Transcriptomic Analysis Reveals the Effects of miR-122 Overexpression in the Liver of Qingyuan Partridge Chickens
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Statement of Ethics
2.2. Establishment and Identification of Lentivirus-Mediated miR-122-5p Overexpression Vector
2.3. Animals and Breeding Management
2.4. RNA Extraction, Real-Time Reverse Transcription PCR, and Deep Sequencing
2.5. Quality Control
2.6. Statistical Analysis of Differentially Expressed Genes and Functional Enrichment Analysis
2.7. Gene Set Enrichment Analysis (GSEA)
2.8. Predicting the Target Genes of miR-122-5p
2.9. Statistical Analysis
3. Results
3.1. Establishment of an Overexpression Animal Model for miR-122
3.2. Transcriptome Data Quality Control Results
3.3. Identification of Differentially Expressed Genes
3.4. Functional Enrichment Analysis of DEGs: GO and KEGG Pathway Analysis
3.5. Gene Set Enrichment Analysis of DEGs
3.6. Target-Gene Prediction Results
3.7. Target Gene qRT-PCR Measurement Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wei, R.; Han, C.; Deng, D.; Ye, F.; Gan, X.; Liu, H.; Li, L.; Xu, H.; Wei, S. Research progress into the physiological changes in metabolic pathways in waterfowl with hepatic steatosis. Brit. Poult. Sci. 2021, 62, 118–124. [Google Scholar] [CrossRef] [PubMed]
- Leveille, G.A.; O’Hea, E.K.; Chakrabarty, K. In Vivo Lipogenesis in the Domestic Chicken. Proc. Soc. Exp. Biol. Med. 1968, 128, 398–401. [Google Scholar] [CrossRef] [PubMed]
- Julian, R.J. Production and growth related disorders and other metabolic diseases of poultry—A review. Vet. J. 2005, 169, 350–369. [Google Scholar] [CrossRef]
- Claire, D.; Andre, H.; Paul, W.; Shen, X.; Jia, X.; Zhang, R.; Sun, L.; Zhang, X. Identification and characterization of genes that control fat deposition in chickens. J. Anim. Sci. Biotechnol. 2013, 4, 43. [Google Scholar] [CrossRef]
- Alshamy, Z.; Richardson, K.C.; Harash, G.; Hünigen, H.; Röhe, I.; Hafez, H.M.; Plendl, J.; Al Masri, S. Structure and age-dependent growth of the chicken liver together with liver fat quantification: A comparison between a dual-purpose and a broiler chicken line. PLoS ONE 2019, 14, e226903. [Google Scholar] [CrossRef]
- Tian, W.; Wang, Z.; Yue, Y.; Li, H.; Li, Z.; Han, R.; Tian, Y.; Kang, X.; Liu, X. miR-34a-5p Increases Hepatic Triglycerides and Total Cholesterol Levels by Regulating ACSL1 Protein Expression in Laying Hens. Int. J. Mol. Sci. 2019, 20, 4420. [Google Scholar] [CrossRef] [PubMed]
- Xu, E.; Zhang, L.; Yang, H.; Shen, L.; Feng, Y.; Ren, M.; Xiao, Y. Transcriptome profiling of the liver among the prenatal and postnatal stages in chickens. Poult. Sci. 2019, 98, 7030–7040. [Google Scholar] [CrossRef]
- Bernstein, E.; Caudy, A.A.; Hammond, S.M.; Hannon, G.J. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 2001, 409, 363–366. [Google Scholar] [CrossRef]
- Ambros, V. The functions of animal microRNAs. Nature 2004, 431, 350–355. [Google Scholar] [CrossRef]
- Zhang, B.; Pan, X.; Cobb, G.P.; Anderson, T.A. microRNAs as oncogenes and tumor suppressors. Dev. Biol. 2007, 302, 1–12. [Google Scholar] [CrossRef]
- Kosaka, N.; Iguchi, H.; Yoshioka, Y.; Takeshita, F.; Matsuki, Y.; Ochiya, T. Secretory Mechanisms and Intercellular Transfer of MicroRNAs in Living Cells. J. Biol. Chem. 2010, 285, 17442–17452. [Google Scholar] [CrossRef]
- Huang, Y.; Shen, X.J.; Zou, Q.; Wang, S.P.; Tang, S.M.; Zhang, G.Z. Biological functions of microRNAs: A review. J. Physiol. Biochem. 2011, 67, 129–139. [Google Scholar] [CrossRef] [PubMed]
- Pandita, A.; Basnet, A.; Ramadas, P.; Poudel, A.; Anand, A.; Saad, N.; Akbar, S.A.; Chaudhry, S.I.; Middleton, F.; Gilligan, D.M. Micro RNAs in Acute Myeloid Leukemia. Blood 2016, 128, 5252. [Google Scholar] [CrossRef]
- Guoan, Z. Significance of non-coding circular RNAs and micro RNAs in the pathogenesis of cardiovascular diseases. J. Med. Genet. 2018, 55, 713. [Google Scholar] [CrossRef]
- Cui, Z.; Liu, L.; Kwame Amevor, F.; Zhu, Q.; Wang, Y.; Li, D.; Shu, G.; Tian, Y.; Zhao, X. High Expression of miR-204 in Chicken Atrophic Ovaries Promotes Granulosa Cell Apoptosis and Inhibits Autophagy. Front. Cell Dev. Biol. 2020, 8, 580072. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Li, X.; Li, M.; Sun, Y.; Shi, Y.; Ma, T. miR-140-3p promotes follicle granulosa cell proliferation and steroid hormone synthesis via targeting AMH in chickens. Theriogenology 2023, 202, 84–92. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Chen, Y.; Wu, S.; Tang, J.; Chen, G.; Li, F. miR-135a Suppresses Granulosa Cell Growth by Targeting Tgfbr1 and Ccnd2 during Folliculogenesis in Mice. Cells 2021, 10, 2104. [Google Scholar] [CrossRef]
- Bandiera, S.; Pfeffer, S.; Baumert, T.F.; Zeisel, M.B. miR-122—A key factor and therapeutic target in liver disease. J. Hepatol. 2015, 62, 448–457. [Google Scholar] [CrossRef]
- Thakral, S.; Ghoshal, K. miR-122 is a Unique Molecule with Great Potential in Diagnosis, Prognosis of Liver Disease, and Therapy Both as miRNA Mimic and Antimir. Curr. Gene Ther. 2015, 15, 142–150. [Google Scholar] [CrossRef]
- Wu, S.; Guo, W.; Liang, S.; Lu, H.; Sun, W.; Ren, X.; Sun, Q.; Yang, X. Systematic analysis of the regulatory roles of microRNAs in postnatal maturation and metergasis of liver of breeder cocks. Sci. Rep. 2018, 8, 61. [Google Scholar] [CrossRef]
- Chai, C.; Rivkin, M.; Berkovits, L.; Simerzin, A.; Zorde-Khvalevsky, E.; Rosenberg, N.; Klein, S.; Yaish, D.; Durst, R.; Shpitzen, S.; et al. Metabolic Circuit Involving Free Fatty Acids, microRNA 122, and Triglyceride Synthesis in Liver and Muscle Tissues. Gastroenterology 2017, 153, 1404–1415. [Google Scholar] [CrossRef] [PubMed]
- Valdmanis, P.N.; Kim, H.K.; Chu, K.; Zhang, F.; Xu, J.; Munding, E.M.; Shen, J.; Kay, M.A. miR-122 removal in the liver activates imprinted microRNAs and enables more effective microRNA-mediated gene repression. Nat. Commun. 2018, 9, 5321. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; He, J.; Xiao, Z.; Zhang, Q.; Chen, Y.; Zhou, H.; Qu, L. Liver-enriched transcription factors regulate MicroRNA-122 that targets CUTL1 during liver development. Hepatology 2010, 52, 1431–1442. [Google Scholar] [CrossRef] [PubMed]
- Laudadio, I.; Manfroid, I.; Achouri, Y.; Schmidt, D.; Wilson, M.D.; Cordi, S.; Thorrez, L.; Knoops, L.; Jacquemin, P.; Schuit, F.; et al. A Feedback Loop Between the Liver-Enriched Transcription Factor Network and Mir-122 Controls Hepatocyte Differentiation. Gastroenterology 2012, 142, 119–129. [Google Scholar] [CrossRef] [PubMed]
- Kim, N.; Kim, H.; Jung, I.; Kim, Y.; Kim, D.; Han, Y. Expression profiles of miRNAs in human embryonic stem cells during hepatocyte differentiation. Hepatol. Res. 2011, 41, 170–183. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.; Ewing, L.E.; Koturbash, I.; Gurley, B.J.; Miousse, I.R. MicroRNAs as biomarkers for liver injury: Current knowledge, challenges and future prospects. Food Chem. Toxicol. 2017, 110, 229–239. [Google Scholar] [CrossRef] [PubMed]
- Krützfeldt, J.; Rajewsky, N.; Braich, R.; Rajeev, K.G.; Tuschl, T.; Manoharan, M.; Stoffel, M. Silencing of microRNAs in vivo with ‘antagomirs’. Nature 2005, 438, 685–689. [Google Scholar] [CrossRef] [PubMed]
- Esau, C.; Davis, S.; Murray, S.F.; Yu, X.X.; Pandey, S.K.; Pear, M.; Watts, L.; Booten, S.L.; Graham, M.; McKay, R.; et al. miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. Cell Metab. 2006, 3, 87–98. [Google Scholar] [CrossRef] [PubMed]
- Hsu, S.; Wang, B.; Kota, J.; Yu, J.; Costinean, S.; Kutay, H.; Yu, L.; Bai, S.; La Perle, K.; Chivukula, R.R.; et al. Essential metabolic, anti-inflammatory, and anti-tumorigenic functions of miR-122 in liver. J. Clin. Investig. 2012, 122, 2871–2883. [Google Scholar] [CrossRef]
- Hsu, S.H.; Delgado, E.R.; Otero, P.A.; Teng, K.Y.; Kutay, H.; Meehan, K.M.; Moroney, J.B.; Monga, J.K.; Hand, N.J.; Friedman, J.R.; et al. MicroRNA-122 regulates polyploidization in the murine liver. Hepatology 2016, 64, 599–615. [Google Scholar] [CrossRef]
- Xu, H.; Wang, X.; Du, Z.; Li, N. Identification of microRNAs from different tissues of chicken embryo and adult chicken. FEBS Lett. 2006, 580, 3610–3616. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Shao, F.; Yu, J.; Jiang, H.; Gong, D.; Gu, Z. MicroRNA-122 targets genes related to liver metabolism in chickens. Comp. Biochem. Phys. B 2015, 184, 29–35. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Wang, X.; Yu, J.; Shao, F.; Zhang, Y.; Lu, X.; Gu, Z. MiR-122 targets the vanin 1 gene to regulate its expression in chickens. Poult. Sci. 2016, 95, 1145–1150. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Yu, J.; Shao, F.; Zhang, Y.; Li, Y.; Lu, X.; Gong, D.; Gu, Z. microRNA-122 targets the P4HA1 mRNA and regulates its expression in chicken hepatocytes. Ital. J. Anim. Sci. 2019, 18, 587–593. [Google Scholar] [CrossRef]
- Qi, J.; Wang, H.; Zhou, G.; Xu, X.; Li, X.; Bai, Y.; Yu, X. Evaluation of the taste-active and volatile compounds in stewed meat from the Chinese yellow-feather chicken breed. Int. J. Food Prop. 2017, 20, S2579–S2595. [Google Scholar] [CrossRef]
- Zhang, W.; Naveena, B.M.; Jo, C.; Sakata, R.; Zhou, G.; Banerjee, R.; Nishiumi, T. Technological demands of meat processing–An Asian perspective. Meat Sci. 2017, 132, 35–44. [Google Scholar] [CrossRef] [PubMed]
- Xu, N.; Ye, J.; Li, L.; Wang, X.; Wang, P.; Han, M.; Xu, X. Exploration of flavor and taste of soft-boiled chicken at different post-mortem aging time: Based on GC-IMS and multivariate statistical analysis. Food Biosci. 2021, 43, 101326. [Google Scholar] [CrossRef]
- Deng, S.; Xing, T.; Li, C.; Xu, X.; Zhou, G. The Effect of Breed and Age on the Growth Performance, Carcass Traits and Metabolic Profile in Breast Muscle of Chinese Indigenous Chickens. Foods 2022, 11, 483. [Google Scholar] [CrossRef] [PubMed]
- Yuan, C.; Jiang, Y.; Wang, Z.; Chen, G.; Bai, H.; Chang, G. Indigenous, Yellow-Feathered Chickens Body Measurements, Carcass Traits, and Meat Quality Depending on Marketable Age. Animals 2022, 12, 2422. [Google Scholar] [CrossRef]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R.; Genome, P.D.P.S. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef]
- Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef]
- Goodridge, A.G.; Ball, E.G. Lipogenesis in the pigeon: In vivo studies. Am. J. Physiol. Leg. Content 1967, 213, 245–249. [Google Scholar] [CrossRef]
- O’Hea, E.K.; Leveille, G.A. Lipogenesis in isolated adipose tissue of the domestic chick (Gallus domesticus). Comp. Biochem. 1968, 26, 111–120. [Google Scholar] [CrossRef]
- O’Hea, E.K.; Leveille, G.A. Lipid biosynthesis and transport in the domestic chick (Gallus domesticus). Comp. Biochem. 1969, 30, 149–159. [Google Scholar] [CrossRef]
- Sivaprakasam, S.; Sikder, M.O.F.; Ramalingam, L.; Kaur, G.; Dufour, J.M.; Moustaid-Moussa, N.; Wachtel, M.S.; Ganapathy, V. SLC6A14 deficiency is linked to obesity, fatty liver, and metabolic syndrome but only under conditions of a high-fat diet. Biochim. Biophys. Acta Mol. Basis Dis. 2021, 1867, 166087. [Google Scholar] [CrossRef]
- Zhang, L. Studies on Genetic Parameters for and Candidate Genes Associated with Egg Quality Traits in Chickens. Ph.D. Dissertation, China Agricultural University, Beijing, China, 2007. [Google Scholar]
- Sheng, Q.; Cao, D.; Zhou, Y.; Lei, Q.; Han, H.; Li, F.; Lu, Y.; Wang, C. Detection of SNPs in the Cathepsin D Gene and Their Association with Yolk Traits in Chickens. PLoS ONE 2013, 8, e56656. [Google Scholar] [CrossRef]
- Zheng, Q.; Yang, Q.; Zhou, J.; Gu, X.; Zhou, H.; Dong, X.; Zhu, H.; Chen, Z. Immune signature-based hepatocellular carcinoma subtypes may provide novel insights into therapy and prognosis predictions. Cancer Cell Int. 2021, 21, 330. [Google Scholar] [CrossRef]
- Banet, N.; Masnick, M.; Quddus, M.R. Evaluation of Saccharomyces cerevisiae–like 1 (SEC14L1) in Gynecologic Malignancies Shows Overexpression in Endometrial Serous Carcinoma. Int. J. Gynecol. Pathol. 2023, 42, 136–142. [Google Scholar] [CrossRef]
- Vazquez-Chantada, M.; Gonzalez-Lahera, A.; Martinez-Arranz, I.; Garcia-Monzon, C.; Regueiro, M.M.; Garcia-Rodriguez, J.L.; Schlangen, K.A.; Mendibil, I.; Rodriguez-Ezpeleta, N.; Lozano, J.J.; et al. Solute carrier family 2 member 1 is involved in the development of nonalcoholic fatty liver disease. Hepatology 2013, 57, 505–514. [Google Scholar] [CrossRef]
- Shang, X.; Moon, S.Y.; Zheng, Y. p200 RhoGAP Promotes Cell Proliferation by Mediating Cross-talk between Ras and Rho Signaling Pathways*. J. Biol. Chem. 2007, 282, 8801–8811. [Google Scholar] [CrossRef]
- Nakamura, T.; Arima-Yoshida, F.; Sakaue, F.; Nasu-Nishimura, Y.; Takeda, Y.; Matsuura, K.; Akshoomoff, N.; Mattson, S.N.; Grossfeld, P.D.; Manabe, T.; et al. PX-RICS-deficient mice mimic autism spectrum disorder in Jacobsen syndrome through impaired GABAA receptor trafficking. Nat. Commun. 2016, 7, 10861. [Google Scholar] [CrossRef]
- Guo, D.; Yang, X.; Shi, L. Rho GTPase Regulators and Effectors in Autism Spectrum Disorders: Animal Models and Insights for Therapeutics. Cells 2020, 9, 835. [Google Scholar] [CrossRef]
- Xu, Z.; Gu, C.; Yao, X.; Guo, W.; Wang, H.; Lin, T.; Li, F.; Chen, D.; Wu, J.; Ye, G.; et al. CD73 promotes tumor metastasis by modulating RICS/RhoA signaling and EMT in gastric cancer. Cell Death Dis. 2020, 11, 202. [Google Scholar] [CrossRef]
- Leal-Gutiérrez, J.D.; Elzo, M.A.; Mateescu, R.G. Identification of eQTLs and sQTLs associated with meat quality in beef. BMC Genom. 2020, 21, 104. [Google Scholar] [CrossRef]
- Saravanan, K.A.; Panigrahi, M.; Kumar, H.; Bhushan, B.; Dutt, T.; Mishra, B.P. Genome-wide analysis of genetic diversity and selection signatures in three Indian sheep breeds. Livest. Sci. 2021, 243, 104367. [Google Scholar] [CrossRef]
- Kawakami, Y.; Esteban, C.R.; Matsui, T.; Rodríguez-León, J.; Kato, S.; Belmonte, J.C.I. Sp8 and Sp9, two closely related buttonhead-like transcription factors, regulate Fgf8expression and limb outgrowth in vertebrate embryos. Development 2004, 131, 4763–4774. [Google Scholar] [CrossRef] [PubMed]







| Gene | Direction | Sequence (5′-3′) | Tm (°C) | Product Size (bp) |
|---|---|---|---|---|
| gga-miR-122-5p | F | GATGCTCTGGAGTGTGACAATG | 60 | 127 |
| R | TATGGTTGTTCACGACTCCTTCAC | |||
| U6 | F | CGCTTCGGCAGCACATATAC | 60 | 148 |
| R | TTCACGAATTTGCGTGTCATC | |||
| GAPDH | F | TCTTCACCACCATGGAGAAG | 60 | 154 |
| R | CAGGACGCATTGCTGACAAT | |||
| ARHGAP32/ARHGAP33 | F | GACAACTGGAAGGACAGGGC | 60 | 84 |
| R | ACCCCAGCAGCATCTCTTTC | |||
| CTSD | F | ACAGCCATTGGTGCAAAACC | 59 | 80 |
| R | GTGACAACAGGCAGAGACGA | |||
| LBH | F | GCCGGGACTTCATGTCTGTG | 61 | 133 |
| R | GAGAGCCCATCTTTACGGGG | |||
| PLEKHB2 | F | CGCGGCGGCTTTCGATTAAG | 61 | 121 |
| R | CAAACGGCCATCAGACCACA | |||
| SEC14L1 | F | CGGTTGGAGCTGACCTTCAT | 60 | 127 |
| R | TCAGCGGGCATGTAGGAAAC | |||
| SLC2A1 | F | CAAGATGACAGCTCGCCTGATG | 61 | 150 |
| R | ATGGGCTCCTCATACGGTACA | |||
| SLC6A14 | F | GCCGTGCCTTTGGAATGTTT | 59 | 94 |
| R | GGGAGGGTGCCATAACCAAA | |||
| SP8 | F | GGGCACTTTTGTGTGATGGC | 60 | 137 |
| R | GACTGATAGCCCCGGTCAAG |
| Sample | Clean Reads | Clean Bases | GC Content | % ≥ Q30 1 |
|---|---|---|---|---|
| NC1 | 29,502,698 | 8,784,688,394 | 48.75% | 94.05% |
| NC2 | 24,646,831 | 7,335,965,546 | 50.22% | 93.38% |
| NC3 | 22,151,478 | 6,609,841,012 | 49.61% | 93.81% |
| M1 | 23,481,002 | 7,011,105,812 | 49.18% | 93.72% |
| M2 | 30,054,384 | 8,973,042,098 | 48.88% | 93.52% |
| M3 | 20,590,795 | 6,146,105,976 | 49.15% | 93.75% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luo, X.; Zhang, J.; Guo, J.; Zhao, W.; Tian, Y.; Xiang, H.; Kang, H.; Ye, F.; Chen, S.; Li, H.; et al. Transcriptomic Analysis Reveals the Effects of miR-122 Overexpression in the Liver of Qingyuan Partridge Chickens. Animals 2024, 14, 2132. https://doi.org/10.3390/ani14142132
Luo X, Zhang J, Guo J, Zhao W, Tian Y, Xiang H, Kang H, Ye F, Chen S, Li H, et al. Transcriptomic Analysis Reveals the Effects of miR-122 Overexpression in the Liver of Qingyuan Partridge Chickens. Animals. 2024; 14(14):2132. https://doi.org/10.3390/ani14142132
Chicago/Turabian StyleLuo, Xiaolu, Jiahang Zhang, Jiancheng Guo, Wenjuan Zhao, Yinan Tian, Hai Xiang, Huimin Kang, Fei Ye, Siyu Chen, Hua Li, and et al. 2024. "Transcriptomic Analysis Reveals the Effects of miR-122 Overexpression in the Liver of Qingyuan Partridge Chickens" Animals 14, no. 14: 2132. https://doi.org/10.3390/ani14142132
APA StyleLuo, X., Zhang, J., Guo, J., Zhao, W., Tian, Y., Xiang, H., Kang, H., Ye, F., Chen, S., Li, H., & Ma, Z. (2024). Transcriptomic Analysis Reveals the Effects of miR-122 Overexpression in the Liver of Qingyuan Partridge Chickens. Animals, 14(14), 2132. https://doi.org/10.3390/ani14142132

