New Insights on Tools for Detecting β-Tubulin Polymorphisms in Trichuris trichiura Using rhAmpTM SNP Genotyping
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Collection Samples
2.3. Molecular Analysis
2.3.1. DNA Extraction
2.3.2. Genotyping by rhAmp SNP Assays
2.3.3. PCR and Sequencing
2.3.4. Phylogenetic Studies
3. Results
3.1. SNP Genotyping Assays
3.2. Molecular Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Health Organization. Soil-Transmitted Infections. Available online: https://www.who.int/news-room/fact-sheets/detail/soil-transmitted-helminth-infections (accessed on 18 January 2023).
- Kern, P. Echinococcus granulosus infection: Clinical presentation, medical treatment and outcome. Langenbecks Arch. Surg. 2003, 388, 413–420. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soukhathammavong, P.A.; Sayasone, S.; Phongluxa, K.; Xayaseng, V.; Utzinger, J.; Vounatsou, P.; Hatz, C.; Akkhavong, K.; Keiser, J.; Odermatt, P. Low efficacy of single-dose albendazole and mebendazole against hookworm and effect on concomitant helminth infection in Lao PDR. PLoS Negl. Trop. Dis. 2012, 6, e1417. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moser, W.; Schindler, C.; Keiser, J. Efficacy of recommended drugs against soil transmitted helminths: Systematic review and network meta-analysis. BMJ 2017, 358, j4307. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moser, W.; Schindler, C.; Keiser, J. Drug Combinations Against Soil-Transmitted Helminth Infections. Adv. Parasitol. 2019, 103, 91–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaplan, R.M. Drug resistance in nematodes of veterinary importance: A status report. Trends Parasitol. 2004, 20, 477–481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keiser, J.; Utzinger, J. Efficacy of current drugs against soil-transmitted helminth infections: Systematic review and meta-analysis. JAMA 2008, 299, 1937–1948. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vercruysse, J.; Behnke, J.M.; Albonico, M.; Ame, S.M.; Angebault, C.; Bethony, J.M.; Engels, D.; Guillard, B.; Nguyen, T.V.; Kang, G.; et al. Assessment of the anthelmintic efficacy of albendazole in school children in seven countries where soil-transmitted helminths are endemic. PLoS Negl. Trop. Dis. 2011, 5, e948. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Levecke, B.; Montresor, A.; Albonico, M.; Ame, S.M.; Behnke, J.M.; Bethony, J.M.; Noumedem, C.D.; Engels, D.; Guillard, B.; Kotze, A.C.; et al. Assessment of anthelmintic efficacy of mebendazole in school children in six countries where soil-transmitted helminths are endemic. PLoS Negl. Trop. Dis. 2014, 8, e3204. [Google Scholar] [CrossRef] [Scilit]
- Kwa, M.S.; Veenstra, J.G.; Roos, M.H. Benzimidazole resistance in Haemonchus contortus is correlated with a conserved mutation at amino acid 200 in beta-tubulin isotype 1. Mol. Biochem. Parasitol. 1994, 63, 299–303. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prichard, R. Genetic variability following selection of Haemonchus contortus with anthelmintics. Trends Parasitol. 2001, 17, 445–453. [Google Scholar] [CrossRef] [Scilit]
- Ghisi, M.; Kaminsky, R.; Maser, P. Phenotyping and genotyping of Haemonchus contortus isolates reveals a new putative candidate mutation for benzimidazole resistance in nematodes. Vet. Parasitol. 2007, 144, 313–320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keiser, J.; Utzinger, J. The drugs we have and the drugs we need against major helminth infections. Adv. Parasitol. 2010, 73, 197–230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Olliaro, P.; Seiler, J.; Kuesel, A.; Horton, J.; Clark, J.N.; Don, R.; Keiser, J. Potential drug development candidates for human soil-transmitted helminthiases. PLoS Negl. Trop. Dis. 2011, 5, e1138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tehseen, M.M.; Zheng, Y.; Wyatt, N.A.; Bolton, M.D.; Yang, S.; Xu, S.S.; Li, X.; Chu, C. Development of STARP Marker Platform for Flexible SNP Genotyping in Sugarbeet. Agronomy 2023, 13, 1359. [Google Scholar] [CrossRef] [Scilit]
- Bennett, A.B.; Anderson, T.J.; Barker, G.C.; Michael, E.; Bundy, D.A. Sequence variation in the Trichuris trichiura beta-tubulin locus: Implications for the development of benzimidazole resistance. Int. J. Parasitol. 2002, 32, 1519–1528. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diawara, A.; Drake, L.J.; Suswillo, R.R.; Kihara, J.; Bundy, D.A.; Scott, M.E.; Halpenny, C.; Stothard, J.R.; Prichard, R.K. Assays to detect beta-tubulin codon 200 polymorphism in Trichuris trichiura and Ascaris lumbricoides. PLoS Negl. Trop. Dis. 2009, 3, e397. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diawara, A.; Schwenkenbecher, J.M.; Kaplan, R.M.; Prichard, R.K. Molecular and biological diagnostic tests for monitoring benzimidazole resistance in human soil-transmitted helminths. Am. J. Trop. Med. Hyg. 2013, 88, 1052–1061. [Google Scholar] [CrossRef] [Scilit]
- Diawara, A.; Halpenny, C.M.; Churcher, T.S.; Mwandawiro, C.; Kihara, J.; Kaplan, R.M.; Streit, T.G.; Idaghdour, Y.; Scott, M.E.; Basáñez, M.G.; et al. Association between response to albendazole treatment and β-tubulin genotype frequencies in soil-transmitted helminths. PLoS Negl. Trop. Dis. 2013, 30, 7:e2247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mendes de Oliveira, V.N.G.; Zuccherato, L.W.; Dos Santos, T.R.; Rabelo, É.M.L.; Furtado, L.F.V. Detection of Benzimidazole Resistance-Associated Single-Nucleotide Polymorphisms in the Beta-Tubulin Gene in Trichuris trichiura from Brazilian Populations. Am. J. Trop. Med. Hyg. 2022, 107, 640–648. [Google Scholar] [CrossRef] [Scilit]
- Vercruysse, J.; Levecke, B.; Prichard, R. Human soil-transmitted helminths: Implications of mass drug administration. Curr. Opin. Infect. Dis. 2012, 25, 703–708. [Google Scholar] [CrossRef] [Scilit]
- Semagn, K.; Babu, R.; Hearne, S.; Olsen, M. Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR (KASP): Overview of the technology and its application in crop improvement. Mol. Breed. 2014, 33, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Ertiro, B.T.; Ogugo, V.; Worku, M.; Das, B.; Olsen, M.; Labuschagne, M.; Semagn, K. Comparison of Kompetitive Allele Specific PCR (KASP) and genotyping by sequencing (GBS) for quality control analysis in maize. BMC Genom. 2015, 16, 908. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dobosy, J.R.; Rose, S.D.; Beltz, K.R.; Rupp, S.M.; Powers, K.M.; Behlke, M.A.; Walder, J.A. RNase H-dependent PCR (rhPCR): Improved specificity and single nucleotide polymorphism detection using blocked cleavable primers. BMC Biotechnol. 2011, 11, 80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Woodward, J. Bi-allelic SNP genotyping using the TaqMan assay. Methods Mol. Biol. 2014, 1145, 67–74. [Google Scholar] [CrossRef] [Scilit]
- Long, Y.M.; Chao, W.S.; Ma, G.J.; Xu, S.S.; Qi, L.L. An innovative SNP genotyping method adapting to multiple platforms and throughputs. Theor. Appl. Genet. 2017, 130, 597–607. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schwenkenbecher, J.M.; Albonico, M.; Bickle, Q.; Kaplan, R.M. Characterization of beta-tubulin genes in hookworms and investigation of resistance-associated mutations using real-time PCR. Mol. Biochem. Parasitol. 2007, 156, 167–174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rashwan, N.; Scott, M.; Prichard, R. Rapid Genotyping of β-tubulin Polymorphisms in Trichuris trichiura and Ascaris lumbricoides. PLoS Negl. Trop. Dis. 2017, 11, e0005205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gupta, S.K.; Singla, L.D. Chapter 6: Diagnostic Trends in Parasitic Diseases of Animals. In Veterinary Diagnostics; Gupta, R.P., Garg, S.R., Nehra, V., Lather, D., Eds.; Statish Serial Publishing House: Delhi, India, 2013; pp. 81–112. [Google Scholar]
- Horii, Y.; Usui, M. Experimental transmission of Trichuris ova from monkeys to man. Trans. R. Soc. Trop. Med. Hyg. 1985, 79, 423. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rivero, J.; García-Sánchez, Á.M.; Zurita, A.; Cutillas, C.; Callejón, R. Trichuris trichiura isolated from Macaca sylvanus: Morphological, biometrical, and molecular study. BMC Vet. Res. 2020, 16, 445, Erratum in: BMC Vet. Res. 2021, 17, 160. [Google Scholar] [CrossRef] [Scilit]
- Rivero, J.; Cutillas, C.; Callejón, R. Trichuris trichiura (Linnaeus, 1771) From Human and Non-human Primates: Morphology, Biometry, Host Specificity, Molecular Characterization, and Phylogeny. Front. Vet. Sci. 2021, 7, 626120. [Google Scholar] [CrossRef] [Scilit]
- Beltz, K.; Tsang, D.; Wang, J.; Rose, S.; Bao, Y.; Wang, Y.; Larkin, K.; Rupp, S.; Schrepfer, D.; Datta, K.; et al. A high-performing and cost-effective SNP genotyping method using rhPCR and universal reporters. Adv. Biosci. Biotechnol. 2018, 9, 497–512. [Google Scholar] [CrossRef]
- Hansen, T.V.; Thamsborg, S.M.; Olsen, A.; Prichard, R.K.; Nejsum, P. Genetic variations in the beta-tubulin gene and the internal transcribed spacer 2 region of Trichuris species from man and baboons. Parasit. Vectors 2013, 6, 236. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guindon, S.; Dufayard, J.F.; Lefort, V.; Anisimova, M.; Hordijk, W.; Gascuel, O. New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst. Biol. 2010, 59, 307–321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [Scilit]
- Posada, D. jModelTest: Phylogenetic model averaging. Mol. Biol. Evol. 2008, 25, 1253–1256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Posada, D.; Buckley, T.R. Model selection and model averaging in phylogenetics: Advantages of akaike information criterion and bayesian approaches over likelihood ratio tests. Syst. Biol. 2004, 53, 793–808. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Humphries, D.; Nguyen, S.; Boakye, D.; Wilson, M.; Cappello, M. The promise and pitfalls of mass drug administration to control intestinal helminth infections. Curr. Opin. Infect. Dis. 2012, 25, 584–589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Furtado, L.F.; de Paiva Bello, A.C.P.; Rabelo, É.M.L. Benzimidazole resistance in helminths: From problem to diagnosis. Acta Trop. 2016, 162, 95–102. [Google Scholar] [CrossRef] [Scilit]
- Geerts, S.; Gryseels, B. Anthelmintic resistance in human helminths: A review. Trop. Med. Int. Health 2001, 6, 915–921. [Google Scholar] [CrossRef] [Scilit]
- van Wyk, J.A. Refugia-overlooked as perhaps the most potent factor concerning the development of anthelmintic resistance. J. Vet. Res. 2001, 68, 55–67. [Google Scholar]
- Wolstenholme, A.J.; Fairweather, I.; Prichard, R.; von Samson-Himmelstjerna, G.; Sangster, N.C. Drug resistance in veterinary helminths. Trends Parasitol. 2004, 20, 469–476. [Google Scholar] [CrossRef] [Scilit]
- Furtado, L.F.V.; Magalhães, J.G.S.; Rabelo, É.M.L. Standardization and application of a modified RFLP-PCR methodology for analysis of polymorphisms linked to treatment resistance in Ancylostoma braziliense. Parasit. Vectors 2018, 11, 540. [Google Scholar] [CrossRef] [Scilit]
- Furtado, L.F.V.; Medeiros, C.d.S.; Zuccherato, L.W.; Alves, W.P.; de Oliveira, V.N.G.M.; da Silva, V.J.; Miranda, G.S.; Fujiwara, R.T.; Rabelo, É.M.L. First identification of the benzimidazole resistance-associated F200Y SNP in the beta-tubulin gene in Ascaris lumbricoides. PLoS ONE 2019, 14, e0224108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Broccanello, C.; Chiodi, C.; Funk, A.; McGrath, J.M.; Panella, L.; Stevanato, P. Comparison of three PCR-based assays for SNP genotyping in plants. Plant Methods 2018, 14, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dixit, A.K.; Das, G.; Dixit, P.; Singh, A.P.; Kumbhakar, N.K.; Sankar, M.; Sharma, R.L. An assessment of benzimidazole resistance against caprine nematodes in Central India. Trop. Anim. Health Prod. 2017, 49, 1471–1478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tydén, E.; Engström, A.; Morrison, D.A.; Höglund, J. Sequencing of the β-tubulin genes in the ascarid nematodes Parascaris equorum and Ascaridia galli. Mol. Biochem. Parasitol. 2013, 190, 38–43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tydén, E.; Dahlberg, J.; Karlberg, O.; Höglund, J. Deep amplicon sequencing of preselected isolates of Parascaris equorum in β-tubulin codons associated with benzimidazole resistance in other nematodes. Parasit. Vectors 2014, 7, 410. [Google Scholar] [CrossRef] [Scilit]
- Tarbiat, B.; Jansson, D.S.; Tydén, E.; Höglund, J. Evaluation of benzimidazole resistance status in Ascaridia galli. Parasitology 2017, 144, 1338–1345. [Google Scholar] [CrossRef] [Scilit]
- Liu, G.H.; Gasser, R.B.; Su, A.; Nejsum, P.; Peng, L.; Lin, R.Q.; Li, M.W.; Xu, M.J.; Zhu, X.Q. Clear genetic distinctiveness between human-and pig-derived Trichuris based on analysis of mitochondrial datasets. PLoS Negl. Trop. Dis. 2012, 6, e1539. [Google Scholar] [CrossRef] [Scilit]
- Cavallero, S.; De Liberato, C.; Friedrich, K.G.; Di Cave, D.; Masella, V.; D’Amelio, S.; Berrilli, F. Genetic heterogeneity and phylogeny of Trichuris spp. from captive non-human primates based on ribosomal DNA sequence data. Infect. Genet. Evol. 2015, 34, 450–456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cavallero, S.; Nejsum, P.; Cutillas, C.; Callejón, R.; Doležalová, J.; Modrý, D.; D’Amelio, S. Insights into the molecular systematics of Trichuris infecting captive primates based on mitochondrial DNA analysis. Vet. Parasitol. 2019, 272, 23–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hawash, M.B.; Andersen, L.O.; Gasser, R.B.; Stensvold, C.; Nejsum, P. Mitochondrial genome analyses suggest multiple Trichuris species in humans, baboons, and pigs from different geographical regions. PLoS Negl. Trop. Dis. 2015, 9, e0004059. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, Y.; Zhao, B.; Hoberg, E.P.; Li, M.; Zhou, X.; Gu, X.; Lai, W.; Peng, X.; Yang, G. Genetic characterisation and phylogenetic status of whipworms (Trichuris spp.) from captive non-human primates in China, determined by nuclear and mitochondrial sequencing. Parasit. Vectors 2018, 11, 516. [Google Scholar] [CrossRef] [Scilit]
- Rivero, J.; García-Sánchez, Á.M.; Callejón, R.; Cutillas, C. Characterization of Trichuris species from porcupine (Hystrix cristata) at zoological garden of Spain. Acta Trop. 2022, 228, 106276. [Google Scholar] [CrossRef] [Scilit]


| Species | Sample ID | Adult/Eggs | Host Species/Geographical Origin | Accession Number | Length (bp) | G + C Content (%) |
|---|---|---|---|---|---|---|
| Trichuris trichiura | TMSM9 | Adult | Macaca sylvanus/Spain | OQ446467 | 445 | 44.94 |
| Trichuris sp. | TMSF10 | Adult | Macaca sylvanus/Spain | OQ446468 | 445 | 44.94 |
| Trichuris trichiura | TPPM1 | Adult | Papio papio/Spain | OQ446469 | 445 | 45.39 |
| Trichuris trichiura | TPPF1 | Adult | Papio papio/Spain | OQ446470 | 445 | 45.39 |
| Trichuris trichiura | TPPF2 | Adult | Papio papio/Spain | OQ446471 | 445 | 45.39 |
| Trichuris trichiura | TCAE_1 | Eggs | Chlorocebus aethiops/Spain | OQ446472 | 445 | 44.94 |
| Trichuris trichiura | TCAE_2 | Eggs | Chlorocebus aethiops/Spain | OQ446473 | 445 | 44.94 |
| Trichuris trichiura | TCAE_3 | Eggs | Chlorocebus aethiops/Spain | OQ446474 | 445 | 44.94 |
| Trichuris trichiura | TCAE_4 | Eggs | Chlorocebus aethiops/Spain | OQ446475 | 445 | 44.94 |
| Trichuris trichiura | TEPE | Eggs | Erythrocebus patas/Spain | OQ446476 | 445 | 44.94 |
| Trichuris colobae | TCO_901 | Adult | Colobus guereza kikuyensis/Spain | OQ446477 | 445 | 44.94 |
| Trichuris suis | TSF1 | Adult | Sus scrofa domestica/Spain | OQ446478 | 445 | 44.72 |
| Trichuris suis | TSF2 | Adult | Sus scrofa domestica/Spain | OQ446479 | 445 | 44.72 |
| Trichuris sp. | THCF10 | Adult | Hystrix cristata/Spain | OQ446480 | 448 | 47.99 |
| Trichuris sp. | THCF15 | Adult | Hystrix cristata/Spain | OQ446481 | 448 | 47.99 |
| Codon | T. trichiura rhAmp SNP Assays | ||
|---|---|---|---|
| Primer Type | Primer | Sequence | |
| Codon 167 | Allele-Specific | Primer 1 | CCTGACCGAATTATGACAACTTT |
| Allele-Specific | Primer 2 | CCTGACCGAATTATGACAACTTA | |
| Locus-Specific | Primer | GCCCCAACGTGAACAGTATCAAA | |
| Codon 198 | Allele-Specific | Primer 1 | GCTTCATTATCTATGCAGAATGTTT |
| Allele-Specific | Primer 2 | GCTTCATTATCTATGCAGAATGTTG | |
| Locus-Specific | Primer | GCATGCAACTCTGTCAGTCCA | |
| Codon 200 | Allele-Specific | Primer 1 | AGCGCTTCATTATCTATGCAGAA |
| Allele-Specific | Primer 2 | AGCGCTTCATTATCTATGCAGAT | |
| Locus-Specific | Primer | GCATGCAACTCTGTCAGTCCA | |
| T. trichiura gBlocks® Gene Fragments | Sequence |
|---|---|
| gBlocks® WT | GAATCGGAAAGCTGCGACTGCCTGCAAGGGTTCCAGTTGACTCATTCCCTCGGCGGCGGAACTGGGAGTGGAATGGGTACGCTTCTGATATCTAAAATTCGGGAAGAGTATCCTGACCGAATTATGACAACTTTTAGTGTCGTTCCGTCTCCGAAGGCAAGTTGTTTGATACTGTTCACGTCGTGAACTATCGCCTTTTTAGGTTTCAGATACAGTTGTAGAACCATATAATGCAACTCTGTCAGTCCACCAGTTGGTAGAGAACACGGACGAAACATTCTGCATAGATAATGAAGCGCTTTACGATATTTGTTTCCGAACTTTGAAGTTAACAACACCAACTTACGGAGACTTAAATCATTTGGTTTCGGCAACCATGTCTGGAGTAACGACATGCCTACGCTTTCCTGGTCAGTTGAATGCTGATTTGCGGAAGCTGGCAGTC |
| gBlocks® 167 | GAATCGGAAAGCTGCGACTGCCTGCAAGGGTTCCAGTTGACTCATTCCCTCGGCGGCGGAACTGGGAGTGGAATGGGTACGCTTCTGATATCTAAAATTCGGGAAGAGTATCCTGACCGAATTATGACAACTTATAGTGTCGTTCCGTCTCCGAAGGCAAGTTGTTTGATACTGTTCACGTCGTGAACTATCGCCTTTTTAGGTTTCAGATACAGTTGTAGAACCATATAATGCAACTCTGTCAGTCCACCAGTTGGTAGAGAACACGGACGAAACATTCTGCATAGATAATGAAGCGCTTTACGATATTTGTTTCCGAACTTTGAAGTTAACAACACCAACTTACGGAGACTTAAATCATTTGGTTTCGGCAACCATGTCTGGAGTAACGACATGCCTACGCTTTCCTGGTCAGTTGAATGCTGATTTGCGGAAGCTGGCAGTC |
| gBlocks® 198 | GAATCGGAAAGCTGCGACTGCCTGCAAGGGTTCCAGTTGACTCATTCCCTCGGCGGCGGAACTGGGAGTGGAATGGGTACGCTTCTGATATCTAAAATTCGGGAAGAGTATCCTGACCGAATTATGACAACTTTTAGTGTCGTTCCGTCTCCGAAGGCAAGTTGTTTGATACTGTTCACGTCGTGAACTATCGCCTTTTTAGGTTTCAGATACAGTTGTAGAACCATATAATGCAACTCTGTCAGTCCACCAGTTGGTAGAGAACACGGACGCAACATTCTGCATAGATAATGAAGCGCTTTACGATATTTGTTTCCGAACTTTGAAGTTAACAACACCAACTTACGGAGACTTAAATCATTTGGTTTCGGCAACCATGTCTGGAGTAACGACATGCCTACGCTTTCCTGGTCAGTTGAATGCTGATTTGCGGAAGCTGGCAGTC |
| gBlocks® 200 | GAATCGGAAAGCTGCGACTGCCTGCAAGGGTTCCAGTTGACTCATTCCCTCGGCGGCGGAACTGGGAGTGGAATGGGTACGCTTCTGATATCTAAAATTCGGGAAGAGTATCCTGACCGAATTATGACAACTTTTAGTGTCGTTCCGTCTCCGAAGGCAAGTTGTTTGATACTGTTCACGTCGTGAACTATCGCCTTTTTAGGTTTCAGATACAGTTGTAGAACCATATAATGCAACTCTGTCAGTCCACCAGTTGGTAGAGAACACGGACGAAACAATCTGCATAGATAATGAAGCGCTTTACGATATTTGTTTCCGAACTTTGAAGTTAACAACACCAACTTACGGAGACTTAAATCATTTGGTTTCGGCAACCATGTCTGGAGTAACGACATGCCTACGCTTTCCTGGTCAGTTGAATGCTGATTTGCGGAAGCTGGCAGTC |
| Dye | λ Excitation Filter (nm) | λ Emission Filter (nm) |
|---|---|---|
| FAMTM | 450 | 533 |
| HEXTM | 483 | 568 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rivero, J.; Cutillas, C.; Callejón, R. New Insights on Tools for Detecting β-Tubulin Polymorphisms in Trichuris trichiura Using rhAmpTM SNP Genotyping. Animals 2024, 14, 1545. https://doi.org/10.3390/ani14111545
Rivero J, Cutillas C, Callejón R. New Insights on Tools for Detecting β-Tubulin Polymorphisms in Trichuris trichiura Using rhAmpTM SNP Genotyping. Animals. 2024; 14(11):1545. https://doi.org/10.3390/ani14111545
Chicago/Turabian StyleRivero, Julia, Cristina Cutillas, and Rocío Callejón. 2024. "New Insights on Tools for Detecting β-Tubulin Polymorphisms in Trichuris trichiura Using rhAmpTM SNP Genotyping" Animals 14, no. 11: 1545. https://doi.org/10.3390/ani14111545
APA StyleRivero, J., Cutillas, C., & Callejón, R. (2024). New Insights on Tools for Detecting β-Tubulin Polymorphisms in Trichuris trichiura Using rhAmpTM SNP Genotyping. Animals, 14(11), 1545. https://doi.org/10.3390/ani14111545

