Next Article in Journal
Electroencephalogram and Physiological Responses as Affected by Slaughter Empathy in Goats
Next Article in Special Issue
Molecular Detection and Epidemiology of Potentially Zoonotic Cryptosporidium spp. and Giardia duodenalis in Wild Boar (Sus scrofa) from Eastern Spain
Previous Article in Journal
Correction: da Silva et al. Increased Sulphur Amino Acids Consumption as OH-Methionine or DL-Methionine Improves Growth Performance and Carcass Traits of Growing-Finishing Pigs Fed under Hot Conditions. Animals 2022, 12, 2159
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Occurrence of Giardia duodenalis in Cats from Queretaro and the Risk to Public Health

by
Nerina P. Veyna-Salazar
1,
Germinal J. Cantó-Alarcón
2,
Andrea M. Olvera-Ramírez
3,
Felipe J. Ruiz-López
4,
Rodolfo Bernal-Reynaga
5,
Isabel Bárcenas-Reyes
2 and
Marina Durán-Aguilar
2,*
1
Doctorado en Ciencias Biológicas, Facultad de Ciencias Naturales, Universidad Autónoma de Querétaro, Avenida de las Ciencias S/N Juriquilla, Delegación Santa Rosa Jáuregui, Querétaro 76230, Mexico
2
Cuerpo Académico Mejoramiento Animal Integral, Facultad de Ciencias Naturales, Universidad Autónoma de Querétaro, Avenida de las Ciencias S/N Juriquilla, Delegación Santa Rosa Jáuregui, Querétaro 76230, Mexico
3
Cuerpo Académico Salud Animal y Microbiología Ambiental, Facultad de Ciencias Naturales, Universidad Autónoma de Querétaro, Avenida de las Ciencias S/N Juriquilla, Delegación Santa Rosa Jauregui, Querétaro 76230, Mexico
4
Centro Nacional de Investigación en Fisiología y Mejoramiento Animal, INIFAP-SAGARPA, México. Km1. Carr. Ajuchitlán-Colón Ajuchitlán, Querétaro 76280, Mexico
5
Cuerpo Académico de Salud Pública, Unidad de Investigaciones en Salud Pública “Dra. Kaethe Willms”, Facultad de Ciencias Químico Biológicas, Universidad Autónoma de Sinaloa, Ave. de las Américas y Blvd. Universitarios, Ciudad Universitaria, Culiacán 80100, Mexico
*
Author to whom correspondence should be addressed.
Animals 2023, 13(6), 1098; https://doi.org/10.3390/ani13061098
Submission received: 9 February 2023 / Revised: 17 March 2023 / Accepted: 18 March 2023 / Published: 20 March 2023
(This article belongs to the Special Issue Parasitic Zoonoses: From a Public Health Perspective)

Abstract

Simple Summary

Giardia duodenalis is a flagellated protozoan that has been reported worldwide. Its resistance to adverse climates and its wide host range makes this parasite a serious problem specifically in developing countries where personal hygiene practices are inadequate. The magnitude of the risk of transmission from cats to humans is not well known; to date, in Mexico, there has not been a single study of the presence of G. duodenalis in cats. Therefore, the objective of this work is to determine the frequency and importance of the cat as a potential zoonotic reservoir of Giardia. Sampling of feces was performed in private clinics and an animal control unit. A direct microscopy diagnosis was carried out, and once positive results were obtained, PCR and RFLP were performed in order to obtain assemblages. The results obtained in the present study, in terms of the genetic characterization, showed only assemblage A, which indicates that the cat is an important source of transmission to humans, with consequences for public health.

Abstract

Giardia is a protozoan that affects humans as well as a wide range of domestic species. It is distributed worldwide, and the highest frequency is seen in developing countries. Due to the potential for domestic cats to be carriers of this parasite and subsequently transmit the infection to humans, it is important to know the risk of transmission. For this reason, the objective of this study was to determine the frequency of this parasite in the cat population of the city of Santiago de Queretaro, Mexico, and identify the assemblages present to determine the role this host plays in public health, this being the first study of its type to be performed in the country. This was a cross-sectional study during which 200 fecal samples were collected from cats of both sexes and varying ages and strata of origin. The samples were analyzed by microscopy following the flotation technique, having obtained a general frequency of 25%. Giardia cysts were found at higher frequency in pasty stools. The assemblages found were zoonotic, specifically assemblage A, which suggests that the cat poses an important risk for the dissemination of the parasite to humans, making it an important public health problem.

1. Introduction

Giardia duodenalis is one of the most common gastrointestinal parasites that affects humans. Its resistance to adverse climates and its wide host range make it a serious problem, more so in places that lack good personal hygiene practices [1,2]. Because giardiosis can occur following the ingestion of only 10 cysts, this protozoan is considered a risk to public health [3]. Despite having been discovered 400 years ago, the disease is considered a re-emerging disease [4]. Worldwide, about 200 million people are reported to be infected with the parasite, mainly in Asia, Africa, and Latin America, and approximately 500,000 new cases are reported annually [5].
Giardia is transmitted through the fecal–oral route, frequently due to the ingestion of food and water contaminated with the parasite’s cysts, or by host-to-host contact [6], The most susceptible section of a population includes infants in daycare, daycare workers, travelers to regions where the protozoan is endemic, people with immunodeficiencies and cystic fibrosis, and those who participate in oral and anal sexual practices [7].
Giardia duodenalis has a direct life cycle that is composed of two morphologically different stages. On the one hand, the infective stage, or cyst, is responsible for causing the infection. The cyst can survive in the environment for months under optimal conditions (4 °C) [8]. On the other hand, the invasive stage, or trophozoite, is responsible for causing the disease due to its colonization in the upper parts of the small intestine. Previously, the cyst was considered to be a cryptobiotic form; however, it was found that its oxygen consumption is 15% of that of trophozoites and it is capable of passing through the stomach and excysting in the duodenum [9].
Giardiosis can manifest symptomatically and asymptomatically; the fact that this parasite is found to a greater extent in asymptomatic patients, including cats, increases the risk of transmission to humans [10]. Although it is said that the presence of clinical signs could be linked to host factors, such as immune response, it may also be due to virulence factors of the strain of the infecting parasite [11]. However, the risk factors that may trigger the clinical disease are not yet known with certainty [12]. The most common signs of giardiosis include diarrhea, steatorrhea, abdominal pain, and weight loss [11]. Clinical manifestation of giardiosis may also be related to the assemblages present, with assemblage A being associated with acute disease and the presence of explosive diarrhea, and assemblage B being associated with chronic disease [4,13,14].
Studies indicate that cysts are passed through the stool intermittently, making diagnosis difficult and mistaking it with other gastrointestinal diseases. The low sensitivity of coproparasitoscopic tests makes detection of the disease even more difficult, for which a minimum of three serial tests are needed to observe the morphological forms [15].
The presence of G. duodenalis depends on variables such as geographic area, sanitary conditions, and number of animals sharing the same space. Epidemiological studies allow us to understand the importance of giardiosis in different regions of the world, characterizing the presence of the zoonotic and non-zoonotic assemblages and the risk of people living with companion animals, especially cats [16,17].
The reported prevalence of Giardia in humans in Mexico is variable, ranging from 2 to 50%, depending on the region, with preschool-age children being the most susceptible [18,19]. With regard to cats, studies have reported prevalences ranging from 1 to 43% (Table 1).
Giardia affects a wide range of species, and the fact that it can infect humans and animals raises concern regarding the risk to public health posed by companion animals [32]. The level of risk depends on the prevalence and assemblages present, and since cats are reservoirs of this parasite, this causes public health problems, affecting the health of humans and animals [33].
To date, the magnitude of the risk of transmission from cats to humans is not well known. Studies on the genetic variability of G. duodenalis have identified four main genetic groups. Groups A and B generally affect humans, while groups C and D affect dogs, and group F is more specific to cats. However, there are reports of groups A and B infecting cats and dogs. Group A includes four subgroups: AI to AIV. Subgroups AI and AII can be found in both humans and animals, but AIII and AIV are exclusive to animals [34,35]. Currently, mixed infections with assemblages belonging to humans and cats have been reported; therefore, from an epidemiological point of view, this suggests that there is a potential environmental reservoir for giardiosis in urban areas [36]. In Mexico, studies have been performed regarding the prevalence and presence of zoonotic assemblages in dogs, sheep, and cattle [19,37,38]; however, there are no reports of the occurrence of G. duodenalis or its assemblages in cats. For this reason, the present study aims to determine the occurrence of assemblage A and its sub-assemblages (AI, AII) in cats that affect humans as well as the role that cats have as potential transmitters of this protozoan to humans.

2. Materials and Methods

2.1. Study Setting and Sampling

The study was performed in the city of Santiago de Queretaro, located in the center of Mexico. This city has a territorial extension pf 263 km2, a population of 1,049,777, and a temperate, semi-arid climate (20 °C annual average temperature, 720 mm2 per year, 38.2% humidity). For the study, 200 fecal samples were obtained from cats from two different strata of origin: (1) without an owner or “unowned” (stray and feral cats), from the municipal animal control unit (UCAM), and (2) with an owner (pet cats), from private veterinary clinics. The samples were labeled and data regarding age and sex of the cats and consistency of the feces was recorded. The samples were then transported to the parasitology lab of the Autonomous University of Queretaro (UAQ), where they were stored at 4 °C until further processing.
A total of 200 samples were distributed, as follows: by strata of origin, 103 were from cats with owners and 97 from cats without owners; by age, 72 were from cats under 6 months and 128 were from cats over 6 months; by gender, 109 were from females and 91 were from males; and by stool consistency, 139 stools were firm and 61 were pasty.

2.2. Coproparasitoscopic Analysis

Two grams of each fecal sample were processed using the flotation technique with zinc sulfate, as described by Dryden et al. [39]. A drop of fecal suspension was transferred to a microscope slide with a cover slip and examined at 40X magnification for identification of cysts. A sample was considered positive if cysts were observed.

2.3. Sample Pooling

After identifying the positive samples, seven pools were made. It was not possible to make more pools because of the low volume of the samples obtained from the cats. All of the positive samples with a sufficient quantity of feces were pooled. Each pool consisted of four positive samples (totaling 28 samples) in order to obtain a minimum of 5 g of feces, which is required for cyst concentration with the sucrose gradient method [40]. This technique was required due to the necessity of obtaining a sufficient number of cysts to perform an optimal DNA extraction [41].

2.4. DNA Extraction

DNA extraction was performed following the technique described by Babaei et al. [42], with some modifications to obtain more DNA from each sample. A 200 µL volume of the concentrated cyst suspension was transferred into a 2 mL Eppendorf tube with 200 µL of glass beads (0.1 mm) and 500 µL of a buffer lysis solution (100 mM NaCl, 50 mM Tris HCl, 100 mM EDTA, 1% SDS, pH 7.4) and homogenized in a Powerlyzer 24 (MO BIO, Carlsbad, CA, USA) with five 2 min cycles in liquid nitrogen and boiling water. A 40 µL volume of proteinase K and 10 µL of SDS (1 M) were added, and the reaction was incubated at 55 °C for 4 h. Subsequently, DNA was extracted using the CTAB method, as described by De Almeida et al. [43].

2.5. PCR, RFLP, and Sequencing

Fragments of the β-giardin gene were amplified in two phases using the following primers: G7 5′-AAGCCCGACGACCTCACCCGCAGTGC-3′ and G759 5′-GAGGCCGCCCTGGATCTTCGAGACGAC-3′ for an initial reaction, and G376 5′-CATAACGAC-GCCATCGCGGCTCTCAGGAA-3′ and G759 for a second reaction. The cycling conditions were those described by Caccio et al. [44]. The reaction mixture consisted of 6.25 µL of GoTaq Green Master Mix 2X (Promega, Madison, WI, USA), 0.4 µL of each primer (10 µM), 1 µL of BSA, 2.45 µL of nuclease-free water, and 2 µL of DNA (100 ng/µL). PCR products were analyzed by 2% agarose gel electrophoresis (Thermo Scientific Waltham, MA, USA), submerged in TAE 1X buffer (55 min, 75 volts), including a molecular weight marker of 100 pb (Promega, Madison, WI, USA), and blue/orange 6X loading buffer (Promega, Madison, WI, USA).
For genetic characterization, restriction fragment length polymorphism (RFLP) analysis was performed using 10 µL of the second PCR product (380 bp) and 0.25 µL of restriction enzyme HhaI (Promega, Madison, WI, USA), for a total reaction volume of 10.25 µL, and then incubated in a water bath at 37 °C for 2 h [44]. Banding patterns were analyzed by 3% agarose gel electrophoresis (Thermo Scientific Waltham, MA, USA), submerged in TAE 1X buffer (90 min, 70 volts), including a molecular weight marker of 100 pb (Promega, Madison, WI, USA), and blue/orange 6X loading buffer (Promega, Madison, WI, USA).
To validate the resulting amplicon as Giardia duodenalis, the second PCR product was sequenced, also using the G759 and G376 primers mentioned above. Sanger sequencing was performed by the National Laboratory of Genomics for Biodiversity (LANGEBIO-CINVESTAB, Irapuato, Guanajuato, Mexico) using a [PacBio/Illumina/Ion Torrent/etc instrument]. For validation, the sequences were compared against G. duodenalis reference sequences found in NCBI using the BLAST (blastn) web tool, which is available at https://blast.ncbi.nlm.nih.gov/Blast.cgi. Accesed on 5 May 2022.

2.6. Statistical Analysis

A χ2 analysis was used to determine associations between the presence of the parasite and any of the variables (age, sex, strata of origin, and stool consistency) using SPSS Statistics software, version 25.0 (IBM Corp, Armonk, NY, USA). Associations were considered statistically significant if p < 0.05.

3. Results

3.1. Coproparasitoscopic Analysis

Based on the zinc sulfate flotation technique, cysts were detected by microscopy in 50 out of the 200 samples analyzed, obtaining an overall occurrence of 25%. Significant statistical associations for the presence of the parasite were determined for age and stool consistency (Table 2). Detection of G. duodenalis was similar in cats with and without an owner (p > 0.05). Regarding age, the occurrence was higher in young cats (33%) than in adults (20%) (p < 0.05). For stool consistency, the occurrence was higher in cats with pasty stool (44%) as opposed to those with firm stool (16%) (p < 0.05). Finally, sex didn’t show significant association, as the occurrence was similar in males (24%) and females (25%) (p > 0.05).

3.2. PCR, RFLP, and Sequencing

Seven groups of pooled samples were obtained based on age, sex, and strata of origin. These pools showed a good number of cysts (at least 10 cysts per field with a 40x objective). A fragment specific to the β-giardin gene was amplified from all of them, obtaining a 753 bp product for the first PCR reaction and a 384 bp product for the second (Figure 1). Original figures were shown in Figure S1.
RFLP on the fragments corresponding to the second PCR product (384 bp) resulted in the detection of assemblage A in all the pools. Three were further determined as the AI assemblage, with a fragment pattern of 70, 100, and 190 bp, and four were assemblage AII, consistent with a fragment pattern of 70 and 210 bp (Figure 2).
Two sequences were recovered from the sanger sequencing results, one from the G759 primer and one from G376 (Appendix A). BLAST results showed 99% identity similarity to the β-giardin gene sequences reported in GenBank. These sequences were submitted to the GenBank: PRJNA945414.

4. Discussion

The estimated occurrence of G. duodenalis obtained in this study and the assemblages detected indicate that cats represent an important risk for the transmission of this protozoan to humans in Santiago de Queretaro, this being the first study of its type carried out in Mexico. The overall occurrence was 25%, similar to that obtained by studies on cats from Serbia and Colombia [28,45]; however, higher than that reported worldwide (12%) [46] and lower than that reported in Brazil (32%) [47]. The diagnostic method used in the present study was zinc sulfate with centrifugation, which has proven to have a sensitivity of over 72% if a single sample is analyzed [48,49]. This technique has been considered the gold standard for the diagnosis of Giardia in dogs and cats [39]. However, due to the intermittent excretion of cysts and because only one sample was collected rather than the three recommended [49] the occurrence obtained in this study could be underestimated.
Differences in occurrence were seen in each of the categories defined, such as strata of origin (owned vs. unowned), age, sex, and stool consistency. Regarding their origin, the occurrence was slightly higher for cats with owners (28%) than for cats without owners (21%); in Mexico, it is more common for household cats to have access to the exterior and roam the streets, which inadvertently puts their owners at higher risk for infection [50].
A significant association with age was identified in this study, where young cats (<6 months) had a higher occurrence (30%) than adults (21%) (p < 0.05). Similar findings were reported by Nikolic et al. [45], in which G. duodenalis was detected in young cats at a frequency of 30.4% but only in 19% of adults. Therefore, the age of the animals could potentially be a risk factor for becoming infected with this parasite, most likely due to their adaptive immunity not being fully developed [45]. Consequently, these young cats can excrete high amounts of cysts per gram of feces; therefore, they represent a significant source of infection [45,51,52]. In contrast, sex was not a statistically significant factor (p > 0.05), obtaining a frequency of 24% for males and 25% for females, coinciding with previously published studies [22,53].
As our results show, stool consistency was an important factor for detecting giardiosis in cats, as diarrhea or pasty stool with steatorrhea are among the main clinical signs observed in cats with this disease [2]. Therefore, in the present study, cats with pasty stools (44%) were significantly (p < 0.05) more likely to be infected than those that had firm stools (16%) (Table 2). These findings agree with those of other studies in which G. duodenalis was detected more frequently from animals with diarrhea [53,54,55].
For the molecular analysis, we pooled the positive samples to ensure a high yield of DNA, and this strategy has proven to be cost-effective and efficient for obtaining precise results [56]. Pooling of samples has also been commonly used in veterinary medicine as a fast and safe method for estimating prevalene based on microscopy results [57,58]. Additionally, molecular studies have used this pooling method to increase sensitivity at the group level, which has shown to be a reliable method for the detection of several microorganisms [46,59,60]. Here, PCR was performed on each of the seven pools targeting a fragment of the β-giardin gene due to its specificity for G. duodenalis and its high sensitivity for genetic characterization, both of which were essential for the objectives of this study [38,44,61].
The results show assemblage A, which suggests that the cat could be an important transmitter of this protozoan to humans [24] In this study, assemblage B was not analyzed due to the fact that its presence in Mexico is very low and it has only been found twice in humans and never in domestic animals [19,62]. The presence of assemblage A raises the concern of zoonotic transmission due to the association with the presence of clinical signs of the disease [13]. This coincides with other reports in which the zoonotic assemblages dominated in the cat population [24,63,64,65]; in contrast, some studies have detected cat-specific assemblage (F) at a higher frequency [66,67,68]. Here, further genetic characterization showed that assemblage AII was present at a higher proportion (57%) than assemblage AI (42%), coinciding with Procesi et al. [63]. Because AII is predominantly present in humans and is associated with virulence factors that may trigger clinical manifestations, this finding raises the concern for zoonotic transmission [69,70]. Studies carried out in North America have reported three assemblages in cats: AI and AII from group A and groups B and F [71,72], coinciding also with assemblage A detected here. In Mexico, the current cat population is at approximately 16.2 million; pet cats are not regularly spayed/neutered and usually have unrestricted access to the outdoors. Also, some can become free-roaming cats, without necessary preventative care to control these diseases. Gerold and Jessup have described that free-roaming cats represent a significant source of zoonotic diseases, including rabies, toxoplasmosis, larva migrans, tularemia, and plague [33]. Consequently, the high level of interaction among cats can lead to an increased risk of cat-to-cat transmission of pathogens, with subsequent transmission to humans and other animals.
The close contact that exists between humans and their pet cats needs to be taken into consideration due to the high occurrence and assemblages observed [73]. From this perspective, it is important to emphasize the need to develop effective strategies for the control of these zoonotic diseases, as well as raise awareness among the population and encourage responsible ownership and proper management in order to reduce the risk of transmission.

5. Conclusions

The high occurrence rate of G. duodenalis observed in this study, as well as the presence of assemblages A only, makes evident the source of infection that cats represent for humans and other domestic animals. With this knowledge, control measures need to be carried out in order to minimize or eliminate the risk of Giardia transmission to cat owners.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani13061098/s1, Figure S1: Original figures.

Author Contributions

Conceptualization, N.P.V.-S., G.J.C.-A. and M.D.-A.; methodology, N.P.V.-S., A.M.O.-R., I.B.-R., M.D.-A., R.B.-R., F.J.R.-L. and G.J.C.-A.; formal analysis, N.P.V.-S., G.J.C.-A. and M.D.-A.; investigation, N.P.V.-S., G.J.C.-A. and A.M.O.-R.; resources, I.B.-R., A.M.O.-R. and G.J.C.-A.; data curation, N.P.V.-S. and G.J.C.-A.; writing—original draft preparation, N.P.V.-S. and G.J.C.-A.; writing—review and editing, N.P.V.-S., A.M.O.-R., M.D.-A., R.B.-R. and G.J.C.-A.; visualization, N.P.V.-S., G.J.C.-A. and A.M.O.-R.; supervision, N.P.V.-S., G.J.C.-A. and A.M.O.-R.; project administration, N.P.V.-S. and G.J.C.-A. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the special funds of research FOPER from the Autonomous University of Queretaro, grant number FCN02613.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Not applicable.

Acknowledgments

The authors thank Susana Sosa for her aid and support for the fulfillment of this project.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Appendix A.1. Sequencing Analysis for the forward Primer G736 > B_Giardin_G376_Partial Sequence

CGAGAAGGTCGCAGAGGGCTTCGCCCGCATCTCCGCCGCGATCGAGAAGGAGA CGATCGCCCGCGAGAGGGCCGTTAGTGCTGCCACGACAGAAGCGCTCACAAAC ACGAAGCTCGTCGAGAAGTGCGTCAACGAGCAGCTCGAGAACGTCGCCTCGGA GATCCGCGCTATCCAGGAGGAGATCGACCGCGAGAAGGCCGAGCGCAAGGAG GCAGAGGACAAGATCGTCAACACTCTCGAGGACGTCGTCTCGAAGATCCAGGG CGGCCTCA
Table A1. BLAST results for the sequence obtained by PCR amplification of the G. duodenalis β-giardin gene (primer G376).
Table A1. BLAST results for the sequence obtained by PCR amplification of the G. duodenalis β-giardin gene (primer G376).
DescriptionMax
Score
Total
Score
Query
Cover
E
Value
Ident.Accession
Giardia intestinalis isolate CAT clone 2 beta-giardin gene, complete cds49649699%1 × 10−13599.63%EU014386.1
Giardia intestinalis isolate B7V_oct’11 note assemblage AI beta-giardin gene, partial cds497496100%3 × 10−13699.63%KF963547.1
Giardia intestinalis isolate 34H beta-giardin gene, partial cds497497100%3 × 10−13699.63%DQ466765.1

Appendix A.2. Sequencing Analysis for the forward Primer G759 > B_Giardin_G759_Partial Sequence

GGATCTCCGAGGCGACGTCCTCGAGCTGCTCGTTGACGCACTTCTCGACGAGCT TCGTGTTTGTGAGCGCTTCTGTCGTGGCAGCGCTAACGGCCCTCTCGCGGGCGAT CGTCTCCTTCTCGATCGCGGCGGAGATGCGGGCGAAGCCCTCTGCGACCTTCTCG TTGAGCTGGTCGTACATCTTCTTCCTTTCTGCGTTCTCCGTGGCAATGCGTCTCGA GATCGTTCAGGCTCTTGAGGGCCTCCTTCCTGAGAGCCGCGATGGCGTCGTTATG A
Table A2. BLAST results for the sequence obtained by PCR amplification of the G. duodenalis β-giardin gene (primer G759).
Table A2. BLAST results for the sequence obtained by PCR amplification of the G. duodenalis β-giardin gene (primer G759).
DescriptionMax
Score
Total
Score
Query
Cover
E
Value
Ident.Accession
Giardia intestinalis isolate 9C beta-giardin gene, partial cds508508100%1 × 10−13999.64%DQ466729.1
Giardia intestinalis isolate Z1 beta-giardin gene, partial cds50750799%5 × 10−13999.64%MN629930.1
Giardia intestinalis strain VANC/96/UBC/126 beta-giardin (bg) gene, partial cds50750799%5 × 10−13999.64%KP687765.1

References

  1. Savioli, L.; Smith, H.; Thompson, A. Giardia and Cryptosporidium join the ‘Neglected Diseases Initiative’. Trends Parasitol. 2006, 22, 203–208. [Google Scholar] [CrossRef]
  2. Aw, J.Y.H.; Clarke, N.E.; McCarthy, J.S.; Traub, R.J.; Amaral, S.; Huque, H.; Andrews, R.M.; Gray, D.J.; Clements, A.C.A.; Nery, S.V. Giardia duodenalis infection in the context of a community-based deworming and water, sanitation and hygiene trial in Timor-Leste. Parasites Vectors 2019, 12, 491–510. [Google Scholar] [CrossRef]
  3. Rendtorff, R.C. The experimental transmission of human intestinal protozoan parasites: II. Giardia lamblia Cysts Gwen in Capsules. Am. J. Epidemiol. 1954, 59, 209–222. [Google Scholar] [CrossRef]
  4. Thompson, R. Giardiasis as a re-emerging infectious disease and its zoonotic potential. Int. J. Parasitol. 2000, 30, 1259–1267. [Google Scholar] [CrossRef] [PubMed]
  5. Balderrama-Carmona, A.P.; Gortares-Moroyoqui, P.; Moran-Palacio, E.F.; Ulloa-Mercado, R.G.; Diaz-Tenorio, L.M.; Leyva-Soto, L.A. Risk assesmet for Giardia in enviromental samples. In Current Topics in Giardiasis, 1st ed.; Alfonso Rodriguez Morales; IntechOpen: Ryjeca, Croacia, 2017; pp. 147–164. [Google Scholar] [CrossRef]
  6. Lujan, H.D. Giardia y Giardiasis. Medicina 2006, 66, 70–74. [Google Scholar] [PubMed]
  7. Leung, A.K.; Leung, A.A.; Wong, A.H.; Sergi, C.M.; Kam, J.K. Giardiasis: An Overview. Recent Pat. Inflamm. Allergy Drug Discov. 2019, 13, 134–143. [Google Scholar] [CrossRef]
  8. Adam, R.D. Biology of Giardia lamblia. Clin. Microbiol. Rev. 2001, 14, 447–475. [Google Scholar] [CrossRef]
  9. Paget, T.A.; Macechko, P.T.; Jarroll, E.L. Metabolic Changes in Giardia intestinalis during Differentiation. J. Parasitol. 1998, 84, 222–226. [Google Scholar] [CrossRef]
  10. Heresi, G.P.; Murphy, J.R.; Cleary, T.G. Giardiasis. Semin. Pediatr. Infect. Dis. 2000, 11, 189–195. [Google Scholar] [CrossRef]
  11. Thompson, R.; Reynoldson, J.; Mendis, A. Giardia and Giardiasis. Adv. Parasitol. 1993, 32, 71–160. [Google Scholar] [CrossRef] [PubMed]
  12. Williamson, A.; O’Donoghue, P.; Upcroft, J.; Upcroft, P. Immune and pathophysiological responses to different strains of Giardia duodenalis in neonatal mice. Int. J. Parasitol. 2000, 30, 129–136. [Google Scholar] [CrossRef] [PubMed]
  13. El-Basha, N.R.; Zaki, M.M.; Hassanin, O.M.; Rehan, M.K.; Omran, D. Giardia Assemblages A and B in Diarrheic Patients: A Comparative Study in Egyptian Children and Adults. J. Parasitol. 2016, 102, 69–74. [Google Scholar] [CrossRef]
  14. Puebla, L.E.J.; Núñez, F.A.; Silva, I.M.; Rivero, L.R.; González, M.M.; Sutil, Y.M.; Valdés, L.A.; Millán, I.A.; Müller, N. Molecular Characterization and Risk Factors of Giardia duodenalisamong School Children from La Habana, Cuba. J. Parasitol. Res. 2015, 2015, 378643. [Google Scholar] [CrossRef]
  15. Nash, T.E.; Herrington, D.A.; Losonsky, G.A.; Levine, M.M. Experimental Human Infections with Giardia lamblia. J. Infect. Dis. 1987, 156, 974–984. [Google Scholar] [CrossRef] [PubMed]
  16. Jiménez-Cardoso, E.; Eligio-García, L.; Cortés-Campos, A.; Estrada, A.C.; Pinto-Sagahón, M.; Noguera-Estrada, C. The frequency of intestinal parasites in puppies from Mexican kennels. Health 2010, 02, 1316–1319. [Google Scholar] [CrossRef]
  17. Ramírez-Ocampo, S.; Cotte-Alzate, J.D.; Escobedo, Á.A.; Rodríguez-Morales, A.J. Prevalence of zoonotic and non-zoonotic genotypes of Giardia intestinalis in cats: A systematic review and meta-analysis. Infez. Med. 2017, 25, 326–338. [Google Scholar] [CrossRef]
  18. Cedillo, R.; Leal, Y.; Yepez, L.; Gomez, A.; Ortega, G.; Tapia, R.; Muñoz, O. Seroepidemiology of Giardiasis in Mexico. Am. J. Trop. Med. Hyg. 2009, 80, 6–10. [Google Scholar] [CrossRef]
  19. García-Cervantes, P.C.; Báez-Flores, M.E.; Delgado-Vargas, F.; Ponce-Macotela, M.; Nawa, Y.; De-La-Cruz-Otero, M.D.-C.; Martínez-Gordillo, M.N.; Díaz-Camacho, S.P. Giardia duodenalis genotypes among schoolchildren and their families and pets in urban and rural areas of Sinaloa, Mexico. J. Infect. Dev. Ctries. 2017, 11, 180–187. [Google Scholar] [CrossRef]
  20. Sommer, M.; Rupp, P.; Pietsch, M.; Kaspar, A.; Beelitz, P. Giardia in a selected population of dogs and cats in Germany—diagnostics, coinfections and assemblages. Vet. Parasitol. 2018, 249, 49–56. [Google Scholar] [CrossRef]
  21. Paoletti, B.; Otranto, D.; Weigl, S.; Giangaspero, A.; Di Cesare, A.; Traversa, D. Prevalence and genetic characterization of Giardia and Cryptosporidium in cats from Italy. Res. Vet. Sci. 2010, 91, 397–399. [Google Scholar] [CrossRef]
  22. Mircean, V.; Györke, A.; Jarca, A.; Cozma, V. Prevalence of Giardia species in stool samples by ELISA in household cats from Romania and risk factors. J. Feline Med. Surg. 2011, 13, 479–482. [Google Scholar] [CrossRef]
  23. Jaros, D.; Zygner, W.; Jaros, S.; Wędrychowicz, H. Detection of Giardia intestinalis Assemblages A, B and D in Domestic Cats from Warsaw, Poland. Pol. J. Microbiol. 2011, 60, 259–263. [Google Scholar] [CrossRef] [PubMed]
  24. Vasilopulos, R.J.; Rickard, L.G.; Mackin, A.J.; Pharr, G.T.; Huston, C.L. Genotypic Analysis of Giardia duodenalis in Domestic Cats. J. Vet. Intern. Med. 2007, 21, 352–355. [Google Scholar] [CrossRef] [PubMed]
  25. De Santis-Kerr, A.C.; Raghavan, M.; Glickman, N.W.; Caldanaro, R.J.; Moore, G.E.; Lewis, H.B.; Schantz, P.M.; Glickman, L.T. Prevalence and risk factors for Giardia and coccidia species of pet cats in 2003–2004. J. Feline Med. Surg. 2006, 8, 292–301. [Google Scholar] [CrossRef]
  26. Itoh, N.; Muraoka, N.; Saeki, H.; Aoki, M.; Itagaki, T. Prevalence of Giardia intestinalis Infection in Dogs of Breeding Kennels in Japan. J. Vet. Med. Sci. 2005, 67, 717–718. [Google Scholar] [CrossRef] [PubMed]
  27. Santín, M.; Trout, J.M.; Vecino, J.A.C.; Dubey, J.; Fayer, R. Cryptosporidium, Giardia and Enterocytozoon bieneusi in cats from Bogota (Colombia) and genotyping of isolates. Vet. Parasitol. 2006, 141, 334–339. [Google Scholar] [CrossRef]
  28. López-Arias, Á.; Villar, D.; López-Osorio, S.; Calle-Vélez, D.; Chaparro-Gutiérrez, J.J. Giardia is the most prevalent parasitic infection in dogs and cats with diarrhea in the city of Medellín, Colombia. Vet. Parasitol. Reg. Stud. Rep. 2019, 18, 100335. [Google Scholar] [CrossRef]
  29. Souza, S.L.; Gennari, S.M.; Richtzenhain, L.J.; Pena, H.F.; Funada, M.R.; Cortez, A.; Gregori, F.; Soares, R.M. Molecular identification of Giardia duodenalis isolates from humans, dogs, cats and cattle from the state of São Paulo, Brazil, by sequence analysis of fragments of glutamate dehydrogenase (gdh) coding gene. Vet. Parasitol. 2007, 149, 258–264. [Google Scholar] [CrossRef]
  30. López, J.; Abarca, K.; Paredes, P.; Inzunza, E. Parásitos intestinales en caninos y felinos con cuadros digestivos en Santiago, Chile: Consideraciones en Salud Pública. Revista Médica Chile 2006, 134, 193–200. [Google Scholar] [CrossRef]
  31. Scorza, A.V.; Duncan, C.; Miles, L.; Lappin, M.R. Prevalence of selected zoonotic and vector-borne agents in dogs and cats in Costa Rica. Vet. Parasitol. 2011, 183, 178–183. [Google Scholar] [CrossRef]
  32. Thompson, R.A.; Palmer, C.S.; O’Handley, R. The public health and clinical significance of Giardia and Cryptosporidium in domestic animals. Vet. J. 2008, 177, 18–25. [Google Scholar] [CrossRef] [PubMed]
  33. Gerhold, R.W.; Jessup, D.A. Zoonotic Diseases Associated with Free-Roaming Cats. Zoonoses Public Health 2012, 60, 189–195. [Google Scholar] [CrossRef] [PubMed]
  34. Abe, N.; Kimata, I.; Tokoro, M. Genotyping of Giardia isolates from humans in Japan using the small subunit ribosomal RNA and glutamate dehydrogenase gene sequences. Jpn. J. Infect. Dis. 2005, 58, 57–58. [Google Scholar]
  35. Eligio-García, L.; Cortes-Campos, A.; Jiménez-Cardoso, E. Genotype of Giardia intestinalis isolates from children and dogs and its relationship to host origin. Parasitol. Res. 2005, 97, 1–6. [Google Scholar] [CrossRef]
  36. Monis, P.; Caccio, S.M.; Thompson, R.A. Variation in Giardia: Towards a taxonomic revision of the genus. Trends Parasitol. 2009, 25, 93–100. [Google Scholar] [CrossRef] [PubMed]
  37. Otero-Negrete, J.J.; Martínez-Godillo, M.N.; Ibarra-Velarde, F.; Ponce-Macotela, M. Prevalence of Giardia Intestinalis and Zo-onotic Genotype Predominance in Small Scale Sheep and Cattle Farms in Five States of Mexican Republic. Veterinaria Mexico 2011, 42, 219–226. [Google Scholar]
  38. Godínez-Galaz, E.M.; Veyna-Salazar, N.P.; Olvera-Ramírez, A.M.; Milián-Suazo, F.; Perea-Razo, C.A.; Bernal-Reynaga, R.; Cantó-Alarcón, G.J. Prevalence and Zoonotic Potential of Giardia intestinalis in Dogs of the Central Region of Mexico. Animals 2019, 9, 325. [Google Scholar] [CrossRef]
  39. Dryden, M.W.; Payne, P.A.; Smith, V. Accurate diagnosis of Giardia spp and proper fecal examination procedures. Vet Ther. 2006, 7, 4–14. [Google Scholar]
  40. Minvielle, M.C.; Molina, N.B.; Polverino, D.; Basualdo, J. First genotyping of Giardia lamblia from human and animal feces in Argentina, South America. Mem. Inst. Oswaldo Cruz 2008, 103, 98–103. [Google Scholar] [CrossRef]
  41. Ghosh, S.; Debnath, A.; Sil, A.; De, S.; Chattopadhyay, D.; Das, P. PCR detection of Giardia lamblia in stool: Targeting intergenic spacer region of multicopy rRNA gene. Mol. Cell. Probes 2000, 14, 181–189. [Google Scholar] [CrossRef]
  42. Babaei, Z.; Oormazdi, H.; Rezaie, S.; Rezaeian, M.; Razmjou, E. Giardia intestinalis: DNA extraction approaches to improve PCR results. Exp. Parasitol. 2011, 128, 159–162. [Google Scholar] [CrossRef]
  43. de Almeida, I.N.; Carvalho, W.D.S.; Rossetti, M.L.; Costa, E.R.D.; de Miranda, S.S. Evaluation of six different DNA extraction methods for detection of Mycobacterium tuberculosis by means of PCR-IS6110: Preliminary study. BMC Res. Notes 2013, 6, 561. [Google Scholar] [CrossRef] [PubMed]
  44. Cacciò, S.M.; De Giacomo, M.; Pozio, E. Sequence analysis of the β-giardin gene and development of a polymerase chain reaction–restriction fragment length polymorphism assay to genotype Giardiaduodenalis cysts from human faecal samples. Int. J. Parasitol. 2002, 32, 1023–1030. [Google Scholar] [CrossRef]
  45. Nikolic, A.; Dimitrijevic, S.; Djurkovic-Djarkovic, O.; Bobic, B.; Maksimovic-Mihajlovic, O. Giardiasis in Dogs and Cats in the Belgrade Area. Acta Vet. Brno. 2002, 52, 43–48. [Google Scholar]
  46. Bouzid, M.; Halai, K.; Jeffreys, D.; Hunter, P.R. The prevalence of Giardia infection in dogs and cats, a systematic review and meta-analysis of prevalence studies from stool samples. Vet. Parasitol. 2015, 207, 181–202. [Google Scholar] [CrossRef] [PubMed]
  47. Dall´agnol, L.P.; Otto, M.A.; da Silva, A.S.; Gonzalez Monteiro, S. Gastrointestinal Parasites in Naturally Infected Cats in the Municipality of Santa Maria in Rio Grande Do Sul, Brazil. Vet. Bras. 2010, 4, 181–184. [Google Scholar]
  48. Fernandes de Mendoça, F.; Pitella, A.; Emmerick, S.; Pereira, N. Assesment of the diagnostic performances of four methods for detection of Giardia duodenalis in fecal samplesfrom human, canineand feline carriers. J. Microbiol. Methods 2018, 145, 73–78. [Google Scholar] [CrossRef]
  49. Decock, C.; Cadiergues, M.C.; Larcher, M.; Vermot, S.; Franc, M. Comparison of two techniques for diagnosis of giardiasis in dogs. Parasite 2003, 10, 69–72. [Google Scholar] [CrossRef]
  50. Chalkowski, K.; Wilson, A.E.; Lepczyk, C.A.; Zohdy, S. Who let the cats out? A global meta-analysis on risk of parasitic infection in indoor versus outdoor domestic cats (Felis catus). Biol. Lett. 2019, 15, 20180840. [Google Scholar] [CrossRef]
  51. Singer, S.M.; Nash, T.E. The Role of Normal Flora in Giardia lamblia Infections in Mice. J. Infect. Dis. 2000, 181, 1510–1512. [Google Scholar] [CrossRef]
  52. Nydam, D.V.; Wade, S.E.; Schaaf, S.L.; Mohammed, H.O. Number of Cryptosporidium parvum oocysts or Giardia spp cysts shed by dairy calves after natural infection. Am. J. Vet. Res. 2001, 62, 1612–1615. [Google Scholar] [CrossRef]
  53. Mosallanejad, B.; Avizeh, R.; Jalali, M.R.; Alborzi, A. Prevalence of Giardia duodenalis Infection in Household Cats of Ahvaz District, South-West of Iran. Iran. J. Parasitol. 2010, 5, 27–34. [Google Scholar] [PubMed]
  54. Mekaru, S.R.; Marks, S.L.; Felley, A.J.; Chouicha, N.; Kass, P.H. Comparison of Direct Immunofluorescence, Immunoassays, and Fecal Flotation for Detection of Cryptosporidium spp. and Giardia spp. in Naturally Exposed Cats in 4 Northern California Animal Shelters. J. Vet. Intern. Med. 2007, 21, 959–965. [Google Scholar] [CrossRef] [PubMed]
  55. Sursal, N.; Simsek, E.; Yildiz, K. Feline Giardiasis in Turkey: Prevalence and Genetic and Haplotype Diversity of Giardia duodenalis Based on the β-Giardin Gene Sequence in Symptomatic Cats. J. Parasitol. 2020, 106, 699–706. [Google Scholar] [CrossRef] [PubMed]
  56. Pedersen, K.S.; Johansen, M.; Jorsal, S.E.; Nielsen, J.P.; Bækbo, P.; Angen, Ø. Pooling of porcine fecal samples for quantification of Lawsonia intracellularis by real-time polymerase chain reaction. J. Vet. Diagn. Investig. 2014, 26, 342–345. [Google Scholar] [CrossRef]
  57. Eysker, M.; Bakker, J.; Berg, M.V.D.; van Doorn, D.; Ploeger, H. The use of age-clustered pooled faecal samples for monitoring worm control in horses. Vet. Parasitol. 2008, 151, 249–255. [Google Scholar] [CrossRef]
  58. Papaiakovou, M.; Wright, J.; Pilotte, N.; Chooneea, D.; Schär, F.; Truscott, J.E.; Dunn, J.C.; Gardiner, I.; Walson, J.L.; Williams, S.A.; et al. Pooling as a strategy for the timely diagnosis of soil-transmitted helminths in stool: Value and reproducibility. Parasites Vectors 2019, 12, 443. [Google Scholar] [CrossRef]
  59. Singer, R.S.; Cooke, C.L.; Maddox, C.W.; Isaacson, R.E.; Wallace, R.L. Use of Pooled Samples for the Detection of Salmonella in Feces by Polymerase Chain Reaction. J. Vet. Diagn. Investig. 2006, 18, 319–325. [Google Scholar] [CrossRef]
  60. Clasen, J.; Mellerup, A.; Olsen, J.E.; Angen, Ø.; Folkesson, A.; Halasa, T.; Toft, N.; Birkegård, A.C. Determining the optimal number of individual samples to pool for quantification of average herd levels of antimicrobial resistance genes in Danish pig herds using high-throughput qPCR. Vet. Microbiol. 2016, 189, 46–51. [Google Scholar] [CrossRef]
  61. Covacin, C.; Aucoin, D.; Elliot, A.; Thompson, R. Genotypic characterisation of Giardia from domestic dogs in the USA. Vet. Parasitol. 2011, 177, 28–32. [Google Scholar] [CrossRef]
  62. Torres-Romero, J.; Euan-Canto, A.D.J.; Benito-González, N.; Padilla-Montaño, N.; Huchin-Chan, C.; Lara-Riegos, J.; Cedillo-Rivera, R. Intestinal parasites and genotyping of Giardia duodenalis in children: First report of genotype B in isolates from human clinical samples in Mexico. Mem. Inst. Oswaldo Cruz 2014, 109, 388–390. [Google Scholar] [CrossRef] [PubMed]
  63. Procesi, I.G.; Carnio, A.; Berrilli, F.; Di Filippo, M.M.; Scarito, A.; Amoruso, C.; Barni, M.; Ruffini, M.; Barlozzari, G.; Scarpulla, M.; et al. Giardia duodenalis in colony stray cats from Italy. Zoonoses Public Health 2021, 69, 46–54. [Google Scholar] [CrossRef] [PubMed]
  64. Zanzani, S.; Gazzonis, A.L.; Scarpa, P.; Berrilli, F.; Manfredi, M.T. Intestinal Parasites of Owned Dogs and Cats from Metropolitan and Micropolitan Areas: Prevalence, Zoonotic Risks, and Pet Owner Awareness in Northern Italy. BioMed. Res. Int. 2014, 2014, 696508. [Google Scholar] [CrossRef] [PubMed]
  65. Papini, R.; Cardini, G.; Paoletti, B.; Giangaspero, A. Detection of Giardia assemblage A in cats in Florence, Italy. Parasitol. Res. 2006, 100, 653–656. [Google Scholar] [CrossRef]
  66. Palmer, C.S.; Traub, R.; Robertson, I.; Devlin, G.; Rees, R.; Thompson, R.A. Determining the zoonotic significance of Giardia and Cryptosporidium in Australian dogs and cats. Vet. Parasitol. 2008, 154, 142–147. [Google Scholar] [CrossRef] [PubMed]
  67. Li, J.; Dan, X.; Zhu, K.; Li, N.; Guo, Y.; Zheng, Z.; Feng, Y.; Xiao, L. Genetic characterization of Cryptosporidium spp. and Giardia duodenalis in dogs and cats in Guangdong, China. Parasites Vectors 2019, 12, 571. [Google Scholar] [CrossRef]
  68. Suzuki, J.; Murata, R.; Kobayashi, S.; Sadamasu, K.; Kai, A.; Takeuchi, T. Risk of human infection with Giardia duodenalis from cats in Japan and genotyping of the isolates to assess the route of infection in cats. Parasitology 2010, 138, 493–500. [Google Scholar] [CrossRef]
  69. Sahagún, J.; Clavel, A.; Goñi, P.; Seral, C.; Llorente, M.T.; Castillo, F.J.; Capilla, S.; Arias, A.; Gómez-Lus, R. Correlation between the presence of symptoms and the Giardia duodenalis genotype. Eur. J. Clin. Microbiol. Infect. Dis. 2007, 27, 81–83. [Google Scholar] [CrossRef]
  70. Ballweber, L.R.; Xiao, L.; Bowman, D.D.; Kahn, G.; Cama, V.A. Giardiasis in dogs and cats: Update on epidemiology and public health significance. Trends Parasitol. 2010, 26, 180–189. [Google Scholar] [CrossRef]
  71. Read, C.M.; Monis, P.T.; Thompson, R.A. Discrimination of all genotypes of Giardia duodenalis at the glutamate dehydrogenase locus using PCR-RFLP. Infect. Genet. Evol. 2004, 4, 125–130. [Google Scholar] [CrossRef]
  72. van Keulen, H.; Macechko, P.; Wade, S.; Schaaf, S.; Wallis, P.M.; Erlandsen, S.L. Presence of human Giardia in domestic, farm and wild animals, and environmental samples suggests a zoonotic potential for giardiasis. Vet. Parasitol. 2002, 108, 97–107. [Google Scholar] [CrossRef] [PubMed]
  73. Instituto Nacional de Estadística, Geografía e informática. Primera Encuesta Nacional de Bienestar Autorreportado; INEGI: Aguascalientes, Mexico, 2021.
Figure 1. Amplicons of 384 bp in size from the second PCR reaction (G. duodenalis). Lane 1 corresponds to control; lanes 2–8 correspond to the pools analyzed; lane 9 corresponds to the negative control.
Figure 1. Amplicons of 384 bp in size from the second PCR reaction (G. duodenalis). Lane 1 corresponds to control; lanes 2–8 correspond to the pools analyzed; lane 9 corresponds to the negative control.
Animals 13 01098 g001
Figure 2. RFLP analysis of a 384 bp fragment of the β-giardin gene (G. duodenalis). Lanes 2, 5, and 6 correspond to the AI assemblage (190, 100 and 70 bp) and lanes 1, 3, 4, and 7 correspond to the AII assemblage (210 and 70 bp).
Figure 2. RFLP analysis of a 384 bp fragment of the β-giardin gene (G. duodenalis). Lanes 2, 5, and 6 correspond to the AI assemblage (190, 100 and 70 bp) and lanes 1, 3, 4, and 7 correspond to the AII assemblage (210 and 70 bp).
Animals 13 01098 g002
Table 1. Occurrence, origin, age, and assemblages of Giardia duodenalis in cats.
Table 1. Occurrence, origin, age, and assemblages of Giardia duodenalis in cats.
LocationAge and OriginTotalOccurrence (%)AssemblageReference
GermanyOwned, stray, Shelter
(Adults and kittens)
14517.9%D2018 [20]
ItalyOwned, Stray (Kittens, Adults)1816.1% A, F2011 [21]
RomaniaOwned (Kittens, Adults)18128%Not reported2011 [22]
PolandOwned (No age)1603.75%A, B, D2011 [23]
USAOwned (No age)25013%AI, AII, F2007 [24]
USAOwned (Kittens, Adults)211,1050.58%Not reported2006 [25]
JapanKennels, Owned (Kittens, Adults)60040%Not reported2005 [26]
ColombiaStray (Kittens, Adults)466.5%F2006 [27]
ColombiaOwned (Kittens, Adults)20320%Not reported2019 [28]
BrazilOwned, shelters (No age)19Not reportedAI, F2007 [29]
Chile Owned (No age)23019%Not reported2006 [30]
Costa RicaOwned (No age)957.1%Not reported2011 [31]
Table 2. Distribution of samples and statistical association analysis by stratum, age, stool consistency, and gender.
Table 2. Distribution of samples and statistical association analysis by stratum, age, stool consistency, and gender.
PositiveNegativeOccurrence (%)p ValueOdds Ratio95% CI
Total5015025%
Strata of origin
 Owned2974280.288271.410.731–2.7
 Unowned217621
Age
 <6 Months244833%0.0412271.961.02–3.76
 >6 Months2610220%
Stool consistency
 Pasty273444%0.0000314.002.03–7.8
 Firm2311616%
Sex
 Male226924%0.8057230.920.48–1.75
 Female288125%
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Veyna-Salazar, N.P.; Cantó-Alarcón, G.J.; Olvera-Ramírez, A.M.; Ruiz-López, F.J.; Bernal-Reynaga, R.; Bárcenas-Reyes, I.; Durán-Aguilar, M. Occurrence of Giardia duodenalis in Cats from Queretaro and the Risk to Public Health. Animals 2023, 13, 1098. https://doi.org/10.3390/ani13061098

AMA Style

Veyna-Salazar NP, Cantó-Alarcón GJ, Olvera-Ramírez AM, Ruiz-López FJ, Bernal-Reynaga R, Bárcenas-Reyes I, Durán-Aguilar M. Occurrence of Giardia duodenalis in Cats from Queretaro and the Risk to Public Health. Animals. 2023; 13(6):1098. https://doi.org/10.3390/ani13061098

Chicago/Turabian Style

Veyna-Salazar, Nerina P., Germinal J. Cantó-Alarcón, Andrea M. Olvera-Ramírez, Felipe J. Ruiz-López, Rodolfo Bernal-Reynaga, Isabel Bárcenas-Reyes, and Marina Durán-Aguilar. 2023. "Occurrence of Giardia duodenalis in Cats from Queretaro and the Risk to Public Health" Animals 13, no. 6: 1098. https://doi.org/10.3390/ani13061098

APA Style

Veyna-Salazar, N. P., Cantó-Alarcón, G. J., Olvera-Ramírez, A. M., Ruiz-López, F. J., Bernal-Reynaga, R., Bárcenas-Reyes, I., & Durán-Aguilar, M. (2023). Occurrence of Giardia duodenalis in Cats from Queretaro and the Risk to Public Health. Animals, 13(6), 1098. https://doi.org/10.3390/ani13061098

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop