | 5.53 ± 0.06 | 5.65 ± 0.15 | 5.64 ± 0.19 | 5.68 ± 0.25 | 0.531 |
| Items | Groups | p-Value | |||
|---|---|---|---|---|---|
| CON | VE | KAE | KAE + VE | ||
| Phylum level | |||||
| Firmicutes | 42.35 ± 8.77 | 45.26 ± 9.38 | 46.72 ± 4.59 | 47.79 ± 11.15 | 0.892 |
| Bacteroidota | 45.34 ± 9.05 | 47.78 ± 11.17 | 43.79 ± 4.49 | 44.78 ± 8.82 | 0.941 |
| WPS-2 | 3.40 ± 1.56 | 1.70 ± 1.15 | 2.474 ± 1.47 | 1.05 ± 0.85 | 0.119 |
| F/B 1 | 0.96 ± 0.32 | 1.01 ± 0.37 | 1.03 ± 0.23 | 1.18 ± 0.54 | 0.858 |
| Items | Groups | p-Value | |||
|---|---|---|---|---|---|
| CON | VE | KAE | KAE + VE | ||
| ACE | 659.90 ± 136.80 | 700.40 ± 167.50 | 764.70 ± 83.70 | 710.80 ± 21.95 | 0.644 |
| Chao1 | 658.30 ± 136.50 | 700.00 ± 168.20 | 763.20 ± 84.10 | 709.80 ± 22.12 | 0.644 |
| Sobs | 656.30 ± 135.50 | 699.30 ± 169.40 | 755.70 + 84.76 | 709.00 ± 22.52 | 0.643 |
| Shannon | 4.77 ± 0.60 | 4.54 ± 0.76 | 4.67 ± 0.37 | 4.29 ± 0.16 | 0.668 |
| Items | Groups | p-Value | |||
|---|---|---|---|---|---|
| CON | VE | KAE | KAE + VE | ||
| Phylum level | |||||
| Firmicutes | 57.56 ± 5.92 | 56.40 ± 14.30 | 62.78 ± 4.28 | 68.29 ± 11.67 | 0.442 |
| Proteobacteria | 23.86 ± 8.24 | 25.23 ± 20.29 | 18.84 ± 3.54 | 16.30 ± 6.339 | 0.764 |
| Bacteroidota | 8.917 ± 3.19 | 13.66 ± 10.75 | 11.16 ± 2.57 | 4.68 ± 2.785 | 0.340 |
| F/B | 4.46 ± 1.36 b | 4.51 ± 1.12 b | 6.27 ± 1.17 ab | 9.31 ± 3.36 a | 0.016 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, J.; Zhang, J.; Li, K.; Fu, X.; Liang, Y.; Zhang, M.; Zhuang, S.; Gao, Y. Kaempferol and Vitamin E Improve Production Performance by Linking the Gut–Uterus Axis Through the Reproductive Hormones and Microbiota of Late-Laying Hens. Animals 2025, 15, 15. https://doi.org/10.3390/ani15010015
Zhang J, Zhang J, Li K, Fu X, Liang Y, Zhang M, Zhuang S, Gao Y. Kaempferol and Vitamin E Improve Production Performance by Linking the Gut–Uterus Axis Through the Reproductive Hormones and Microbiota of Late-Laying Hens. Animals. 2025; 15(1):15. https://doi.org/10.3390/ani15010015
Chicago/Turabian StyleZhang, Jing, Jie Zhang, Kangle Li, Xinyue Fu, Yanhui Liang, Minling Zhang, Shaolong Zhuang, and Yuyun Gao. 2025. "Kaempferol and Vitamin E Improve Production Performance by Linking the Gut–Uterus Axis Through the Reproductive Hormones and Microbiota of Late-Laying Hens" Animals 15, no. 1: 15. https://doi.org/10.3390/ani15010015
APA StyleZhang, J., Zhang, J., Li, K., Fu, X., Liang, Y., Zhang, M., Zhuang, S., & Gao, Y. (2025). Kaempferol and Vitamin E Improve Production Performance by Linking the Gut–Uterus Axis Through the Reproductive Hormones and Microbiota of Late-Laying Hens. Animals, 15(1), 15. https://doi.org/10.3390/ani15010015

