Use of Transcriptomics to Identify Candidate Genes for Hematopoietic Differences Between Wujin and Duroc Pigs
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Samples
2.2. Sample Collection
2.3. Determination of Blood Indexes
2.4. RNA Extraction, Quantification, and Qualification
2.5. Library Preparation and Sequencing
2.6. RNA-Seq Data Analysis
2.7. Functional Annotation of DEGs
2.8. Screening Important Candidate Genes
2.9. Validation of Important Candidate Genes
2.10. Statistical Analysis
3. Results
3.1. Blood Routine Examination
3.2. Serum Biochemical Indicators
3.3. Sequencing Results and Quality Control
3.4. Analysis of Differentially Expressed Genes
3.5. WGCNA Results
3.6. Screening and Relative Expression of Core Genes
4. Discussion
4.1. Differences in Blood Physiological and Biochemical Indices Between Wujin and Duroc Pigs
4.2. Transcriptomic Analysis
4.3. Key Differential Genes for Hematopoiesis in Wujin and Duroc Pigs
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Deng, M.L.; Feng, G.Y.; Li, R.; Yin, Y.L. Research Progress on Germplasm Characteristics and Nutrition of Wujin Pig. Chin. J. Anim. Nutr. 2024, 36, 2067–2078. [Google Scholar]
- Gao, L.; Xing, X.; Guo, R.; Li, Q.; Xu, Y.; Pan, H.; Ji, P.; Wang, P.; Yu, C.; Li, J.; et al. Effect of Different Dietary Iron Contents on Liver Transcriptome Characteristics in Wujin Pigs. Animals 2024, 14, 2399. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Zhang, C.; An, Q.; Pan, H.; Chen, K.; Guo, R. The Study of Hypoxia Adaptive Differences of Yunnan Wujin and Yuedawu Pigs. Acta Vet. Zootech. Sin. 2015, 46, 965–973. [Google Scholar]
- Zhang, C.; Chen, K.; Huang, J.; Guo, R. Glutaredoxin 1 and Thioredoxin 1: Gene Expression Characteristics in Different Tissues and Effects of L-Histidine on Gene Expressions in Oxidant Stress Cells of Yunnan Wujin Pigs. Chin. J. Anim. Nutr. 2012, 24, 2415–2423. [Google Scholar]
- Hamey, F.K.; Lau, W.W.; Kucinski, I.; Wang, X.; Diamanti, E.; Wilson, N.K.; Göttgens, B.; Dahlin, J.S. Single-cell molecular profiling provides a high-resolution map of basophil and mast cell development. Allergy 2020, 76, 1731–1742. [Google Scholar] [CrossRef]
- Cantor, A.B.; Orkin, S.H. Transcriptional regulation of erythropoiesis: An affair involving multiple partners. Oncogene 2002, 21, 3368–3376. [Google Scholar] [CrossRef]
- Rhodes, J.; Hagen, A.; Hsu, K.; Deng, M.; Liu, T.X.; Look, A.T.; Kanki, J.P. Interplay of pu. 1 and gata1 determines myelo-erythroid progenitor cell fate in zebrafish. Dev. Cell 2005, 8, 97–108. [Google Scholar] [CrossRef]
- Scott, E.W.; Simon, M.C.; Anastasi, J.; Singh, H. Requirement of transcription factor PU. 1 in the development of multiple hematopoietic lineages. Science 1994, 265, 1573–1577. [Google Scholar] [CrossRef]
- Brown, G.; Ceredig, R.; Tsapogas, P. The Making of Hematopoiesis: Developmental Ancestry and Environmental Nurture. Int. J. Mol. Sci. 2018, 19, 2122. [Google Scholar] [CrossRef]
- Jacobsen, S.E.; Nerlov, C. Haematopoiesis in the era of advanced single-cell technologies. Nat. Cell Biol. 2019, 21, 2–8. [Google Scholar] [CrossRef]
- Ding, L.; Saunders, T.L.; Enikolopov, G.; Morrison, S.J. Endothelial and perivascular cells maintain haematopoietic stem cells. Nature 2012, 481, 457–462. [Google Scholar] [CrossRef] [PubMed]
- Greenbaum, A.; Hsu, Y.M.; Day, R.B.; Schuettpelz, L.G.; Christopher, M.J.; Borgerding, J.N.; Nagasawa, T.; Link, D.C. CXCL12 in early mesenchymal progenitors is required for haematopoietic stem-cell maintenance. Nature 2013, 495, 227–230. [Google Scholar] [CrossRef]
- Li, W.; Wang, Y.; Chen, L.; An, X. Erythroblast island macrophages: Recent discovery and future perspectives. Blood Sci. 2019, 1, 61–64. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Guo, R.; Song, Y.; Jiang, Z. Erythroblastic island macrophages shape normal erythropoiesis and drive associated disorders in erythroid hematopoietic diseases. Front. Cell Dev. Biol. 2021, 8, 613885. [Google Scholar] [CrossRef] [PubMed]
- Bai, J.; Fan, F.; Gao, C.; Li, S.; Li, W.; Wei, T.; Cheng, S.; Yu, J.; Zheng, C.; Zhao, J.; et al. CD169-CD43 interaction is involved in erythroblastic island formation and erythroid differentiation. Haematologica 2023, 108, 2205. [Google Scholar] [CrossRef] [PubMed]
- Lévesque, J.P.; Summers, K.M.; Bisht, K.; Millard, S.M.; Winkler, I.G.; Pettit, A.R. Macrophages form erythropoietic niches and regulate iron homeostasis to adapt erythropoiesis in response to infections and inflammation. Exp. Hematol. 2021, 103, 1–14. [Google Scholar] [CrossRef]
- Storz, J.F.; Bautista, N.M. Altitude acclimatization, hemoglobin-oxygen affinity, and circulatory oxygen transport in hypoxia. Mol. Aspects Med. 2022, 84, 101052. [Google Scholar] [CrossRef]
- Cheng, Y.; Miller, M.J.; Zhang, D.; Xiong, Y.; Hao, Y.; Jia, C.; Cai, T.; Li, S.H.; Johansson, U.S.; Liu, Y.; et al. Parallel genomic responses to historical climate change and high elevation in East Asian songbirds. Proc. Natl. Acad. Sci. USA 2021, 118, e2023918118. [Google Scholar] [CrossRef]
- Ivy, C.M.; Wearing, O.H.; Natarajan, C.; Schweizer, R.M.; Gutiérrez-Pinto, N.; Velotta, J.P.; Campbell-Staton, S.C.; Petersen, E.E.; Fago, A.; Cheviron, Z.A.; et al. Genetic variation in haemoglobin is associated with evolved changes in breathing in high-altitude deer mice. J. Exp. Biol. 2022, 225, jeb243595. [Google Scholar]
- Storz, J.F. Hemoglobin–oxygen affinity in high-altitude vertebrates: Is there evidence for an adaptive trend? J. Exp. Biol. 2016, 219, 3190–3203. [Google Scholar] [CrossRef]
- Ivy, C.M.; Scott, G.R. Control of breathing and ventilatory acclimatization to hypoxia in deer mice native to high altitudes. Acta Physiol. 2017, 221, 266–282. [Google Scholar] [CrossRef] [PubMed]
- Meurens, F.; Summerfield, A.; Nauwynck, H.; Saif, L.; Gerdts, V. The pig: A model for human infectious diseases. Trends Microbiol. 2012, 20, 50–57. [Google Scholar] [CrossRef]
- Swindle, M.M.; Makin, A.; Herron, A.J.; Clubb, F.J., Jr.; Frazier, K.S. Swine as models in biomedical research and toxicology testing. Vet. Pathol. 2012, 49, 344–356. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Liang, Z.; Lu, T. Differentiation Potential Analysis of Bone Marrow Mesenchymal Stem Cells from Guizhou Miniature Pigs. Adv. Eng. Technol. Res. 2024, 9, 471. [Google Scholar] [CrossRef]
- Gerdts, V.; Wilson, H.L.; Meurens, F.; van Drunen Littel-van den Hurk, S.; Wilson, D.; Walker, S.; Wheler, C.; Townsend, H.; Potter, A.A. Large animal models for vaccine development and testing. ILAR J. 2015, 56, 53–62. [Google Scholar] [CrossRef] [PubMed]
- Gutierrez, K.; Dicks, N.; Glanzner, W.G.; Agellon, L.B.; Bordignon, V. Efficacy of the porcine species in biomedical research. Front. Genet. 2015, 6, 293. [Google Scholar] [CrossRef]
- Klymiuk, N.; Seeliger, F.; Bohlooly-Y, M.; Blutke, A.; Rudmann, D.G.; Wolf, E. Tailored pig models for preclinical efficacy and safety testing of targeted therapies. Toxicol. Pathol. 2016, 44, 346–357. [Google Scholar] [CrossRef]
- Pabst, R. The pig as a model for immunology research. Cell Tissue Res. 2020, 380, 287–304. [Google Scholar] [CrossRef]
- De Lange, C.F.M. New NRC (2012) Nutrient Requirements of Swine. Adv. Pork Prod. 2013, 24, 17–28. [Google Scholar]
- GB/T 39235-2020; Nutrient Requirements of Swine. China Livestock Standardization Technical Committee: Beijing, China, 2020.
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef]
- Mao, X.; Cai, T.; Olyarchuk, J.G.; Wei, L. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics 2005, 21, 3787–3793. [Google Scholar] [CrossRef] [PubMed]
- Langfelder, P.; Horvath, S. WGCNA: An R Package for Weighted Correlation Network Analysis. BMC Bioinform. 2008, 9, 559. [Google Scholar] [CrossRef] [PubMed]
- Alkhaldy, H.Y.; Awan, Z.A.; Abouzaid, A.A.; Elbahaey, H.M.; Al Amoudi, S.M.; Shehata, S.F.; Saboor, M. Effect of altitude on hemoglobin and red blood cell indices in adults in different regions of Saudi Arabia. Int. J. Gen. Med. 2022, 15, 3559–3565. [Google Scholar] [CrossRef]
- Wilkes, M.C.; Shibuya, A.; Sakamoto, K.M. Signaling pathways that regulate normal and aberrant red blood cell development. Genes 2021, 12, 1646. [Google Scholar] [CrossRef] [PubMed]
- Wiesener, M.S.; Jürgensen, J.S.; Rosenberger, C.; Scholze, C.K.; Hörstrup, J.H.; Warnecke, C.; Mandriota, S.; Bechmann, I.; Frei, U.A.; Pugh, C.W.; et al. Widespread hypoxia-inducible expression of HIF-2alpha in distinct cell populations of different organs. FASEB J. 2003, 17, 271–273. [Google Scholar] [CrossRef] [PubMed]
- Bracken, C.P.; Whitelaw, M.L.; Peet, D.J. The hypoxia-inducible factors: Key transcriptional regulators of hypoxic responses. Cell. Mol. Life Sci. 2003, 60, 1376–1393. [Google Scholar] [CrossRef]
- Metcalf, D. Hematopoietic cytokines. Blood 2008, 111, 485–491. [Google Scholar] [CrossRef]
- Song, J.; Sundar, K.M.; Hoidal, J.; Prchal, J.T. Hematological changes in chronic sustained hypoxia and chronic intermittent hypoxia in a mouse model. Blood 2019, 134, 3525. [Google Scholar] [CrossRef]
- Panday, S.; Talreja, R.; Kavdia, M. The role of glutathione and glutathione peroxidase in regulating cellular level of reactive oxygen and nitrogen species. Microvasc. Res. 2020, 131, 104010. [Google Scholar] [CrossRef]
- Aranda-Rivera, A.K.; Cruz-Gregorio, A.; Arancibia-Hernández, Y.L.; Hernández-Cruz, E.Y.; Pedraza-Chaverri, J. RONS and Oxidative Stress: An Overview of Basic Concepts. Oxygen 2022, 2, 437–478. [Google Scholar] [CrossRef]
- Shivakumar, A.; Yogendra Kumar, M.S. Critical review on the analytical mechanistic steps in the evaluation of antioxidant activity. Crit. Rev. Anal. Chem. 2018, 48, 214–236. [Google Scholar] [CrossRef] [PubMed]
- Sies, H.; Jones, D.P. Reactive oxygen species (ROS) as pleiotropic physiological signalling agents. Nat. Rev. Mol. Cell Biol. 2020, 21, 363–383. [Google Scholar] [CrossRef]
- Dong, H.; Li, H.; Fang, L.; Zhang, A.; Liu, X.; Xue, F.; Chen, Y.; Liu, W.; Chi, Y.; Wang, W.; et al. Increased reactive oxygen species lead to overactivation of platelets in essential thrombocythemia. Thromb. Res. 2023, 226, 18–29. [Google Scholar] [CrossRef] [PubMed]
- Ye, Z.W.; Zhang, J.; Townsend, D.M.; Tew, K.D. Oxidative stress, redox regulation and diseases of cellular differentiation. BBA-Gen. Subj. 2015, 1850, 1607–1621. [Google Scholar] [CrossRef] [PubMed]
- Ito, K.; Hirao, A.; Arai, F.; Takubo, K.; Matsuoka, S.; Miyamoto, K.; Ohmura, M.; Naka, K.; Hosokawa, K.; Ikeda, Y.; et al. Reactive oxygen species act through p38 MAPK to limit the lifespan of hematopoietic stem cells. Nat. Med. 2006, 12, 446–451. [Google Scholar] [CrossRef] [PubMed]
- Jang, Y.Y.; Sharkis, S.J. A low level of reactive oxygen species selects for primitive hematopoietic stem cells that may reside in the low-oxygenic niche. Blood 2007, 110, 3056–3063. [Google Scholar] [CrossRef]
- Ito, K.; Hirao, A.; Arai, F.; Matsuoka, S.; Takubo, K.; Hamaguchi, I.; Nomiyama, K.; Hosokawa, K.; Sakurada, K.; Nakagata, N.; et al. Regulation of oxidative stress by ATM is required for self-renewal of haematopoietic stem cells. Nature 2004, 431, 997–1002. [Google Scholar] [CrossRef]
- Anderson, G.A.; Rodriguez, M.; Kathrein, K.L. Regulation of stress-induced hematopoiesis. Curr. Opin. Hematol. 2020, 27, 279–287. [Google Scholar] [CrossRef]
- Salama, R.M.; Abbas, S.S.; Darwish, S.F.; Sallam, A.A.; Elmongy, N.F.; El Wakeel, S.A. Regulation of NOX/p38 MAPK/PPARα pathways and miR-155 expression by boswellic acids reduces hepatic injury in experimentally-induced alcoholic liver disease mouse model: Novel mechanistic insight. Arch. Pharm. Res. 2023, 46, 323–338. [Google Scholar] [CrossRef]
- Bousounis, P.; Bergo, V.; Trompouki, E. Inflammation, aging and hematopoiesis: A complex relationship. Cells 2021, 10, 1386. [Google Scholar] [CrossRef]
- Xu, Y.; Murphy, A.J.; Fleetwood, A.J. Hematopoietic progenitors and the bone marrow niche shape the inflammatory response and contribute to chronic disease. Int. J. Mol. Sci. 2022, 23, 2234. [Google Scholar] [CrossRef] [PubMed]
- Ho, N.P.Y.; Takizawa, H. Inflammation regulates haematopoietic stem cells and their niche. Int. J. Mol. Sci. 2022, 23, 1125. [Google Scholar] [CrossRef] [PubMed]
- Leimkühler, N.B.; Schneider, R.K. Inflammatory bone marrow microenvironment. Hematol. ASH Educ. Program 2019, 2019, 294–302. [Google Scholar] [CrossRef]
- Ali, M.A.; Park, C.Y. A new view of hematopoiesis during inflammation. Blood 2020, 136, 1117–1118. [Google Scholar] [CrossRef] [PubMed]
- Hosokawa, K.; Arai, F.; Yoshihara, H.; Nakamura, Y.; Gomei, Y.; Iwasaki, H.; Miyamoto, K.; Shima, H.; Ito, K.; Suda, T. Function of oxidative stress in the regulation of hematopoietic stem cell-niche interaction. Biochem. Biophys. Res. Commun. 2007, 363, 578–583. [Google Scholar] [CrossRef]
- Okita, K.; Yamanaka, S. Intracellular signaling pathways regulating pluripotency of embryonic stem cells. Curr. Stem Cell Res. Ther. 2006, 1, 103–111. [Google Scholar] [CrossRef] [PubMed]
- Staerk, J.; Constantinescu, S.N. The JAK-STAT pathway and hematopoietic stem cells from the JAK2 V617F perspective. Jak-Stat 2012, 1, 184–190. [Google Scholar] [CrossRef] [PubMed]
- Fasouli, E.S.; Katsantoni, E. JAK-STAT in early hematopoiesis and leukemia. Front. Cell Dev. Biol. 2021, 9, 669363. [Google Scholar]
- Zeng, J.; Yi, D.; Sun, W.; Liu, Y.; Chang, J.; Zhu, L.; Zhang, Y.; Pan, X.; Dong, Y.; Zhou, Y.; et al. Overexpression of HOXA9 upregulates NF-κB signaling to promote human hematopoiesis and alter the hematopoietic differentiation potentials. Cell Regen. 2021, 10, 9. [Google Scholar] [CrossRef]
- Krstic, A.; Mojsilovic, S.; Jovcic, G.; Bugarski, D. The potential of interleukin-17 to mediate hematopoietic response. Immunol. Res. 2012, 52, 34–41. [Google Scholar] [CrossRef]
- Broxmeyer, H.E. Chemokines in hematopoiesis. Curr. Opin. Hematol. 2008, 15, 49–58. [Google Scholar] [CrossRef]
- Land, S.C.; Tee, A.R. Hypoxia-inducible factor 1α is regulated by the mammalian target of rapamycin (mTOR) via an mTOR signaling motif. J. Biol. Chem. 2007, 282, 20534–20543. [Google Scholar] [CrossRef] [PubMed]
- Cheng, J.Q.; Lindsley, C.W.; Cheng, G.Z.; Yang, H.; Nicosia, S.V. The Akt/PKB pathway: Molecular target for cancer drug discovery. Oncogene 2005, 24, 7482–7492. [Google Scholar] [CrossRef] [PubMed]
- Carvalheira, J.B.; Ribeiro, E.B.; Folli, F.; Velloso, L.A.; Saad, M.J. Interaction between leptin and insulin signaling pathways differentially affects JAK-STAT and PI 3-kinase-mediated signaling in rat liver. Biol. Chem. 2005, 384, 151–159. [Google Scholar] [CrossRef] [PubMed]
- Santamaria, K.; Desmots, F.; Leonard, S.; Caron, G.; Haas, M.; Delaloy, C.; Chatonnet, F.; Rossille, D.; Pignarre, A.; Monvoisin, C.; et al. Committed Human CD23-Negative Light-Zone Germinal Center B Cells Delineate Transcriptional Program Supporting Plasma Cell Differentiation. Front. Immunol. 2021, 12, 744573. [Google Scholar] [CrossRef]
- Aranda, C.J.; Gonzalez-Kozlova, E.; Saunders, S.P.; Fernandes-Braga, W.; Ota, M.; Narayanan, S.; He, J.S.; Del Duca, E.; Swaroop, B.; Gnjatic, S.; et al. IgG Memory B Cells Expressing IL4R and FCER2 Are Associated with Atopic Diseases. Allergy 2023, 78, 752–766. [Google Scholar] [CrossRef]
- Chang, L.S.; Ming-Huey Guo, M.; Lo, M.H.; Kuo, H.C. Identification of Increased Expression of Activating Fc Receptors and Novel Findings Regarding Distinct IgE and IgM Receptors in Kawasaki Disease. Pediatr. Res. 2021, 89, 191–197. [Google Scholar] [CrossRef]
- Xu, X.; Chen, S.; Zhao, Z.; Xiao, X.; Huang, S.; Huo, Z.; Li, Y.; Tu, S. Consolidative Hematopoietic Stem Cell Transplantation After CD19 CAR-T Cell Therapy for Acute Lymphoblastic Leukemia: A Systematic Review and Meta-analysis. Front. Oncol. 2021, 11, 651944. [Google Scholar] [CrossRef]
- Silva-Gomes, R.; Mapelli, S.N.; Boutet, M.A.; Mattiola, I.; Sironi, M.; Grizzi, F.; Colombo, F.; Supino, D.; Carnevale, S.; Pasqualini, F.; et al. Differential Expression and Regulation of MS4A Family Members in Myeloid Cells in Physiological and Pathological Conditions. J. Leukocyte Biol. 2022, 111, 817–836. [Google Scholar] [CrossRef]
- Liu, F.; Yuan, Y.; Bai, L.; Yuan, L.; Li, L.; Liu, J.; Chen, Y.; Lu, Y.; Cheng, J.; Zhang, J. LRRc17 Controls BMSC Senescence Via Mitophagy and Inhibits the Therapeutic Effect of BMSCs on Ovariectomy-induced Bone Loss. Redox Biol. 2021, 43, 101963. [Google Scholar] [CrossRef]
- Li, S.; Yao, J.C.; Oetjen, K.A.; Krambs, J.R.; Xia, J.; Zhang, J.; Schmidt, A.P.; Helton, N.M.; Fulton, R.S.; Heath, S.E.; et al. IL-1β Expression in Bone Marrow Dendritic Cells is Induced by TLR2 Agonists and Regulates HSC Function. Blood 2022, 140, 1607–1620. [Google Scholar] [CrossRef] [PubMed]
- Pietras, E.M.; Mirantes-Barbeito, C.; Fong, S.; Loeffler, D.; Kovtonyuk, L.V.; Zhang, S.; Lakshminarasimhan, R.; Chin, C.P.; Techner, J.M.; Will, B.; et al. Chronic Interleukin-1 Exposure Drives Haematopoietic Stem Cells Towards Precocious Myeloid Differentiation at the Expense of Self-renewal. Nat. Cell Biol. 2016, 18, 607–618. [Google Scholar] [CrossRef] [PubMed]
- Fok, E.T.; Moorlag, S.J.; Negishi, Y.; Groh, L.A.; Dos Santos, J.C.; Gräwe, C.; Monge, V.V.; Craenmehr, D.D.; van Roosmalen, M.; da Cunha Jolvino, D.P.; et al. A Chromatin-regulated Biphasic Circuit Coordinates IL-1β-mediated Inflammation. Nat. Genet. 2024, 56, 85–99. [Google Scholar] [CrossRef] [PubMed]
- Lin, X.; Lv, X.; Li, B.; Meng, Q.; Lai, H.; Gong, Q.; Tong, Z. Heterogeneity of T cells in periapical lesions and in vitro validation of the proangiogenic effect of GZMA on HUVECs. Int. Endod. J. 2003, 56, 1254–1269. [Google Scholar] [CrossRef] [PubMed]
- Lieberman, J. Granzyme A activates another way to die. Immunol. Rev. 2020, 235, 93–104. [Google Scholar] [CrossRef]
- Metkar, S.S.; Menaa, C.; Pardo, J.; Wang, B.; Wallich, R.; Freudenberg, M.; Kim, S.; Raja, S.M.; Shi, L.; Simon, M.M.; et al. Human and mouse granzyme A induce a proinflammatory cytokine response. Immunity 2008, 29, 720–733. [Google Scholar] [CrossRef]
- Zhou, Z.; He, H.; Wang, K.; Shi, X.; Wang, Y.; Su, Y.; Wang, Y.; Li, D.; Liu, W.; Zhang, Y.; et al. Granzyme A from cytotoxic lymphocytes cleaves GSDMB to trigger pyroptosis in target cells. Science 2020, 368, 7548. [Google Scholar] [CrossRef]
- Seiler, K.; Minder, P.; Mashimo, I.; Humbert, M.; Simpson, E.; Tschan, M.P.; Torbett, B.E. Hexokinase proteins impart distinct functions in myeloid development and cell death. Blood 2018, 132, 5088. [Google Scholar] [CrossRef]
- Casirati, G.; Cosentino, A.; Mucci, A.; Salah Mahmoud, M.; Ugarte Zabala, I.; Zeng, J.; Ficarro, S.B.; Klatt, D.; Brendel, C.; Rambaldi, A.; et al. Epitope editing enables targeted immunotherapy of acute myeloid leukaemia. Nature 2023, 621, 404–414. [Google Scholar] [CrossRef]
- Lei, Y.; Klionsky, D.J. MCOLN3/TRPML3 bridges the regulation of autophagosome biogenesis by PtdIns3P and the calcium channel. Autophagy 2023, 19, 377–378. [Google Scholar] [CrossRef]
- Kim, S.W.; Kim, D.H.; Park, K.S.; Kim, M.K.; Park, Y.M.; Muallem, S.; So, I.; Kim, H.J. Palmitoylation controls trafficking of the intracellular Ca2+ channel MCOLN3/TRPML3 to regulate autophagy. Autophagy 2019, 15, 327–340. [Google Scholar] [CrossRef] [PubMed]
- Ragland, S.A.; Criss, A.K. From bacterial killing to immune modulation: Recent insights into the functions of lysozyme. PLoS Pathog. 2017, 13, e1006512. [Google Scholar] [CrossRef] [PubMed]
- Qin, P.; Pang, Y.; Hou, W.; Fu, R.; Zhang, Y.; Wang, X.; Meng, G.; Liu, Q.; Zhu, X.; Hong, N.; et al. Integrated decoding hematopoiesis and leukemogenesis using single-cell sequencing and its medical implication. Cell Discov. 2021, 7, 2. [Google Scholar] [CrossRef] [PubMed]
- Gowhari Shabgah, A.; Al-Obaidi, Z.M.J.; Sulaiman Rahman, H.; Kamal Abdelbasset, W.; Suksatan, W.; Bokov, D.O.; Thangavelu, L.; Turki Jalil, A.; Jadidi-Niaragh, F.; Mohammadi, H. Does CCL19 act as a double-edged sword in cancer development? Clin. Exp. Immunol. 2022, 207, 164–175. [Google Scholar] [CrossRef]
Ingredient | Content (%) | Nutrient Level | Content |
---|---|---|---|
Corn | 30.0 | CP (%) | 19.0 |
Soybean meal | 15.0 | Ca (%) | 0.80 |
Expanded soybean | 15.0 | Fe * (%) | 0.02 |
Whey powder | 12.0 | AP (%) | 0.42 |
Rice | 10.0 | Lys (%) | 1.22 |
Flour | 6.0 | Met (%) | 0.39 |
Glucose | 4.0 | Methionine + cystine (%) | 0.67 |
Peruvian fish meal | 3.0 | Thr (%) | 0.77 |
Citric acid | 1.50 | Trp (%) | 0.23 |
Vegetable oil | 1.00 | DE (MJ/kg) | 13.38 |
Fine stone powder | 0.84 | ||
Calcium hydrogen phosphate | 0.81 | ||
Lysine | 0.18 | ||
Fungicide | 0.10 | ||
DL-methionine | 0.08 | ||
Premix | 0.49 |
Gene ID | Primer Sequence (5′-3′) | Amplification Length/bp |
---|---|---|
LYZ | F:GCAAGACACCCAAAGCAGTT | 178 |
R:CCCCGAATGTACTGCGAGAC | ||
HK2 | F:CCTTGGCCCGCTGAGATAAA | 117 |
R:CCACGGGGATTAGCAAAGGT | ||
LOC102167454 | F:CAGGAGGGGAAGGACAAACG | 188 |
R:CGGGCTAAGGGTTGTCTTGA | ||
LOC110258617 | F:CCGTAGCAGGAAATGTGGCT | 224 |
R:TTCACTAGAGCAGTTATCATCAGCA | ||
MCOLN3 | F:GGGGTAGGGAGCAGTTAGGA | 198 |
R:AGTCGCCAACAGGATGGAAG | ||
IRAK3 | F:TCCCACATCCCTGAAGTCCT | 230 |
R:TGCAGGCATCCTCATTCCTC | ||
CYP3A29 | F:AGGACTTGGGCTTTGATGGTC | 250 |
R:ATACTAGGTGGGGGTGGATGG | ||
SAMD7 | F:TGCAACTATGCCGAACATGC | 221 |
R:TGGGGCCATAGAGGAAAGGT | ||
TMSB15B | F:CCAGCAGGAGAAAGAGTGTGT | 165 |
R:GCCAGGCATTACAGGTGAGA | ||
LOC106504983 | F:GACCCTGAGACGCACACAA | 152 |
R:TAGAGGTGATGTGCTGGGTG | ||
FCER2 | F:CTTTGGTGAGACGGCCAAGA | 151 |
R:CAGGTCCCGAAGACCAATCC | ||
AQP3 | F:CACCTACCCCTCTGGACACT | 200 |
R:TGACGGCATAGCCAGAGTTG | ||
PLA2G2D | F:CGCAACCCCCAAAGGATCTA | 128 |
R:CAAGTGGCAGACCCATTCCT | ||
MS4A1 | F:ACTGCTCGCTTCCAAACTGA | 107 |
R:TTCTGGGCGTCGTCATTTCA | ||
CCL19 | F:CGCTACCTGCTCATTCGAGA | 117 |
R:TCTCTTGATGATGCGCTCCAC | ||
GZMA | F:TGACCTGAAAGGCAACCCTC | 229 |
R:GGTGTGGGGTTCGACATCTT | ||
ACTB | F:GCGGCATCCACGAAACTA | 75 |
R:TGTTGGCGTAGAGGTCCTT |
Items | DGB | WGB |
---|---|---|
Leukocyte (×109/L) | 17.96 ± 3.28 | 16.5 ± 4.7 |
Lymphocyte (×109/L) | 8.9 ± 2.46 | 5.78 ± 3.18 |
monocytes (×109/L) | 1.96 ± 0.27 | 1.78 ± 1.1 |
Neutrophil (×109/L) | 7.1 ± 1.48 | 8.9 ± 1.65 |
Lymphocytes percentage (%) | 49.4 ± 6.18 | 32.83 ± 15.3 |
Monocyte percentage (%) | 10.68 ± 1.04 | 9.85 ± 4.45 |
Neutrophils percentage (%) | 39.92 ± 6.42 | 57 ± 18.67 |
Erythrocyte (×1012/L) | 7.52 ± 0.8 | 7.97 ± 1.23 |
Hemoglobin (g/L) | 12.9 ± 1 | 13.93 ± 1.38 * |
Packed cell volume (%) | 39.04 ± 3.55 | 39.85 ± 2.85 |
Mean corpuscular volume (fL) | 51.96 ± 0.96 | 50.35 ± 3.63 |
Mean corpuscular hemoglobin (pg) | 17.22 ± 0.54 | 17.6 ± 0.87 |
Mean corpuscular hemoglobin concentration (g/L) | 33.2 ± 0.84 | 35 ± 0.82 * |
Red cell distribution width (CV%) | 17.76 ± 0.36 | 16.83 ± 0.85 |
Red cell distribution width (SD fL) | 37.84 ± 1.35 | 35.28 ± 4.08 |
Platelet (×109/L) | 274.8 ± 22.6 * | 194.75 ± 47.35 |
MPV (fL) | 5.9 ± 0.35 | 6.1 ± 0.42 |
Items | DGB | WGB |
---|---|---|
EPO/mIU·mL−1 | 4.90 ± 0.53 | 4.89 ± 0.23 |
Hb/μg·mL−1 | 68.64 ± 2.74 * | 61.41 ± 1.79 |
HIF1/pg·mL−1 | 394.5 ± 33.98 | 374.22 ± 31.04 |
GSH-PX | 860.38 ± 212.72 | 1005.28 ± 486.88 |
MDA/nmol·mL−1 | 1.81 ± 0.30 | 2.34 ± 1.43 |
Samples | Clean Reads | Clean Bases | GC Content (%) | % ≥ Q30 (%) | Total Reads | Mapped Reads | Uniq Mapped Reads |
---|---|---|---|---|---|---|---|
DGB2 | 28,469,394 | 8,500,924,602 | 52.98% | 94.79% | 56,938,788 | 55,474,814 (97.43%) | 47,137,369 (82.79%) |
DGB3 | 22,764,914 | 6,806,034,552 | 52.19% | 94.89% | 45,529,828 | 44,345,494 (97.40%) | 40,143,984 (88.17%) |
DGB4 | 27,326,906 | 8,165,439,618 | 53.35% | 95.19% | 54,653,812 | 53,293,026 (97.51%) | 45,501,090 (83.25%) |
DGB5 | 28,422,180 | 8,489,993,794 | 53.89% | 95.16% | 56,844,360 | 55,424,264 (97.50%) | 46,814,234 (82.36%) |
DGB6 | 19,245,459 | 5,756,626,694 | 53.40% | 95.24% | 38,490,918 | 37,528,942 (97.50%) | 32,209,925 (83.68%) |
WGB1 | 29,770,100 | 8,889,006,784 | 54.00% | 95.04% | 59,540,200 | 57,897,952 (97.24%) | 48,075,857 (80.75%) |
WGB2 | 28,121,773 | 8,406,190,620 | 53.39% | 94.98% | 56,243,546 | 54,447,710 (96.81%) | 46,307,875 (82.33%) |
WGB3 | 27,338,088 | 8,161,849,630 | 53.03% | 94.82% | 54,676,176 | 53,120,625 (97.15%) | 46,529,517 (85.10%) |
WGB5 | 25,699,553 | 7,686,844,086 | 52.47% | 94.69% | 51,399,106 | 49,937,139 (97.16%) | 44,979,012 (87.51%) |
WGB6 | 27,510,543 | 8,229,104,936 | 50.65% | 94.64% | 55,021,086 | 53,772,021 (97.73%) | 50,942,780 (92.59%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ji, P.; Wang, P.; Li, Q.; Gao, L.; Xu, Y.; Pan, H.; Zhang, C.; Li, J.; Yao, J.; An, Q. Use of Transcriptomics to Identify Candidate Genes for Hematopoietic Differences Between Wujin and Duroc Pigs. Animals 2024, 14, 3507. https://doi.org/10.3390/ani14233507
Ji P, Wang P, Li Q, Gao L, Xu Y, Pan H, Zhang C, Li J, Yao J, An Q. Use of Transcriptomics to Identify Candidate Genes for Hematopoietic Differences Between Wujin and Duroc Pigs. Animals. 2024; 14(23):3507. https://doi.org/10.3390/ani14233507
Chicago/Turabian StyleJi, Peng, Ping Wang, Qihua Li, Lin Gao, Yan Xu, Hongbin Pan, Chunyong Zhang, Jintao Li, Jun Yao, and Qingcong An. 2024. "Use of Transcriptomics to Identify Candidate Genes for Hematopoietic Differences Between Wujin and Duroc Pigs" Animals 14, no. 23: 3507. https://doi.org/10.3390/ani14233507
APA StyleJi, P., Wang, P., Li, Q., Gao, L., Xu, Y., Pan, H., Zhang, C., Li, J., Yao, J., & An, Q. (2024). Use of Transcriptomics to Identify Candidate Genes for Hematopoietic Differences Between Wujin and Duroc Pigs. Animals, 14(23), 3507. https://doi.org/10.3390/ani14233507