Effects of Photoperiod on Survival, Growth, Physiological, and Biochemical Indices of Redclaw Crayfish (Cherax quadricarinatus) Juveniles
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Experimental Methods
2.2.1. Preparation of the Culture Environment
2.2.2. Experimental Design
2.2.3. Daily Management
2.3. Sample Collection and Analysis
2.3.1. Growth and Survival Indices
2.3.2. Determination of Enzyme Activity and Hormone Levels
2.3.3. Body Color Measurement
2.3.4. Total RNA Extraction, cDNA Synthesis, and qPCR Analysis
2.4. Statistical Analysis
3. Results
3.1. Effects of Different Photoperiod Treatments on Survival Rate and Growth of C. quadricarinatus Juveniles
3.2. Effects of Different Photoperiod Treatments on Antioxidative Capacity and Immune-Related Enzyme Activity of C. quadricarinatus Juveniles
3.2.1. Antioxidant Indices in Different Photoperiod Groups
3.2.2. Immune Enzyme Activities in Different Photoperiod Groups
3.3. Effects of Different Photoperiod Treatments on Melatonin and Cortisol in C. quadricarinatus Juveniles
3.4. Effects of Different Photoperiod Treatments on Body Color Changes in C. quadricarinatus Juveniles
3.5. Effects of Different Photoperiod Treatments on the Expression of Growth-Related Genes in C. quadricarinatus Juveniles
4. Discussion
4.1. Effects of Different Photoperiod Treatments on Survival Rate and Growth of C. quadricarinatus Juveniles
4.2. Effects of Different Photoperiod Treatments on Antioxidative Capacity and Immune-Related Enzyme Activity of C. quadricarinatus Juveniles
4.3. Effects of Different Photoperiod Treatments on Melatonin and Cortisol in C. quadricarinatus Juveniles
4.4. Effects of Different Photoperiod Treatments on Body Color Changes in C. quadricarinatus Juveniles
4.5. Effects of Different Photoperiod Treatments on the Expression of Growth-Related Genes in C. quadricarinatus Juveniles
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tropea, C.; Stumpf, L.; Greco, L.S.L. Effect of Temperature on Biochemical Composition, Growth and Reproduction of the Ornamental Red Cherry Shrimp Neocaridina heteropoda heteropoda (Decapoda, Caridea). PLoS ONE 2015, 10, e0119468. [Google Scholar] [CrossRef]
- Huang, Y.H.; Zhang, M.; Li, Y.M.; Wu, D.L.; Liu, Z.Q.; Jiang, Q.C.; Zhao, Y.L. Effects of salinity acclimation on the growth performance, osmoregulation and energy metabolism of the oriental river prawn, Macrobrachium nipponense (De Haan). Aquac. Res. 2018, 50, 685–693. [Google Scholar] [CrossRef]
- Xu, H.; Dou, J.; Wu, Q.; Ye, Y.; Wang, C.; Song, C.; Mu, C.; Ren, Z.; Shi, C. Photoperiod affects the survival rate but not the development of larval swimming crab Portunus trituberculatus. Aquac. Int. 2022, 30, 1769–1778. [Google Scholar] [CrossRef]
- Cui, Y.; Ren, X.; Li, J.; Zhai, Q.; Feng, Y.; Xu, Y.; Ma, L. Effects of ammonia-N stress on metabolic and immune function via the neuroendocrine system in Litopenaeus vannamei. Fish Shellfish Immunol. 2017, 64, 270–275. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.-N.; Wang, A.-L.; Zhang, Y.-J.; Li, Z.-H.; Wang, J.-X.; Sun, R.-Y. Effects of nitrite on lethal and immune response of Macrobrachium nipponense. Aquaculture 2004, 232, 679–686. [Google Scholar] [CrossRef]
- Villamizar, N.; Blanco-Vives, B.; Migaud, H.; Davie, A.; Carboni, S.; Sánchez-Vázquez, F.J. Effects of light during early larval development of some aquacultured teleosts: A review. Aquaculture 2011, 315, 86–94. [Google Scholar] [CrossRef]
- Bromage, N.; Porter, M.; Randall, C. The environmental regulation of maturation in farmed finfish with special reference to the role of photoperiod and melatonin. Aquaculture 2001, 197, 63–98. [Google Scholar] [CrossRef]
- Migaud, H.; Davie, A.; Taylor, J.F. Current knowledge on the photoneuroendocrine regulation of reproduction in temperate fish species. J. Fish Biol. 2010, 76, 27–68. [Google Scholar] [CrossRef]
- Pedro Cañavate, J.; Zerolo, R.; Fernández-Díaz, C. Feeding and development of Senegal sole (Solea senegalensis) larvae reared in different photoperiods. Aquaculture 2006, 258, 368–377. [Google Scholar] [CrossRef]
- Puvanendran, V.; Brown, J.A. Foraging, growth and survival of Atlantic cod, Gadus morhua, larvae reared in different light intensities and photoperiods. Aquaculture 2002, 214, 131–151. [Google Scholar] [CrossRef]
- Durica, D.S.; Wu, X.H.; Anilkumar, G.; Hopkins, P.M.; Chung, A.C.K. Characterization of crab EcR and RXR homologs and expression during limb regeneration and oocyte maturation. Mol. Cell. Endocrinol. 2002, 189, 59–76. [Google Scholar] [CrossRef] [PubMed]
- Gardner, C.; Maguire, G.B. Effect of photoperiod and light intensity on survival, development and cannibalism of larvae of the Australian giant crab Pseudocarcinus gigas (Lamarck). Aquaculture 1998, 165, 51–63. [Google Scholar] [CrossRef]
- Jiang, Q.C.; Zhang, W.Y.; Tan, H.Y.; Zhang, Y.T.; Yang, J.X.; Li, F. A study on the feeding rhythm of juvenile Australia redclaw crayfish (Cherax quadricarinatus) under different photoperiods. Freshw. Fish. 2012, 42, 89–91. [Google Scholar]
- Khansari, D.N.; Murgo, A.J. Effects of stress on the immune system. Immunol. Today 1990, 11, 170–175. [Google Scholar] [CrossRef] [PubMed]
- Han, Z.; Li, X.; Xu, W.; She, Q.; Liang, S.; Li, X.; Li, Y. Melatonin concentrations in Chinese mitten crabs (Eriocheir sinesis) are affected by artificial photoperiods. Biol. Rhythm Res. 2020, 51, 362–372. [Google Scholar] [CrossRef]
- Wang, X.; Liu, B.; Gao, X.; Wang, X.; Li, H.; Xu, L.; Wang, G.; Zhao, K.; Huang, B. The Effects of Different UVA Photoperiods on the Growth Performance, Immune Responses, Antioxidant Status and Apoptosis-Related Gene Expression of the Pacific White Shrimp (Penaeus vannamei). Antibiotics 2021, 11, 37. [Google Scholar] [CrossRef] [PubMed]
- Sainath, S.B.; Swetha, C.; Reddy, P.S. What do we (need to) know about the melatonin in crustaceans? J. Exp. Zool. Part A-Ecol. Genet. Physiol. 2013, 319, 365–377. [Google Scholar] [CrossRef] [PubMed]
- Maciel, F.E.; Geihs, M.A.; Vargas, M.A.; Cruz, B.P.; Ramos, B.P.; Vakkuri, O.; Meyer-Rochow, V.B.; Nery, L.E.M.; Allodi, S. Daily variation of melatonin content in the optic lobes of the crab Neohelice granulata. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2008, 149, 162–166. [Google Scholar] [CrossRef]
- Cheng, S.; Zheng, J.-B.; Jia, Y.-Y.; Chi, M.-L.; Jiang, W.-P.; Liu, S.-L.; Li, F.; Liu, Y.-N.; Gu, Z.-M.; Wang, D.-L. Effects of light color, photoperiod, and growth-related gene interference or overexpression on the survival, growth, or physiological and biochemical indices of red claw crayfish juveniles. Aquaculture 2023, 562, 738740. [Google Scholar] [CrossRef]
- Chen, S.; Liu, J.; Shi, C.; Migaud, H.; Ye, Y.; Song, C.; Mu, C.; Ren, Z.; Wang, C. Effect of photoperiod on growth, survival, and lipid metabolism of mud crab Scylla paramamosain juveniles. Aquaculture 2023, 567, 739279. [Google Scholar] [CrossRef]
- Wei, J.; Tian, L.; Wang, Y.; Yu, L.; Zhu, X. Effects of salinity, photoperiod, and light spectrum on larval survival, growth, and related enzyme activities in the giant freshwater prawn, Macrobrachium rosenbergii. Aquaculture 2021, 530, 735794. [Google Scholar] [CrossRef]
- Jiao, L.; Dai, T.; Tao, X.; Lu, J.; Zhou, Q. Influence of Light/Dark Cycles on Body Color, Hepatopancreas Metabolism, and Intestinal Microbiota Homeostasis in Litopenaeus vannamei. Front. Mar. Sci. 2021, 8, 750384. [Google Scholar] [CrossRef]
- Ma, H.; Wei, P.; Li, X.; Liu, S.; Tian, Y.; Zhang, Q.; Liu, Y. Effects of photoperiod on growth, digestive, metabolic and non-special immunity enzymes of Takifugu rubripes larvae. Aquaculture 2021, 542, 736840. [Google Scholar] [CrossRef]
- Neptune, T.C.; Benard, M.F. Photoperiod effects in a freshwater community: Amphibian larvae develop faster and zooplankton abundance increases under an early-season photoperiod. Ecol. Evol. 2023, 13, e10400. [Google Scholar] [CrossRef] [PubMed]
- Chang, C.C.; Hung, M.D.; Cheng, W. Norepinephrine depresses the immunity and disease-resistance ability via alpha1- and beta1-adrenergic receptors of Macrobrachium rosenbergii. Dev. Comp. Immunol. 2011, 35, 685–691. [Google Scholar] [CrossRef] [PubMed]
- Gouveia, D.; Bonneton, F.; Almunia, C.; Armengaud, J.; Queau, H.; Degli-Esposti, D.; Geffard, O.; Chaumot, A. Identification, expression, and endocrine-disruption of three ecdysone-responsive genes in the sentinel species Gammarus fossarum. Sci. Rep. 2018, 8, 3793. [Google Scholar] [CrossRef]
- Fei, F. Preliminary Analysis of the Effect of LED Environment on the Growth and Physiological Property of Litopenaeus vannamei and Its Related Mechanism. Master’s Thesis, Dalian Ocean University, Dalian, China, 2020. [Google Scholar]
- FAO. Global Aquaculture Production Quantity (1950–2021). Available online: https://www.fao.org/fishery/statistics-query/en/aquaculture/aquaculture_quantity (accessed on 17 January 2024).
- Strauss, J.; Dircksen, H. Circadian clocks in crustaceans: Identified neuronal and cellular systems. Front. Biosci. 2010, 15, 1040–1074. [Google Scholar] [CrossRef]
- Abeel, T.; Vervloesem, F.; Claeyé, J.; Arnouts, H.; Aerts, S. Effect of Photoperiod on Juvenile Redclaw (Cherax quadricarinatus) Performance in a Closed Aquaculture System. In Proceedings of the International Crayfish Meeting, Visby, Sweden, 27–30 August 2019. [Google Scholar]
- Wu, Z.X.; Chen, X.X.; Liu, X.L.; Mei, X.H.; Chen, X.Q. Effects of different photoperiods on the propagation and growth of redclaw crayfish. Freshw. Fish. 2000, 30, 4–5. [Google Scholar]
- Soares, R.; Peixoto, S.; Wasielesky, W.; D’Incao, F. Feeding rhythms and diet of Farfantepenaeus paulensis under pen culture in Patos Lagoon estuary, Brazil. J. Exp. Mar. Biol. Ecol. 2005, 322, 167–176. [Google Scholar] [CrossRef]
- Wang, Y.; Li, H.; Wei, J.; Hong, K.; Zhou, Q.; Liu, X.; Hong, X.; Li, W.; Liu, C.; Zhu, X.; et al. Multi-Effects of Acute Salinity Stress on Osmoregulation, Physiological Metabolism, Antioxidant Capacity, Immunity, and Apoptosis in Macrobrachium rosenbergii. Antioxidants 2023, 12, 1836. [Google Scholar] [CrossRef]
- Wei, K.; Yang, J. Oxidative damage induced by copper and beta-cypermethrin in gill of the freshwater crayfish Procambarus clarkii. Ecotoxicol. Environ. Saf. 2015, 113, 446–453. [Google Scholar] [CrossRef] [PubMed]
- Chen, P.; Li, J.; Li, J.T.; Liu, P.; Gao, B.Q. Comparison on the function of nonspecific immunity in different populations of Portunus trituberculatus. Chin. Agric. Sci. Bull. 2018, 24, 496–498. [Google Scholar]
- Fu, C.; Cui, Z.; Shi, X.; Liu, J.; Jiang, Y.; Zhang, R. Effects of dietary glyceryl monolaurate supplementation on growth performance, non-specific immunity, antioxidant status and intestinal microflora of Chinese mitten crabs. Fish Shellfish Immunol. 2022, 125, 65–73. [Google Scholar] [CrossRef] [PubMed]
- Long, J.; Cui, Y.; Wang, R.; Chen, Y.; Zhao, N.; Wang, C.; Wang, Z.; Li, Y. Combined effects of high salinity and ammonia-N exposure on the energy metabolism, immune response, oxidative resistance and ammonia metabolism of the Pacific white shrimp Litopenaeus vannamei. Aquac. Rep. 2021, 20, 100648. [Google Scholar] [CrossRef]
- Hu, N.; Yu, C.Y.; Jin, J.X.; Zhao, X.M.; Zhao, Y.Y.; Wei, H.; Li, Y.D. Impact of photoperiods on the specific activities of immune and antioxidant enzymes in different tissues of Dybowski’s frog (Rana dybowskii). Biol. Rhythm Res. 2022, 53, 1790–1799. [Google Scholar] [CrossRef]
- Cagnacci, A.; Volpe, A. Influence of melatonin and photoperiod on animal and human reproduction. J. Endocrinol. Investig. 1996, 19, 382–411. [Google Scholar] [CrossRef]
- Poeggeler, B.; Hardeland, R. Detection and quantification of melatonin in a dinoflagellate, Gonyaulax polyedra: Solutions to the problem of methoxyindole destruction in non-vertebrate material. J. Pineal Res. 1994, 17, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Falcon, J.; Migaud, H.; Munoz-Cueto, J.A.; Carrillo, M. Current knowledge on the melatonin system in teleost fish. Gen. Comp. Endocrinol. 2010, 165, 469–482. [Google Scholar] [CrossRef]
- Randall, C.F.; Bromage, N.R.; Thorpe, J.E.; Miles, M.S.; Muir, J.S. Melatonin rhythms in Atlantic salmon (Salmo salar) maintained under natural and out-of-phase photoperiods. Gen. Comp. Endocrinol. 1995, 98, 73–86. [Google Scholar] [CrossRef]
- Garcia-Allegue, R.; Madrid, J.A.; Sanchez-Vazquez, F.J. Melatonin rhythms in European sea bass plasma and eye: Influence of seasonal photoperiod and water temperature. J. Pineal Res. 2001, 31, 68–75. [Google Scholar] [CrossRef]
- Reiter, R.J.; Tan, D.X.; Burkhardt, S. Reactive oxygen and nitrogen species and cellular and organismal decline: Amelioration with melatonin. Mech. Ageing Dev. 2002, 123, 1007–1019. [Google Scholar] [CrossRef]
- Allegra, M.; Reiter, R.J.; Tan, D.X.; Gentile, C.; Tesoriere, L.; Livrea, M.A. The chemistry of melatonin’s interaction with reactive species. J. Pineal Res. 2003, 34, 1–10. [Google Scholar] [CrossRef]
- Tan, D.X.; Manchester, L.C.; Hardeland, R.; Lopez-Burillo, S.; Mayo, J.C.; Sainz, R.M.; Reiter, R.J. Melatonin: A hormone, a tissue factor, an autocoid, a paracoid, and an antioxidant vitamin. J. Pineal Res. 2003, 34, 75–78. [Google Scholar] [CrossRef]
- Rodriguez, C.; Mayo, J.C.; Sainz, R.M.; Antolin, I.; Herrera, F.; Martin, V.; Reiter, R.J. Regulation of antioxidant enzymes: A significant role for melatonin. J. Pineal Res. 2004, 36, 1–9. [Google Scholar] [CrossRef]
- Geihs, M.A.; Vargas, M.A.; Maciel, F.E.; Caldas, S.S.; Cruz, B.P.; Primel, E.G.; Monserrat, J.M.; Nery, L.E. Effect of melatonin in the antioxidant defense system in the locomotor muscles of the estuarine crab Neohelice granulata (Decapoda, Brachyura). Gen. Comp. Endocrinol. 2010, 166, 72–82. [Google Scholar] [CrossRef]
- Maciel, F.E.; Ramos, B.P.; Geihs, M.A.; Vargas, M.A.; Cruz, B.P.; Meyer-Rochow, V.B.; Vakkuri, O.; Allodi, S.; Monserrat, J.M.; Nery, L.E. Effects of melatonin in connection with the antioxidant defense system in the gills of the estuarine crab Neohelice granulata. Gen. Comp. Endocrinol. 2010, 165, 229–236. [Google Scholar] [CrossRef] [PubMed]
- Tian, H.; Zhang, D.; Li, X.; Jiang, G.; Liu, W. Photoperiod affects blunt snout bream (Megalobrama amblycephala) growth, diel rhythm of cortisol, activities of antioxidant enzymes and mRNA expression of GH/IGF-I. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2019, 233, 4–10. [Google Scholar] [CrossRef]
- Fatira, E.; Papandroulakis, N.; Pavlidis, M. Diel changes in plasma cortisol and effects of size and stress duration on the cortisol response in European sea bass (Dicentrarchus labrax). Fish Physiol. Biochem. 2014, 40, 911–919. [Google Scholar] [CrossRef] [PubMed]
- Leonardi, M.O.; Klempau, A.E. Artificial photoperiod influence on the immune system of juvenile rainbow trout (Oncorhynchus mykiss) in the Southern Hemisphere. Aquaculture 2003, 221, 581–591. [Google Scholar] [CrossRef]
- Newkirk, G.F. Genetics of shell color in Mytilus edulis L. and the association of growth rate with shell color. J. Exp. Mar. Biol. Ecol. 1980, 47, 89–94. [Google Scholar] [CrossRef]
- Uy, F.M.K.; Ravichandran, S.; Patel, K.S.; Aresty, J.; Aresty, P.P.; Audett, R.M.; Chen, K.; Epple, L.; Jeffries, S.F.; Serein, G.N.; et al. Active background choice facilitates crypsis in a tropical crab. Biotropica 2017, 49, 365–371. [Google Scholar] [CrossRef]
- Baldwin, J.; Johnsen, S. The importance of color in mate choice of the blue crab Callinectes sapidus. J. Exp. Biol. 2009, 212, 3762–3768. [Google Scholar] [CrossRef] [PubMed]
- Detto, T.; Backwell, P.R.; Hemmi, J.M.; Zeil, J. Visually mediated species and neighbour recognition in fiddler crabs (Uca mjoebergi and Uca capricornis). Proc. R. Soc. B Biol. Sci. 2006, 273, 1661–1666. [Google Scholar] [CrossRef] [PubMed]
- Poter, M.J.R.; Woolcott, H.M.; Pankhurst, N.W. The use of additional lighting and artificial photoperiods to recondition early maturing Atlantic salmon (Salmo salar) in Tasmania. Fish Physiol. Biochem. 2003, 28, 391–393. [Google Scholar] [CrossRef]
- Adewolu, M.A.; Adeniji, C.A.; Adejobi, A.B. Feed utilization, growth and survival of Clarias gariepinus (Burchell 1822) fingerlings cultured under different photoperiods. Aquaculture 2008, 283, 64–67. [Google Scholar] [CrossRef]
- Leng, X.J.; Li, X.Q. The recent advance of aquatic animal pigmentation. J. Fish. 2006, 30, 138–143. [Google Scholar]
- Shiraki, T.; Kojima, D.; Fukada, Y. Light-induced body color change in developing zebrafish. Photochem. Photobiol. Sci. 2010, 9, 1498–1504. [Google Scholar] [CrossRef]
- Cianci, M.; Rizkallah, P.J.; Olczak, A.; Raftery, J.; Chayen, N.E.; Zagalsky, P.F.; Helliwell, J.R. The molecular basis of the coloration mechanism in lobster shell: β-crustacyanin at 3.2 Å resolution. Proc. Natl. Acad. Sci. USA 2002, 99, 9795–9800. [Google Scholar] [CrossRef]
- Velu, C.S.; Czeczuga, B.; Munuswamy, N. Carotenoprotein complexes in entomostracan crustaceans (Streptocephalus dichotomus and Moina micrura). Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2003, 135, 35–42. [Google Scholar] [CrossRef]
- Supamattaya, K.; Kiriratnikom, S.; Boonyaratpalin, M.; Borowitzka, L. Effect of a Dunaliella extract on growth performance, health condition, immune response and disease resistance in black tiger shrimp (Penaeus monodon). Aquaculture 2005, 248, 207–216. [Google Scholar] [CrossRef]
- Guo, L.L. Effects of Density, Dry Dew and Astaxanthin Deficiency on Body Color of Procambarus clarkii. Master’s Thesis, Shanghai Ocean University, Shanghai, China, 2023. [Google Scholar]
- Wei, M.; Gu, Z.F.; Pan, Z.; Shi, Y.H.; Huang, Z.W.; Zheng, X.; Liao, X.R.; Li, J.N.; Liu, C.S.; Wang, A.M. Effects of background color on growth, survival, body color, and inhabiting behavior distribution of Cherax quadricarinatus. Mar. Sci. 2020, 44, 60–65. [Google Scholar]
- Glenn, K.L.; Grapes, L.; Suwanasopee, T.; Harris, D.L.; Li, Y.; Wilson, K.; Rothschild, M.F. SNP analysis of AMY2 and CTSL genes in Litopenaeus vannamei and Penaeus monodon shrimp. Anim. Genet. 2005, 36, 235–236. [Google Scholar] [CrossRef]
- Tarrant, A.M.; Behrendt, L.; Stegeman, J.J.; Verslycke, T. Ecdysteroid receptor from the American lobster Homarus americanus: EcR/RXR isoform cloning and ligand-binding properties. Gen. Comp. Endocrinol. 2011, 173, 346–355. [Google Scholar] [CrossRef] [PubMed]
- Xu, G.R. Study on the Effects of Temperature on the Growth and Immune Performance of Cherax quadricarinatus. Master’s Thesis, East China Normal University, Shanghai, China, 2017. [Google Scholar]
- Xin, J.J.; Liu, X.L.; Li, X.L.; Wang, X.Z.; Huang, H.; Xiang, J.H. PCR-RFLP polymorphism of alpha-amylase gene and its association with growth traits of Litopenaeus vannamei. Acta Oceanol. Sin. 2011, 33, 124–130. [Google Scholar]
- Li, Z.; Wang, W.Q.; Zhang, E.F.; Qiu, G.F. Identification of spliced mRNA isoforms of retinoid X receptor (RXR) in the Oriental freshwater prawn Macrobrachium nipponense. Genet. Mol. Res. 2014, 13, 3914–3926. [Google Scholar] [CrossRef]
- Kim, H.W.; Lee, S.G.; Mykles, D.L. Ecdysteroid-responsive genes, RXR and E75, in the tropical land crab, Gecarcinus lateralis: Differential tissue expression of multiple RXR isoforms generated at three alternative splicing sites in the hinge and ligand-binding domains. Mol. Cell. Endocrinol. 2005, 242, 80–95. [Google Scholar] [CrossRef]
Gene | Sequence (5′–3′) | Sources |
---|---|---|
RXR | F: AGGAGATGCCGTAACCAACA | KM016907.1 |
R: ATGCTTCGGTGTGAGAAGGA | ||
α-AMY | F: CCGCTGGAGACAGATCTACG | OL963595.1 |
R: AACGTCACAGTAGGTGCCAG | ||
β-actin | F: CCCCATGCTATCTTGCGTCT | MN396754.1 |
R: CGTCAGGAAGCTCGTAGGAT |
Photoperiod (L:D) | Survival Rate (%) | Final Body Weight (g) | Weight Gain Rate (%) | Final Full Length (cm) | Total Length Gain Rate (%) | SGR (%) |
---|---|---|---|---|---|---|
0:24 | 35.67 ± 2.52 c | 0.96 ± 0.21 a | 2822.00 ± 168.50 a | 2.96 ± 0.13 a | 180.00 ± 22.54 | 0.11 ± 0.00 a |
6:18 | 49.67 ± 3.51 b | 0.64 ± 0.13 ab | 2093.00 ± 317.90 ab | 2.68 ± 0.16 ab | 154.00 ± 22.65 | 0.10 ± 0.01 ab |
12:12 | 54.17 ± 3.40 b | 0.48 ± 0.07 b | 1574.00 ± 100.80 b | 2.37 ± 0.14 b | 144.10 ± 20.56 | 0.09 ± 0.00 b |
18:6 | 74.17 ± 3.69 a | 0.53 ± 0.02 b | 1745.00 ± 306.50 b | 2.78 ± 0.09 ab | 163.70 ± 26.08 | 0.10 ± 0.01 b |
24:0 | 66.83 ± 2.26 a | 0.51 ± 0.17 b | 1721.00 ± 373.70 b | 2.86 ± 0.30 a | 169.30 ± 16.29 | 0.10 ± 0.00 ab |
Photoperiod (L:D) | 0:24 | 6:18 | 12:12 | 18:6 |
---|---|---|---|---|
6:18 | 0.53 | —— | —— | —— |
12:12 | 0.82 | 0.78 | —— | —— |
18:6 | 1.41 | 1.21 | 0.95 | —— |
24:0 | 2.02 | 1.55 | 1.23 | 0.84 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nie, X.; Huang, C.; Wei, J.; Wang, Y.; Hong, K.; Mu, X.; Liu, C.; Chu, Z.; Zhu, X.; Yu, L. Effects of Photoperiod on Survival, Growth, Physiological, and Biochemical Indices of Redclaw Crayfish (Cherax quadricarinatus) Juveniles. Animals 2024, 14, 411. https://doi.org/10.3390/ani14030411
Nie X, Huang C, Wei J, Wang Y, Hong K, Mu X, Liu C, Chu Z, Zhu X, Yu L. Effects of Photoperiod on Survival, Growth, Physiological, and Biochemical Indices of Redclaw Crayfish (Cherax quadricarinatus) Juveniles. Animals. 2024; 14(3):411. https://doi.org/10.3390/ani14030411
Chicago/Turabian StyleNie, Xiangxing, Cuixue Huang, Jie Wei, Yakun Wang, Kunhao Hong, Xidong Mu, Chao Liu, Zhangjie Chu, Xinping Zhu, and Lingyun Yu. 2024. "Effects of Photoperiod on Survival, Growth, Physiological, and Biochemical Indices of Redclaw Crayfish (Cherax quadricarinatus) Juveniles" Animals 14, no. 3: 411. https://doi.org/10.3390/ani14030411
APA StyleNie, X., Huang, C., Wei, J., Wang, Y., Hong, K., Mu, X., Liu, C., Chu, Z., Zhu, X., & Yu, L. (2024). Effects of Photoperiod on Survival, Growth, Physiological, and Biochemical Indices of Redclaw Crayfish (Cherax quadricarinatus) Juveniles. Animals, 14(3), 411. https://doi.org/10.3390/ani14030411