LPS Administration during Fertilization Affects Epigenetic Inheritance during Embryonic Development
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. LPS Treatment
2.2. Animal Ethics and Care
2.3. Maternal Effect of LPS Administration in the Uterus
2.4. Measuring LPS Concentration in Blood Samples
2.5. In Vitro Fertilization (IVF)
2.6. LPS Administration In Vivo Using Mice
2.7. Gene Expression Analysis
2.8. Formatting of Mathematical Components
ΔL* = (each LPS group L*) − (control group L*)
Δa* = (each LPS group a*) − (control group a*)
Δb* = (each LPS group b*) − (control group b*)
2.9. Statistical Analysis
3. Results
3.1. Maternal Effect of LPS Administration
3.2. Effect of LPS on Early Embryonic Development In Vitro
3.3. Effect of LPS on Late Embryonic Development In Vivo
3.4. Principal Component Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ander, S.E.; Diamond, M.S.; Coyne, C.B. Immune Responses at the Maternal-Fetal Interface. Sci. Immunol. 2019, 4, eaat6114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Witkin, S.S.; Linhares, I.M.; Bongiovanni, A.M.; Herway, C.; Skupski, D. Unique Alterations in Infection-Induced Immune Activation during Pregnancy. BJOG 2011, 118, 145–153. [Google Scholar] [CrossRef] [Scilit]
- Giakoumelou, S.; Wheelhouse, N.; Cuschieri, K.; Entrican, G.; Howie, S.E.M.; Horne, A.W. The Role of Infection in Miscarriage. Hum. Reprod. Update 2016, 22, 116–133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bidne, K.L.; Dickson, M.J.; Ross, J.W.; Baumgard, L.H.; Keating, A.F. Disruption of Female Reproductive Function by Endotoxins. Reproduction 2020, 155, R169–R181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sheldon, I.; Price, S.; Cronin, J.; Gilbert, R.; Gadsby, J. Mechanisms of Infertility Associated with Clinical and Subclinical Endometritis in High Producing Dairy Cattle. Reprod. Domest. Anim. 2009, 44, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mierzejewski, K.; Kurzyńska, A.; Kunicka, Z.; Klepacka, A.; Golubska, M.; Bogacka, I. Peroxisome Proliferator-Activated Receptor Gamma Ligands Regulate the Expression of Inflammatory Mediators in Porcine Endometrium during LPS-Induced Inflammation. Theriogenology 2022, 187, 195–204. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sheldon, I.M.; Cronin, J.; Goetze, L.; Donofrio, G.; Schuberth, H.J. Defining Postpartum Uterine Disease and the Mechanisms of Infection and Immunity in the Female Reproductive Tract in Cattle. Biol. Reprod. 2009, 81, 1025–1032. [Google Scholar] [CrossRef] [Scilit]
- Deb, K.; Chaturvedi, M.M.; Jaiswal, Y.K. Comprehending the Role of LPS in Gram-Negative Bacterial Vaginosis: Ogling into the Causes of Unfulfilled Child-Wish. Arch. Gynecol. Obstet. 2004, 270, 133–146. [Google Scholar] [CrossRef] [Scilit]
- Bertani, B.; Ruiz, N. Function and Biogenesis of Lipopolysaccharides. EcoSal Plus 2018, 8, 1–33. [Google Scholar] [CrossRef] [Scilit]
- Araya, A.V.; Pavez, V.; Perez, C.; Gonzalez, F.; Colombo, A.; Aguirre, A.; Schiattino, I.; Aguillón, J.C. Ex Vivo Lipopolysaccharide (LPS)-Induced TNF-a, IL-1b, IL-6 and PGE 2 Secretion in Whole Blood from Type 1 Diabetes Mellitus Patients with or without Aggressive Periodontitis. Eur. Cytokine Netw. 2003, 14, 128–133. [Google Scholar]
- Takeda, K.; Akira, S. Toll-like Receptors in Innate Immunity. Int. Immunol. 2005, 17, 1–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawai, T.; Akira, S. TLR Signaling. Semin. Immunol. 2007, 19, 24–32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, C.J.; Romero, R.; Chaemsaithong, P.; Kim, J.S. Chronic Inflammation of the Placenta: Definition, Classification, Pathogenesis, and Clinical Significance. Am. J. Obstet. Gynecol. 2015, 213, S53–S69. [Google Scholar] [CrossRef] [Scilit]
- Suzuki, C.; Yoshioka, K.; Iwamura, S.; Hirose, H. Endotoxin Induces Delayed Ovulation Following Endocrine Aberration during the Proestrous Phase in Holstein Heifers. Domest. Anim. Endocrinol. 2001, 20, 267–278. [Google Scholar] [CrossRef] [Scilit]
- Lavon, Y.; Leitner, G.; Moallem, U.; Klipper, E.; Voet, H.; Jacoby, S.; Glick, G.; Meidan, R.; Wolfenson, D. Immediate and Carryover Effects of Gram-Negative and Gram-Positive Toxin-Induced Mastitis on Follicular Function in Dairy Cows. Theriogenology 2011, 76, 942–953. [Google Scholar] [CrossRef] [Scilit]
- Fumie, M.; Maya, H.; Akio, M.; Takashi, S. Lipopolysaccharide (LPS) Inhibits Steroid Production in Theca Cells of Bovine Follicles In Vitro: Distinct Effect of LPS on Theca Cell Function in Pre-and Post-Selection Follicles. J. Reprod. Dev. 2014, 60, 280–287. [Google Scholar] [CrossRef] [Scilit]
- Mateus, L.; Lopes da Costa, L.; Diniz, P.; Ziecik, A.J. Relationship between Endotoxin and Prostaglandin (PGE2 and PGFM) Concentrations and Ovarian Function in Dairy Cows with Puerperal Endometritis. Anim. Reprod. Sci. 2003, 76, 143–154. [Google Scholar] [CrossRef] [Scilit]
- Herath, S.; Williams, E.J.; Lilly, S.T.; Gilbert, R.O.; Dobson, H.; Bryant, C.E.; Sheldon, I.M. Ovarian Follicular Cells Have Innate Immune Capabilities That Modulate Their Endocrine Function. Reproduction 2007, 134, 683–693. [Google Scholar] [CrossRef] [Scilit]
- Magata, F.; Horiuchi, M.; Echizenya, R.; Miura, R.; Chiba, S.; Matsui, M.; Miyamoto, A.; Kobayashi, Y.; Shimizu, T. Lipopolysaccharide in Ovarian Follicular Fluid Influences the Steroid Production in Large Follicles of Dairy Cows. Anim. Reprod. Sci. 2014, 144, 6–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heidari, M.; Kafi, M.; Mirzaei, A.; Asaadi, A.; Mokhtari, A. Effects of Follicular Fluid of Preovulatory Follicles of Repeat Breeder Dairy Cows with Subclinical Endometritis on Oocyte Developmental Competence. Anim. Reprod. Sci. 2019, 205, 62–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shimada, M.; Hernandez-Gonzalez, I.; Gonzalez-Robanya, I.; Richards, J.A.S. Induced Expression of Pattern Recognition Receptors in Cumulus Oocyte Complexes: Novel Evidence for Innate Immune-like Functions during Ovulation. Mol. Endocrinol. 2006, 20, 3228–3239. [Google Scholar] [CrossRef] [Scilit]
- Xu, D.X.; Wang, H.; Zhao, L.; Ning, H.; Chen, Y.H.; Zhang, C. Effects of Low-Dose Lipopolysaccharide (LPS) Pretreatment on LPS-Induced Intra-Uterine Fetal Death and Preterm Labor. Toxicology 2007, 234, 167–175. [Google Scholar] [CrossRef] [Scilit]
- Okazaki, T.; Mihara, T.; Fujita, Y.; Yoshida, S.; Teshima, H.; Shimada, M. Polymyxin B Neutralizes Bacteria-Released Endotoxin and Improves the Quality of Boar Sperm during Liquid Storage and Cryopreservation. Theriogenology 2010, 74, 1691–1700. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawase, Y.; Tachibe, T.; Kamada, N.; Jishage, K.; Watanabe, H.; Suzuki, H. Male Advantage Observed for in Vitro Fertilization Mouse Embryos Exhibiting Early Cleavage. Reprod. Med. Biol. 2021, 20, 83–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Toyoda, Y.; Yokoyama, M. The Early History of the TYH Medium for in Vitro Fertilization of Mouse Ova. J. Mamm. Ova. Res. 2016, 33, 3–10. [Google Scholar] [CrossRef] [Scilit]
- Whitten, W.K.; Biggers, J.D. Complete Development in Vitro of the Pre-Implantation Stages of the Mouse in a Simple Chemically Defined Medium. J. Reprod. Fertil. 1968, 17, 399–401. [Google Scholar] [CrossRef] [Scilit]
- Wu, H.T.; Chou, C.K.; Lin, C.S.; Huang, M.C. Effects of Glucose Concentration on in Vitro Fertilization in BALB/c Mice. Reprod. Domest. Anim. 2003, 38, 470–474. [Google Scholar] [CrossRef] [Scilit]
- Kitaya, K.; Matsubayashi, H.; Yamaguchi, K.; Nishiyama, R.; Takaya, Y.; Ishikawa, T.; Yasuo, T.; Yamada, H. Chronic Endometritis: Potential Cause of Infertility and Obstetric and Neonatal Complications. Am. J. Reprod. Immunol. 2016, 75, 13–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murtinger, M.; Wirleitner, B.; Spitzer, D.; Bralo, H.; Miglar, S.; Schuff, M. Diagnosing Chronic Endometritis: When Simplification Fails to Clarify. Hum. Reprod. Open 2022, 2022, hoac023. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rose, J.A.; Rabenold, J.J.; Parast, M.M.; Milstone, D.S.; Abrahams, V.M.; Riley, J.K. Peptidoglycan Induces Necrosis and Regulates Cytokine Production in Murine Trophoblast Stem Cells. Am. J. Reprod. Immunol. 2011, 66, 209–222. [Google Scholar] [CrossRef] [Scilit]
- Lauren, R.J.; Char, E.F.; Scott, W. Tumor Necrosis Factor Alpha Inhibits In Vitro Bovine Embryo Development through a Prostaglandin Mediated Mechanism. J. Anim. Sci. Biotechnol. 2012, 3, 7. [Google Scholar] [CrossRef] [Scilit]
- Yu, C.; Zhang, X.; Wang, L.; Liu, Y.; Li, N.; Li, M.; Chen, L.; Liu, Y.; Yao, Y. Interleukin-6 Regulates Expression of Fos and Jun Genes to Affect the Development of Mouse Preimplantation Embryos. J. Obstet. Gynaecol. Res. 2018, 44, 253–262. [Google Scholar] [CrossRef] [Scilit]
- Baptista, F.I.; Aveleira, C.A.; Castilho, Á.F.; Ambrósio, A.F. Elevated Glucose and Interleukin-1 β Differentially Affect Retinal Microglial Cell Proliferation. Mediators Inflamm. 2017, 2017, 4316316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brandt, A.M.; Kania, J.M.; Reinholt, B.M.; Johnson, S.E. Human IL6 Stimulates Bovine Satellite Cell Proliferation through a Signal Transducer and Activator of Transcription 3 (STAT3)-Dependent Mechanism. Domest. Anim. Endocrinol. 2018, 62, 32–38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wiliams, C.L.; Teeling, J.L.; Perry, H.V.; Fleming, T.P. Mouse Maternal Systemic Inflammation at the Zygote Stage Causes Blunted Cytokine Responsiveness in Lipopolysaccharide-Challenged Adult Offspring. BMC Biol 2011, 9, 49. [Google Scholar] [CrossRef] [Scilit]
- Wenbio, T.; Tryo, L.O.; Liu, S.-H.; Bazer, F.W. Intrauterine Infusion of Bacterial Lipopolysaccharide (LPS) Prior to Mating Has No Adverse Effect on Fertility, Fetal Survival and Fetal Development. J. Reprod. Immuol. 1999, 42, 31–39. [Google Scholar] [CrossRef] [Scilit]
- Garnier, Y.; Kadyrov, M.; Gantert, M.; Einig, A.; Rath, W.; Huppertz, B. Proliferative Responses in the Placenta after Endotoxin Exposure in Preterm Fetal Sheep. Eur. J. Obstet. Gynecol. Reprod. Biol. 2008, 138, 152–157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lv, J.; Zeng, J.; Zhao, W.; Cheng, Y.; Zhang, L.; Cai, S.; Hu, G.; Chen, Y. Cdc42 Regulates LPS-Induced Proliferation of Primary Pulmonary Microvascular Endothelial Cells via ERK Pathway. Microvasc. Res. 2017, 109, 45–53. [Google Scholar] [CrossRef] [Scilit]
- Zhou, J.; Miao, H.; Li, X.; Hu, Y.; Sun, H.; Hou, Y. Curcumin Inhibits Placental Inflammation to Ameliorate LPS-Induced Adverse Pregnancy Outcomes in Mice via Upregulation of Phosphorylated Akt. Inflamm. Res. 2017, 66, 177–185. [Google Scholar] [CrossRef] [Scilit]
- Sun, X.; Kaufman, P.D. Ki-67: More than a Proliferation Marker. Chromosoma 2018, 127, 175–186. [Google Scholar] [CrossRef] [Scilit]
- Sobecki, M.; Mrouj, K.; Colinge, J.; Gerbe, F.; Jay, P.; Krasinska, L.; Dulic, V.; Fisher, D. Cell-Cycle Regulation Accounts for Variability in Ki-67 Expression Levels. Cancer Res. 2017, 77, 2722–2734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bao, J.; Zou, Y.; Liu, Y.; Yuan, L.; Garfield, R.E.; Liu, H. Nicotine Protects Fetus against LPS-Induced Fetal Growth Restriction through Ameliorating Placental Inflammation and Vascular Development in Late Pregnancy in Rats. Biosci. Rep. 2019, 39, BSR20190386. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Gene | Primer | Size (bp) | Annealing Temperature (°C) | Accession No. | |
|---|---|---|---|---|---|
| Tnf-α | F R | AAAGATGGGGGGCTTCCAGA GATGAGAGGGAGGCCATTTGG | 157 | 60 | NM_013693.3 |
| Il-1β | F R | GCCACCTTTTGACAGTGATGAG AAGGTCCACGGGAAAGACAC | 219 | 60 | NM_008361.4 |
| Il-6 | F R | GGATACCACTCCCAACAGACC GGTACTCCAGAAGACCAGAGGAA | 251 | 60 | NM_001314054.1 |
| Ki67 | F R | GAGGCTGAGACATGGAGACATA TATCTGCAGAAAGGCCCTTGG | 245 | 60 | NM_001081117.2 |
| p53 | F R | TGGAGGAGTCACAGTCGGATAT ACACTCGGAGGGCTTCACTT | 180 | 60 | NM_011640.3 |
| caspase4 | F R | TAGACTCATTTCCTGCTTCCGG AGGTTGCCCGATCAATGGTG | 128 | 60 | NM_007609.3 |
| ACTB | F R | CGTGCGTGACATCAAAGAGAA TGGATGCCACAGGATTCCAT | 201 | 60 | NM_007393.5 |
| LPS Concentration (µg/mL) | No. of Denuded Oocyte | Development Stages | ||||
|---|---|---|---|---|---|---|
| Oocytes Fertilized | 2-Cell | 4-Cell | Morula | Blastocyst | ||
| Control | 213 | 172 80.8% | 171 99.4% | 161 93.6% | 146 84.9% | 141 82.0% |
| 1 | 132 | 104 78.8% | 104 100% | 97 93.3% | 83 79.8% | 75 72.1% |
| 10 | 130 | 100 76.9% | 95 95.0% † | 83 83.0% * | 71 71.0% * | 62 62.0% ** |
| PC1 | PC2 | PC3 | |
|---|---|---|---|
| Eigenvalue | 5.586 | 2.125 | 1.368 |
| Proportion (%) | 55.86 | 21.25 | 7.06 |
| Cumulative (%) | 55.86 | 77.11 | 90.79 |
| Variables | |||
| LPS concentration | 0.410 | 0.081 | 0.175 |
| Placental weight | −0.037 | −0.452 | −0.047 |
| Fetal weight | −0.084 | −0.490 | 0.493 |
| CRL | 0.043 | −0.567 | 0.303 |
| Tnf-α | −0.049 | −0.396 | −0.669 |
| Il−1β | 0.422 | −0.040 | −0.330 |
| Il−6 | 0.405 | 0.102 | 0.204 |
| Ki67 | −0.418 | −0.050 | −0.117 |
| p53 | 0.386 | −0.176 | −0.265 |
| caspase4 | 0.393 | 0.161 | 0.239 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, S.; Yoneda, E.; Tomita, K.; Kayano, M.; Watanabe, H.; Sasaki, M.; Shimizu, T.; Muranishi, Y. LPS Administration during Fertilization Affects Epigenetic Inheritance during Embryonic Development. Animals 2023, 13, 1135. https://doi.org/10.3390/ani13071135
Kim S, Yoneda E, Tomita K, Kayano M, Watanabe H, Sasaki M, Shimizu T, Muranishi Y. LPS Administration during Fertilization Affects Epigenetic Inheritance during Embryonic Development. Animals. 2023; 13(7):1135. https://doi.org/10.3390/ani13071135
Chicago/Turabian StyleKim, Sangwoo, Erina Yoneda, Kisaki Tomita, Mitsunori Kayano, Hiroyuki Watanabe, Motoki Sasaki, Takashi Shimizu, and Yuki Muranishi. 2023. "LPS Administration during Fertilization Affects Epigenetic Inheritance during Embryonic Development" Animals 13, no. 7: 1135. https://doi.org/10.3390/ani13071135
APA StyleKim, S., Yoneda, E., Tomita, K., Kayano, M., Watanabe, H., Sasaki, M., Shimizu, T., & Muranishi, Y. (2023). LPS Administration during Fertilization Affects Epigenetic Inheritance during Embryonic Development. Animals, 13(7), 1135. https://doi.org/10.3390/ani13071135

