Investigating the Effect of Pulicaria jaubertii as a Natural Feed Additive on the Growth Performance, Blood Biochemistry, Immunological Response, and Cecal Microbiota of Broiler Chickens
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Reference
2.2. Chemical and Bioactive Composition of Pulicaria jaubertii
2.3. Birds, Study Design, and Housing
2.4. General Performance Evaluation
2.5. Sampling and Blood Analysis
2.6. Internal Organs Indicators
2.7. Sampling and Gene Expression
2.8. Cecal Microbiota
2.9. Data Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bravo, D.; Pirgozliev, V.; Rose, S.P. A mixture of carvacrol, cinnamaldehyde, and capsicum oleoresin improves energy utilization and growth performance of broiler chickens fed maize-based diet. J. Anim. Sci. 2014, 92, 1531–1536. [Google Scholar] [CrossRef] [PubMed]
- Pirgozliev, V.; Mansbridge, S.C.; Rose, S.P.; Lillehoj, H.S.; Bravo, D. Immune modulation, growth performance, and nutrient retention in broiler chickens fed a blend of phytogenic feed additives. Poult. Sci. 2019, 98, 3443–3449. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.H.; Ko, C.I.; Ahn, G.; You, S.; Kim, J.S.; Heu, M.S.; Kim, J.; Jee, Y.; Jeon, Y.J. Molecular characteristics and anti-inflammatory activity of the fucoidan extracted from Ecklonia cava. Carbohyd. Polym. 2012, 89, 599–606. [Google Scholar] [CrossRef] [PubMed]
- Karadas, F.; Pirgozliev, V.; Rose, S.P.; Dimitrov, D.; Oduguwa, O.; Bravo, D. Dietary essential oils improve the hepatic antioxidative status of broiler chickens. Br. Poult. Sci. 2014, 55, 329–334. [Google Scholar] [CrossRef]
- Vase-Khavari, K.; Mortezavi, S.H.; Rasouli, B.; Khusro, A.; Salem, A.Z.; Seidavi, A. The effect of three tropical medicinal plants and superzist probiotic on growth performance, carcass characteristics, blood constitutes, immune response, and gut microflora of broiler. Trop. Anim. Health Prod. 2019, 51, 33–42. [Google Scholar] [CrossRef]
- Gao, Z.P.; Zhong, W.M.; Chen, K.Y.; Tang, P.Y.; Guo, J.J. Chemical composition and anti-biofilm activity of essential oil from Citrus medica L. var. sarcodactylis Swingle against listeria monocytogenes. Ind. Crop Prod. 2020, 144, 112036. [Google Scholar] [CrossRef]
- Belal, A.S.; Ismail, A.; Elnaggar, M.M.; Belal, T.S. Click chemistry inspired copper sulphidenanoparticle-based fluorescence assay of kanamycin using DNA aptamer. Spectrochim. Acta A Mol. Biomol. Spectrosc. 2018, 205, 48–54. [Google Scholar] [CrossRef]
- Smith, J.A. Broiler production without antibiotics: United States field perspectives. Anim. Feed Sci. Technol. 2019, 250, 93–98. [Google Scholar] [CrossRef]
- Munyaka, P.M.; Echeverry, H.; Yitbarek, A.; Camelo-Jaimes, G.; Sharif, S.; Guenter, W.; Rodriguez-Lecompte, J.C. Local and systemic innate immunity in broiler chickens supplemented with yeast-derived carbohydrates. Poult. Sci. 2012, 91, 2164–2172. [Google Scholar] [CrossRef]
- Cho, J.H.; Kim, H.J.; Kim, I.H. Effects of phytogenic feed additive on growth performance, digestibility, blood metabolites, intestinal microbiota, meat color and relative organ weight after oral challenge with Clostridium perfringens in broilers. Livest. Sci. 2014, 160, 82–88. [Google Scholar] [CrossRef]
- Al-Gabr, M.N.; Ameddah, S.; Menad, A.; Mekkiou, R.; Chalchat, J.C.; Benayache, S.; Benayache, F. Essential oil composition of Pulicaria jaubertii from Yemen. Int. J. Med. Arom. Plants 2012, 2, 688–690. [Google Scholar]
- Huanga, S.Z.; Lia, L.B.; Jiang, S.; Chen, X.L.; Zhu, H.J. A rarely reported Trinorsesquiterpene-Type structure in an isolate from Pulicaria insignis. Helvetica. Chim. Acta 2010, 93, 1808–1811. [Google Scholar] [CrossRef]
- Ragab, E.A.; Raafat, M. A new monoterpene glucoside and complete assignments of dihydroflavonols of Pulicaria jaubertii: Potential cytotoxic and blood pressure lowering activity. Nat. Prod. Res. 2016, 30, 1280–1288. [Google Scholar] [CrossRef] [PubMed]
- Al-Maqtari, Q.A.; Mahdi, A.A.; Al-Ansi, W.; Mohammed, J.K.; Wei, M.; Yao, W. Evaluation of bioactive compounds and antibacterial activity of Pulicaria jaubertii extract obtained by supercritical and conventional methods. J. Food Measur. Charact. 2020, 15, 449–456. [Google Scholar] [CrossRef]
- Mohammed, H.A.; Abdelwahab, M.F.; El-Ghaly, E.S.M.; Ragab, E.A. Phytochemical Characterization, In Vitro Anti-Inflammatory, Anti-Diabetic, and Cytotoxic Activities of the Edible Aromatic Plant; Pulicaria jaubertii. Molecules 2021, 26, 203. [Google Scholar] [CrossRef]
- Muneer, A.; Alsanea, E.; Alfardi, T.; Alhaidari, S.; Alhaidari, H.; Alzhri, A. Nutritional, health-promoting properties and antioxidant activity of Yemeni fermented milk (Laban) and A Laban-Pulicaria jaubertii mixture. Turk. J. Agr. Food Sci. Technol. 2020, 8, 2049–2058. [Google Scholar] [CrossRef]
- Hussein, K.; Ahmed, A.; Al-Maqtari, M. Composition and radical scavenging activity of edible wild Pulicaria jaubertii (Asteraceae) volatile oil. P.S.M. Biol. Res. 2017, 2, 21–29. [Google Scholar]
- El-Ghaly, E.S.M.; Shaheen, U.; Ragab, E.; El-Hila, A.A.; Abd-Allah, M.R. Bioactive constituents of Pulicaria jaubertii: A promising antihypertensive activity. Pharm. J. 2016, 8, 81–86. [Google Scholar]
- Foudah, A.I.; Alam, A.; Soliman, G.A.; Salkini, M.A.; Elmutasim, O.I.A.; Yusufoglu, H.S. Pharmacognostical, antibacterial and antioxidant studies of aerial parts of Pulicaria somalensis (Family: Asteraceae). Asian J. Boil. Sci. 2016, 9, 19–26. [Google Scholar] [CrossRef]
- AOAC. Official Methods of Analysis, 19th ed.; Association of Official Analytical Chemists—AOAC International: Gaithersburg, MD, USA, 2012. [Google Scholar]
- Biesek, J.; Kuźniacka, J.; Banaszak, M.; Maiorano, G.; Grabowicz, M.; Adamski, M. The effect of various protein sources in goose diets on meat quality, fatty acid composition, and cholesterol and collagen content in breast muscles. Poult. Sci. 2020, 99, 6278–6286. [Google Scholar] [CrossRef]
- El-Ratel, I.T.; Ismail, R.F.; Fouda, S.F. Productive performance, carcass traits, lipid profile, antioxidants and immunity of growing rabbits treated with gum Arabic under Egyptian summer condition. Egypt. J. Nutr. Feeds 2019, 22, 143–154. [Google Scholar] [CrossRef]
- Goiri, I.; Ruiz, R.; Atxaerandio, R.; Lavin, J.L.; de Otálora, X.D.; García-Rodríguez, A. Assessing the potential use of a feed additive based on biochar on broilers feeding upon productive performance, pH of digestive organs, cecum fermentation and bacterial community. Anim. Feed Sci. Technol. 2021, 279, 115039–115049. [Google Scholar] [CrossRef]
- Al-Baadani, H.H.; Abudabos, A.M.; Al-Mufarrej, S.I.; Al-Baadani, A.A.; Alhidary, I.A. Dietary supplementation of Bacillus subtilis, Saccharomyces cerevisiae and their symbiotic effect on serum biochemical parameters in broilers challenged with Clostridium perfringens. J. Appl. Anim. Res. 2018, 46, 1064–1072. [Google Scholar] [CrossRef]
- Shahryari, M.; Tabeidian, S.A.; Shahraki, A.D.F.; Tabatabaei, S.N.; Toghyani, M.; Forouzmand, M.; Habibian, M. Using soy-bean acid oil or its calcium salt as the energy source for broiler chickens: Effects on growth performance, carcass traits, intestinal morphology, nutrient digestibility, and immune responses. Anim. Feed Sci. Technol. 2021, 276, 114919–114933. [Google Scholar] [CrossRef]
- Elnagar, R.; Elkenany, R.; Younis, G. Interleukin gene expression in broiler chickens infected by different Escherichia coli serotypes. Vet. World 2021, 14, 2727–2734. [Google Scholar] [CrossRef]
- Al-Baadani, H.H.; Alhotan, R.A.; Al-Abdullatif, A.A.; Alhidary, I.A.; Alharthi, A.S.; Al-Mufarrej, S.I.; Azzam, M.M. The effect of gum arabic supplementation on growth performance, blood indicators, immune response, cecal microbiota, and the duodenal morphology of broiler chickens. Animals 2022, 12, 2809. [Google Scholar] [CrossRef]
- SAS Institute. SAS Users Guide: Statistics; SAS Institute Inc.: Cary, NC, USA, 2008. [Google Scholar]
- Jamshidparvar, A.; Javandel, F.; Seidavi, A.; Peña Blanco, F.; Martínez Marín, A.L.; Avilés Ramírez, C.; Núñez-Sánchez, N. Effects of golpar (Heracleum persicum Desf.) and probiotics in drinking water on performance, carcass characteristics, organ weights, blood plasma constituents, and immunity of broilers. Environ. Sci. Pollut. Res. 2017, 24, 23571–23577. [Google Scholar] [CrossRef]
- Shirani, V.; Jazi, V.; Toghyani, M.; Ashayerizadeh, A.; Sharifi, F.; Barekatain, R. Pulicaria gnaphalodes powder in broiler diets: Consequences for performance, gut health, antioxidant enzyme activity, and fatty acid profile. Poult. Sci. 2019, 98, 2577–2587. [Google Scholar] [CrossRef]
- Mohebodini, H.; Jazi, V.; Ashayerizadeh, A.; Toghyani, M.; Tellez-Isaias, G. Productive parameters, cecal microflora, nutrient digestibility, antioxidant status, and thigh muscle fatty acid profile in broiler chickens fed with Eucalyptus globulus essential oil. Poult. Sci. 2021, 100, 100922–100931. [Google Scholar] [CrossRef]
- Ameri, S.; Samadi, F.; Dastar, B.; Zarehdaran, S. Efficiency of Peppermint (Mentha piperita) powder on performance, body temperature and carcass characteristics of broiler chickens in heat stress condition. Iran. J. Appl. Anim. Sci. 2016, 6, 943–950. [Google Scholar]
- Banisharif, M.; Kheiri, F.; Jalali, S.M.A. Hypericum perforatum and probiotic effects on performance, carcass characteristics and intestinal morphology in Japanese quails (Coturnix japonica). J. Med. Herb. 2016, 7, 83–88. [Google Scholar]
- Elabd, N.M. Using natural and synthetic antioxidants in low-protein diets to improve the performance of broiler and reduce lost nitrogen in feces. Egypt. Poult. Sci. J. 2018, 38, 1229–1242. [Google Scholar] [CrossRef]
- Dotas, V.; Bampidis, V.A.; Sinapis, E.; Hatzipanagiotou, A.; Papanikolaou, K. Effect of dietary field pea (Pisum sativum L.) supplementation on growth performance, and carcass and meat quality of broiler chickens. Livest. Sci. 2014, 164, 135–143. [Google Scholar] [CrossRef]
- Sharma, M.K.; Dinh, T.; Adhikari, P.A. Production performance, egg quality, and small intestine histomorphology of the laying hens supplemented with phytogenic feed additive. J. Appl. Poult. Res. 2020, 29, 362–371. [Google Scholar] [CrossRef]
- Huff, G.R.; Huff, W.E.; Jalukar, S.; Oppy, J.; Rath, N.C.; Packialakshmi, B. The effects of yeast feed supplementation on turkey performance and pathogen colonization in a transport stress/Escherichia coli challenge. Poult. Sci. 2013, 92, 655–662. [Google Scholar] [CrossRef]
- Kryeziu, A.J.; Mestani, N.; Berisha, S.; Kamberi, M.A. The European performance indicators of broiler chickens as influenced by stocking density and sex. Agron. Res. 2018, 16, 483–491. [Google Scholar]
- Bhamare, K.S.; Dildeep, V.; Senthil, M.S.; Chavan, S.J. Nutritive evaluation of cashew apple waste in broilers. Intern. J. Sci. Nat. 2016, 7, 629–632. [Google Scholar]
- Krishan, G.; Narang, A. Use of essential oils in poultry nutrition. J. Adv. Vet. Anim. Res. 2014, 1, 156–162. [Google Scholar] [CrossRef]
- Giannenas, I.; Bonos, E.; Skoufos, I.; Tzora, A.; Stylianaki, I.; Lazari, D.; Florou-Paneri, P. Effect of herbal feed additives on performance parameters, intestinal microbiota, intestinal morphology and meat lipid oxidation of broiler chickens. Br. Poult. Sci. 2018, 59, 545–553. [Google Scholar] [CrossRef]
- Chowdhury, S.; Mandal, G.P.; Patra, A.K.; Kumar, P.; Samanta, I.; Pradhan, S.; Samanta, A.K. Different essential oils in diets of broiler chickens: 2. Gut microbes and morphology, immune response, and some blood profile and antioxidant enzymes. Anim. Feed Sci. Technol. 2018, 236, 39–47. [Google Scholar] [CrossRef]
- Raju, S.; Gurram, S.; Bora, S.; Kumar, B.S. Effect of herbal immunomodulators on immune status, haematological and serum biochemical parameters of Japanese quails (Coutrinix japanica) during summer stress. Indian J. Anim. Sci. 2019, 89, 575–577. [Google Scholar] [CrossRef]
- Brockman, D.A.; Chen, X.; Gallaher, D.D. High-viscosity dietary fibers reduce adiposity and decrease hepatic steatosis in rats fed a high-fat diet. J. Nutr. 2014, 144, 1415–1422. [Google Scholar] [CrossRef]
- Dong, Z.L.; Wang, Y.W.; Song, D.; Hou, Y.J.; Wang, W.W.; Qi, W.T.; Li, A.K. The effects of dietary supplementation of pre-microencapsulated Enterococcus fecalis and the extract of Camellia oleifera seed on growth performance, intestinal morphology, and intestinal mucosal immune functions in broiler chickens. Anim. Feed Sci. Technol. 2016, 212, 42–51. [Google Scholar] [CrossRef]
- Dar, M.A.; Urwat, U.; Ahmad, S.M.; Ahmad, R.; Kashoo, Z.A.; Dar, T.A.; Heidari, M. Gene expression and antibody response in chicken against Salmonella Typhimurium challenge. Poult. Sci. 2018, 98, 2008–2013. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.D.; Song, M.H.; Yun, W.; Lee, J.H.; Kim, H.B.; Cho, J.H. Effect of carvacrol essential oils on immune response and inflammation-related genes expression in broilers challenged by lipopolysaccharide. Poult. Sci. 2019, 98, 2026–2033. [Google Scholar] [CrossRef]
- Martinez-Guryn, K.; Hubert, N.; Frazier, K.; Urlass, S.; Musch, M.W.; Ojeda, P.; Pierre, J.F.; Miyoshi, J.; Sontag, T.J.; Cham, C.M. Small intestine microbiota regulates host digestive and absorptive adaptive responses to dietary lipids. Cell Host Microbe 2018, 23, 458–469. [Google Scholar] [CrossRef]
- Xiao, Y.; Xiang, Y.; Zhou, W.; Chen, J.; Li, K.; Yang, H. Microbial community mapping in intestinal tract of broiler chicken. Poult. Sci. 2017, 96, 1387–1393. [Google Scholar] [CrossRef]
- Baldwin, S.; Hughes, R.J.; Hao Van, T.T.; Moore, R.J.; Stanley, D. At-hatch administration of probiotic to chickens can introduce beneficial changes in gut microbiota. PLoS ONE 2018, 13, e0194825. [Google Scholar] [CrossRef]
- Jazi, V.; Farahi, M.; Khajali, F.; Abousaad, S.; Ferket, P.; Assadi Soumeh, E. Effect of dietary supplementation of whey powder and Bacillus subtilis on growth performance, gut and hepatic function, and muscle antioxidant capacity of Japanese quail. J. Anim. Physiol. Anim. Nutr. 2020, 104, 886–897. [Google Scholar] [CrossRef]
- Al-Fatimi, M.; Awadh, N.A.A.; Wurster, M.; Al-Sokari, S.S.; Lindequist, U.; Setzer, W.N. Chemical composition, antimicrobial and antioxidant activity of the essential oil of Pulicaria jaubertii from South Yemen. World J. Pharm. Res. 2015, 4, 1–9. [Google Scholar]
Diet Ingredient (g/kg) | Basal Diet | ||
---|---|---|---|
1–10 Days | 11–24 Days | 25–35 Days | |
Corn | 527 | 574 | 616 |
Soybean meal 48% | 391 | 340 | 291 |
Corn oil | 37 | 44 | 53 |
Dicalcium phosphate | 18 | 16 | 15 |
Limestone | 10 | 9.2 | 8.6 |
Salt | 4.2 | 3.2 | 3.3 |
DL-Methionine | 3.5 | 3.2 | 2.9 |
L-Lysin HCl | 2.0 | 1.9 | 1.9 |
L-Threonine | 1.3 | 1.1 | 0.9 |
Premix Blank a | 5.0 | 5.0 | 5.0 |
Choline Cl 60% | 0.9 | 0.9 | 1.0 |
Sodium bicarbonate | 0.1 | 1.5 | 3.5 |
Total | 1000 | 1000 | 1000 |
Calculated nutrient composition (g/kg) | |||
ME, kcal/kg | 3000 | 3100 | 3200 |
Dry Meter | 924.9 | 932.3 | 928.3 |
Crude protein | 232.9 | 211.5 | 190.9 |
Crude fat | 65.1 | 72.6 | 81.6 |
Crude fiber | 28.3 | 27.2 | 26.1 |
Calcium | 9.6 | 8.7 | 7.9 |
Non-phytate P | 4.8 | 4.4 | 4.0 |
d Lysine | 12.8 | 11.5 | 10.3 |
d TSAA | 9.5 | 8.7 | 8.0 |
d Threonine | 8.6 | 7.7 | 6.9 |
d arginine | 14.3 | 12.8 | 11.4 |
Target Gene | Primer Sequences (5′ → 3′) | Product Length | Annealing Temperature (°C) | GenBank Accession Number |
---|---|---|---|---|
TNF-α | F: GGGAGTGTGAGGGGTATCCT R: CTGCACCTTCTGTCTCGGTT | 93 | 60 | MH180383.1 |
IL-1β | F: ACAAGCCGAACAAAGCACAC R: CTCCACATCTGGCTCACGTT | 106 | 61 | KY038171.1 |
IL-4 | F: GCAGCTGATCCGATTCCTGA R: TCCAACGTACTCTGGTTGGC | 99 | 60 | NM_000589.4 |
IL-6 | F: GGAGTGGCCAAGAACCAAGA R: ATGCTAAGGCACAGCACACT | 109 | 60 | AB028635.1 |
IL-10 | F: ACCGTGATTGGCAGGTACAG R: CTGGCCCTGGGTTCACTTAG | 123 | 58 | JQ687536.1 |
IL-12 | F: ATCCACTGGACCTCAGACCA R: CTCAGAGTCTCGCCTCCTCT | 122 | 59 | S82489.1 |
INF-Y | F: TCCCAGAAGCTATCTGAGCAT R: CCACCGTCAGCTACATCTGAAT | 200 | 58 | NM_205149.2 |
sIgA | F: TTCCTGAGTTGCCGAGTGAC R: AGGGATTTCTTGCTGGGAGC | 106 | 60 | DL232588.1 |
MUC-2 | F: CGGTGATGACAACGACTCCA R: AAGTTTGCACAGTCGTTCGC | 163 | 60 | AF167707.1 |
β-actin | F: CCTTCCTGGGTAGGTGTCG R: TGGCGTAGAGGTCCTTCCTG | 188 | 60 | AJ312193.1 |
Chemical Composition 1 | g/100 g of Pulicaria jaubertii |
Dry matter | 92.84 |
Crude protein | 15.52 |
Ash | 17.19 |
Crude fiber | 35.55 |
Total fat | 2.80 |
Fatty acids profile 2 | g/100 g of total fat |
Caproic acid | 2.37 |
Caprylic acid | 1.11 |
Lauric acid | 0.88 |
Tridecylic acid | 14.91 |
Isomyristic acid | 0.55 |
Myristic acid | 0.97 |
Palmitic acid | 20.31 |
Stearic acid | 9.59 |
Behenic acid | 0.22 |
Saturated fatty acids | 50.91 |
Elaidic acid | 0.37 |
Oleic acid | 20.48 |
Linoleic acid | 9.31 |
γ-Linolenic acid | 0.92 |
Linolelaidic acid | 14.08 |
Arachidonic acid | 1.83 |
Docosatetraenoic acid | 0.82 |
Docosapentaenoic acid | 0.65 |
Unsaturated fatty acids | 48.46 |
RT (min) | Hit Name | Mol Formula | % |
---|---|---|---|
3.896 | Benzeneethanol, 4-hydroxy | C8H10O2 | 4.24 |
4.073 | 2-Methoxyethylsemithiocarbazide | C4H11N3OS | 1.59 |
4.148 | 1,4-Benzenedicarboxylic acid, methyl ester | C9H7O4 | 2.49 |
4.256 | Benzaldehyde thiosemicarbazone | C8H9N3S | 21.35 |
4.462 | Dimethoxy-dimethyl silane | C6H16O4Si | 16.35 |
4.743 | Oxime-methoxy-phenyl | C8H9NO2 | 1.04 |
5.098 | 4′-Hydroxy-3′-methoxyacetophenone | C9H10O3 | 1.76 |
6.665 | 4-Amino-5-(4-acetylphenylazo) benzofurazan | C12H8N6O3 | 2.88 |
6.74 | 1,2-Dihydroanthra-thiazole-trione | C15H7NO3S | 3.42 |
7.85 | 2-Ethylacridine | C15H13N | 2.76 |
7.947 | 2-Propen-1, 3-(4-nitrophenyl)-1-phenyl | C15H11NO3 | 6.86 |
8.943 | Benzoic acid, methyl ester | C8H8O2 | 1.51 |
10.327 | Benzoic acid, 2,3-bis(trimethylsiloxy), methyl ester | C14H24O4Si2 | 1.78 |
11.895 | Morphinan, 7,8-didehydro-3-methoxy-17-methyl-6-methylene | C19H23NO | 1.55 |
12.141 | Coumarin, 3-(3,4-dimethoxyphenyl)-6-nitro | C11H11NO5 | 5.72 |
14.293 | Acetic acid, trimethyl ester | C11H29O5PSi3 | 1.34 |
15.975 | Benzophenone-4,4′-dicarboxylic acid dimethyl ester | C17H14O5 | 5.42 |
19.38 | 3-Propenoic acid | C13H19NO4 | 4.43 |
22.429 | 1,4-Benzenedicarboxylic acid, methyl ester | C9H7O4 | 3.42 |
25.182 | 4-Hydroxyphenylacetic acid, ethyl ester | C16H26O3Si | 2.84 |
27.694 | Ethyl (2-[(trimethylsilyl) oxy] phenyl) acetate | C13H20O3Si | 2.00 |
29.994 | tert-Butyldimethyl (2-propynyloxy) silane | C9H18OSi | 1.15 |
Parameters | Dietary Groups 1 | SEM 2 | p-Value | |||
---|---|---|---|---|---|---|
T1 | T2 | T3 | T4 | |||
Live weight, g | 2221.6 b | 2347.9 a | 2381.6 a | 2369.1 a | 31.52 | 0.008 |
Daily weight gain, g | 62.22 b | 65.75 a | 66.71 a | 66.35 a | 1.17 | 0.009 |
Daily feed intake, g | 93.76 | 89.80 | 90.93 | 91.11 | 1.08 | 0.129 |
Feed conversion ratio, g:g | 1.51 a | 1.36 b | 1.36 b | 1.37 b | 0.01 | <0.0001 |
Production efficiency index | 421.6 b | 491.3 a | 499.6 a | 493.1 a | 8.88 | <0.0001 |
Performance index | 144.6 b | 168.5 a | 171.4 a | 169.2 a | 3.09 | <0.0001 |
Parameters | Dietary Groups 1 | SEM 2 | p-Value | |||
---|---|---|---|---|---|---|
T1 | T2 | T3 | T4 | |||
Total protein, g/dL | 3.68 bc | 3.50 c | 4.05 ab | 4.34 a | 0.15 | 0.002 |
Albumin, g/dL | 1.89 | 1.66 | 1.86 | 2.08 | 0.09 | 0.060 |
Globulin, g/dL | 1.78 | 1.84 | 2.18 | 2.26 | 0.18 | 0.223 |
Albumin/Globulin | 1.06 | 0.94 | 1.01 | 0.99 | 0.10 | 0.869 |
Glucose, mg/dL | 162.70 | 153.13 | 162.00 | 174.50 | 8.36 | 0.462 |
Triglycerides, mg/dL | 94.18 a | 100.47 a | 91.23 a | 75.51 b | 4.03 | 0.003 |
Total cholesterol, mg/dL | 136.84 a | 121.20 b | 108.00 c | 122.85 b | 3.92 | 0.0004 |
High-density lipoprotein, mg/dL | 52.64 | 46.33 | 46.78 | 63.00 | 4.82 | 0.124 |
Low-density lipoprotein, mg/dL | 65.36 | 54.76 | 42.96 | 44.74 | 6.26 | 0.081 |
Parameters (%) | Dietary Groups 1 | SEM 2 | p-Value | |||
---|---|---|---|---|---|---|
T1 | T2 | T3 | T4 | |||
Thymus | 0.35 | 0.39 | 0.43 | 0.37 | 0.05 | 0.755 |
Bursa | 0.19 | 0.17 | 0.20 | 0.17 | 0.02 | 0.419 |
Spleen | 0.09 | 0.09 | 0.10 | 0.11 | 0.01 | 0.280 |
Liver | 1.81 b | 2.11 a | 2.09 a | 1.99 ab | 0.07 | 0.030 |
Heart | 0.48 | 0.46 | 0.47 | 0.90 | 0.19 | 0.415 |
Pancreas | 0.22 | 0.21 | 0.22 | 0.24 | 0.01 | 0.602 |
Kidney | 0.51 | 0.53 | 0.39 | 0.50 | 0.05 | 0.194 |
Parameters | Dietary Groups 1 | SEM 2 | p-Value | |||
---|---|---|---|---|---|---|
T1 | T2 | T3 | T4 | |||
Anaerobic bacteria | 10.89 | 12.11 | 11.91 | 11.97 | 0.35 | 0.082 |
Lactobacillus spp. | 9.57 b | 10.88 a | 11.15 a | 11.01 a | 0.36 | 0.021 |
Clostridium perfringens | 11.10 | 10.49 | 11.01 | 10.75 | 0.31 | 0.523 |
Aerobic bacteria | 11.42 | 11.89 | 12.11 | 11.91 | 0.28 | 0.381 |
Escherichia coli | 7.86 | 8.20 | 7.56 | 7.66 | 0.23 | 0.250 |
Salmonella spp. | 8.07 a | 7.37 b | 6.74 c | 6.96 bc | 0.19 | 0.0005 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alharthi, A.S.; Alruwaili, N.W.; Al-Baadani, H.H.; Al-Garadi, M.A.; Shamlan, G.; Alhidary, I.A. Investigating the Effect of Pulicaria jaubertii as a Natural Feed Additive on the Growth Performance, Blood Biochemistry, Immunological Response, and Cecal Microbiota of Broiler Chickens. Animals 2023, 13, 1116. https://doi.org/10.3390/ani13061116
Alharthi AS, Alruwaili NW, Al-Baadani HH, Al-Garadi MA, Shamlan G, Alhidary IA. Investigating the Effect of Pulicaria jaubertii as a Natural Feed Additive on the Growth Performance, Blood Biochemistry, Immunological Response, and Cecal Microbiota of Broiler Chickens. Animals. 2023; 13(6):1116. https://doi.org/10.3390/ani13061116
Chicago/Turabian StyleAlharthi, Abdulrahman S., Nawaf W. Alruwaili, Hani H. Al-Baadani, Maged A. Al-Garadi, Ghalia Shamlan, and Ibrahim A. Alhidary. 2023. "Investigating the Effect of Pulicaria jaubertii as a Natural Feed Additive on the Growth Performance, Blood Biochemistry, Immunological Response, and Cecal Microbiota of Broiler Chickens" Animals 13, no. 6: 1116. https://doi.org/10.3390/ani13061116
APA StyleAlharthi, A. S., Alruwaili, N. W., Al-Baadani, H. H., Al-Garadi, M. A., Shamlan, G., & Alhidary, I. A. (2023). Investigating the Effect of Pulicaria jaubertii as a Natural Feed Additive on the Growth Performance, Blood Biochemistry, Immunological Response, and Cecal Microbiota of Broiler Chickens. Animals, 13(6), 1116. https://doi.org/10.3390/ani13061116