Next Article in Journal
Insights into Early Ontogenesis of Salmo salar: RNA Extraction, Housekeeping Gene Validation and Transcriptional Expression of Important Primordial Germ Cell and Sex-Determination Genes
Next Article in Special Issue
Supplementation with Antimicrobial Peptides or a Tannic Acid Can Effectively Replace the Pharmacological Effects of Zinc Oxide in the Early Stages of Weaning Piglets
Previous Article in Journal
Laparoscopic Salpingectomy and Vasectomy to Inhibit Fertility in Free-Ranging Nutrias (Myocastor coypus)
Previous Article in Special Issue
Effect of High Efficiency Digestion and Utilization of Organic Iron Made by Saccharomyces cerevisiae on Antioxidation and Caecum Microflora in Weaned Piglets
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 13
Issue 6
10.3390/ani13061093
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Different Combinations of Sodium Butyrate, Medium-Chain Fatty Acids and Omega-3 Polyunsaturated Fatty Acids on the Reproductive Performance of Sows and Biochemical Parameters, Oxidative Status and Intestinal Health of Their Offspring

by
Caiyun You
†,
Qingqing Xu
†,
Jinchao Chen
†,
Yetong Xu
,
Jiaman Pang
,
Xie Peng
,
Zhiru Tang
,
Weizhong Sun
and
Zhihong Sun
*
Key Laboratory for Bio-Feed and Animal Nutrition, Southwest University, Chongqing 400715, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Animals 2023, 13(6), 1093; https://doi.org/10.3390/ani13061093
Submission received: 3 January 2023 / Revised: 6 March 2023 / Accepted: 17 March 2023 / Published: 19 March 2023
(This article belongs to the Special Issue Second Edition of Feed Additives in Nonruminant Nutrition, Metabolism, and Gut Microorganisms)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

Dietary supplementation with fatty acids benefits the high productivity of sows and plays an essential role in piglet growth. Considering that the mechanisms of the fatty acid types on animal physiology differ, combined supplementation may have additive effects. Therefore, we investigated the effects of different combinations of fatty acids with different chain lengths on the reproductive performances of sows and on the antioxidant capacity, immune function, and intestinal health of their offspring. Taken together, the dietary supplementation of sows with different combinations of SB, MCFAs, and omega-3 PUFAs to the sows during late gestation and lactation can efficiently improve the growth performance, immune function, antioxidant capability, and intestinal microbiota and decrease the incidence of diarrhea in the suckling piglets. Additionally, dietary SMP supplementation has better effects on piglet intestinal health and is likely through gut microorganism alterations.

Abstract

The aim of the study was to investigate the comparative effects of different combinations of sodium butyrate (SB), medium-chain fatty acids (MCFAs), and omega-3 polyunsaturated fatty acids (n-3 PUFAs) on the reproductive performances of sows, as well as on the biochemical parameters, oxidative statuses, and intestinal health of the sucking piglets. A total of 30 sows were randomly allocated to five treatments: (1) control diet (CON); (2) CON with 1 g/kg of coated SB and 7.75 g/kg of coated MCFAs (SM); (3) CON with 1 g/kg of coated SB and 68.2 g/kg of coated n-3 PUFAs (SP); (4) CON with 7.75 g/kg of coated MCFAs and 68.2 g/kg of coated n-3 PUFAs (MP); (5) CON with 1 g/kg of coated SB, 7.75 g/kg of coated MCFAs and 68.2 g/kg of coated n-3 PUFA (SMP). The results showed that sows fed the SP, MP, and SMP diets had shorter weaning-to-estrus intervals than those fed the CON diet (p < 0.01). The piglets in the SM, SP, and MP groups showed higher increases in the plasma catalase and glutathione peroxidase activities than those of the CON group (p < 0.01). The diarrhea incidence of piglets in the SM, SP and SMP groups was lower than that of piglets in the CON group (p < 0.01). Additionally, the addition of SM, SP, MP, and SMP to the sow diets increased the contents of immunoglobulin A, immunoglobulin G, fat, and proteins in the colostrum (p < 0.01), as well as the plasma total superoxide dismutase activities (p < 0.01) in the suckling piglets, whereas it decreased the mRNA expressions of tumor necrosis factor-α, interleukin-1β, and toll-like receptor 4 in the jejunum mucosa of the piglets. The relative abundances of Prevotella, Coprococcus, and Blautia in the colonic digesta of the piglets were increased in the SM group (p < 0.05), and the relative abundances of Faecalibacterium increased in the SMP group (p < 0.05), compared with the CON group. The relative abundances of Collinsella, Blautia, and Bulleidia in the MP group were higher than those in the CON group (p < 0.05). Collectively, dietary combinations of fatty acids with different chain lengths have positive effects on the growth performances and intestinal health of suckling piglets.

1. Introduction

The reproductive performances of high-yielding sows and the growth performances of piglets are the two most important aspects that influence the economic efficiency of the modern pig breeding industry. With the development of breeding techniques, the reproductive performances of sows have been improved. However, highly prolific sows often suffer from a range of issues, including insufficient nutrient intake, excessive weight loss, longer weaning-to-estrus intervals (WEI), shortened service lives, and metabolic disorders, which result in the retarded growth of their piglets [1,2,3,4]. Additionally, in late pregnancy, the fetal growth rate dramatically accelerates [5]. Diets that contain supplemental fatty acids have been particularly effective at improving the body conditions of sows and the birth weights and growth of suckling piglets [6,7,8]. Therefore, meeting the nutrient requirements of prolific sows is a vital consideration for the development of pig farming.
Fatty acids have biological functions, such as the regulation of metabolic disorders, the intestinal barrier, and the immune function of animals [7,9,10]. Fatty acids are categorized according to the length of the carbon chain and the degree of saturation. Short-chain fatty acids (SCFAs), and especially butyrate (SB), which is a major source of energy for colonic epithelial cells [9], can improve the immune function of piglets through the nuclear factor-kappa B (NF-κB) signal pathway [11,12]. In addition, appropriate doses of butyrate can alleviate diarrhea symptoms and reduce the intestinal permeability to maintain intestinal health [13]. The majority of MCFAs are carried straight to the liver via the portal vein, granting a rapid energy supply, which is vital for piglets [7]. In addition, MCFAs decrease intestinal colonization by opportunistic pathogens and modulate the colonic microbiota of piglets [14,15]. n-3 PUFAs are essential for embryonic and fetal development [16]. In addition, n-3 PUFAs also play an important role in shortening the weaning-to-estrus interval (WEI) and enhancing the immune function in sows [16,17,18]. Previous studies have shown that dietary single fatty acid supplementation could shorten the WEIs of sows and improve the intestinal health and growth performances of suckling piglets [19,20]. However, studies on the effects of dietary combinations of SB, MCFAs, and n-3 PUFA on prolific sows during late gestation and lactation are still lacking. Therefore, the purpose of this study was to investigate the effects of different combinations of SB, MCFAs, and n-3 PUFAs on the reproductive performances of sows and on the biochemical parameters, oxidative status, and intestinal health of their offspring during late gestation and lactation. We speculated that the combination of fatty acids would have additive effects on the reproductive performances of the sows and the growth performances of their offspring.

2. Materials and Methods

All animal operations were carried out in compliance with protocols approved by the Animal Ethics Committee of Southwestern University (Chongqing, China). The behavior and health of the experimental animals were continuously monitored during the trial period, and no negative impacts were observed. More precisely, there were no clinical problems that could have necessitated pharmaceutical treatment for pathologies after the investigation began, and all the animals were deemed suitable for the study. The experimental animals were disposed of safely following the Experimental Animal Handling Procedure of Southwest University (Ethics Approval Code: IACUC-20210120-03).

2.1. Animals, Materials, and Feeding Management

A total of 30 third-parity sows (Landrace × Large White hybrid; 200 ± 15 kg) were used in this study. From mating to d 109 of gestation, the sows were kept in individual stainless-steel cages (0.60 × 2.15 m) in the gestation house, and on approximately d 110 of gestation, they were transferred to the farrowing stalls (1.20 × 2.15 m) in a thoroughly sterilized farrowing house with iron fencing and plastic flooring. The SB, MCFAs, and omega-3 PUFAs in this study were supplied by Xingao Agribusiness Development Co., Ltd. (Xiamen, Fujian, China), with purities of 98%, 70%, and 20%, respectively. The primary active constituents of the n-3 PUFAs were docosahexaenoic acid (DHA), α-linolenic acid (ALA), and eicosapentaenoic acid (EPA). Additionally, the sows were fed twice a day at 08:00 and 16:00, with 2.5–3.0 kg of feed per day, which was restricted in late gestation based on the body condition, while 2 kg was fed on d 1–2 of lactation, with an increase of 0.5 kg per day from d 3 to d 7 of lactation, and an increase of 0.8 kg per day from d 8 to d 14 of lactation, with no further increase thereafter. All sows were allowed to consume water at any time during the study. Heaters and exhaust fans kept the room at a comfortable temperature (from 20 to 25 °C).

2.2. Diets and Experimental Design

The sows were randomly allocated to five treatments (six replicate pens per treatment and one sow per replicate) in a completely randomized experimental design. The sows were fed a basal diet (control, CON), a basal diet supplemented with 1 g/kg of coated SB and 7.75 g/kg of coated MCFAs (SM), a basal diet supplemented with 1 g/kg of coated SB and 68.2 g/kg of coated n-3 PUFAs (SP), a basal diet supplemented with 7.75 g/kg of coated MCFAs and 68.2 g/kg of coated n-3 PUFAs (MP), and a basal diet supplemented with 1 g/kg of coated SB, 7.75 g/kg of coated MCFAs, and 68.2 g/kg of coated n-3 PUFAs (SMP). The dosages were chosen based on the company’s recommended dosages. The piglets were housed in farrowing stalls, with one litter per pen. After the piglets were born, they were manually attached to the nipples to guarantee that they received breast milk for growth and development. This study shared the control group with Chen et al. [20], and the sows in this trial and Chen’s sows were kept in the same barn. The trial started on d 85 of gestation and ended with the weaning of the piglets (d 21 of lactation). From d 85 to d 110 of gestation, the test sows were fed given the gestation diet, followed by the lactation diet from d 110 of gestation and throughout weaning. The nutritional content of the baseline diet met or surpassed the nutritional recommendations of the National Research Council (2012) [21]. The dietary ingredients and nutritional levels for the sows throughout gestation and lactation are shown in Table 1. The gestation diet (approximately 100 g) and lactation diet (approximately 100 g) were collected. Then, the feed samples were analyzed for the crude protein (CP), crude ash (Ash), dry matter (DM), ether extract (EE), calcium (Ca), crude fiber (CF), available phosphorus (AP), and total phosphorus (Total P), according to the procedures followed by the standard of the AOAC (2000) [22].

2.3. Recording and Sample Collection

2.3.1. Reproductive Performances of Sows

During the animal experiment, the feed wastage was recorded every day after the meal to calculate the average daily feed intake (ADFI). The individual neonatal weight of the born alive was weighed within 12 h of delivery. The stillborn and mummified fetuses were not weighed, and the mummified fetuses were counted as stillbirths (piglets that died before birth). We measured the numbers of born alive, stillborn, mummified fetuses, and total born, the litter weights, birth weights, and the weaning weights of the piglets, and the WEIs of the sows. The total litter size included mummified fetuses, born alive, and stillborn. The born-alive rate was calculated as the number of born alive/total born × 100%.

2.3.2. Growth Performances of Piglets and Diarrhea Incidence

Piglets were cross-fostered after altering the litter sizes of the sows within the same treatment within 24 h of farrowing. Piglets were weaned on d 21 of lactation, the number of weaned piglets was counted, and the piglets were weighed to determine the ADGs and weaning survival rates. The diarrhea severity was determined by daily observation of the piglet feces, as previously described [23,24]. The formula for calculating the diarrhea incidence was as follows: the diarrhea rate (%) = Σ[(diarrhea days in piglets × number of diarrhea piglets)]/(total number of piglets × 21) × 100%.

2.3.3. Sample Collection

The colostrum (about 40 mL) was manually collected after the alcohol sterilization of the sow teats within 2 h of the first piglet’s birth. For each repetition, piglets that met the average weight were randomly selected for blood and slaughter sampling. On d 22 of lactation, one piglet per pen was randomly selected for the collection of blood samples from the anterior vein. Then, the blood samples were centrifuged (4 °C, 3000× g, 15 min) and the plasma was stored at −80 °C for subsequent analysis. Next, the piglets were humanely killed after anesthesia by intravenous injection with sodium pentobarbital (50 mg/kg BW). Tissue samples from the liver and middle jejunum were taken, flushed with 0.9% saline, and deposited in a 4% formaldehyde solution for morphological examination. The colonic digesta (approximately 10 g) was collected in sterile tubes for the microbiota analysis. After that, jejunal mucosa samples were carefully scraped off using a sterile glass slide, flash-frozen in liquid nitrogen and were maintained at −80 °C for subsequent analysis.

2.4. Analytical Methods

2.4.1. Colostrum Composition Analysis

One colostrum sample (approximately 20 mL) diluted 3 times with purified water was determined in triplicate for milk fat, milk protein, lactose and solids-not-fat (SNF) using a FOSS Multifunctional Dairy Analyzer (MilkoScan TM FT120, Foss Electric A/S, Hillerød, Denmark). The other colostrum sample (approximately 20 mL) was centrifuged (4 °C, 3000× g, 20 min), and the supernatant was aspirated and kept at −80 °C. The colostrum supernatant was thawed at room temperature and utilized to determine the concentrations of immunoglobulin A (IgA), immunoglobulin G (IgG), and immunoglobulin M (IgM) using swine reagent ELISA kits provided by the Nanjing Jiancheng Bioengineering Institute (Nanjing, Jiangsu, China). The intra- and inter-assay CVs for these ELISA kits were both less than 9.0%.

2.4.2. Blood Biochemical Parameters

The total antioxidant capacity (T-AOC); (Code: A015-2-1), glutathione peroxidase (GSH-Px); (Code: A005-1-1), malondialdehyde (MDA); (Code: A003-1-2), total superoxide dismutase (T-SOD); (Code: A001-1-1) and catalase (CAT); (Code: A007-1-1) in the plasma of the pigs were analyzed by using commercial assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China). The concentrations of total protein (TP); (Code: A045-1-1) and albumin (ALB); (Code: A028-2-1) in the plasma of the pigs were determined using a por-cine-specific commercial kit with microplate test methods and an enzyme-labeled instrument (Thermo Electron Corporation; Rochester, NY, USA). The plasma concentrations of high-density lipoprotein cholesterol (HDL-C); (Code: A112-1-1), glucose (GLU); (Code: F006-1-1), total cholesterol (TC); (Code: A111-1-1), urinary nitrogen, and triglycerides (TG); (Code: A110-1-1) were determined using colorimetric method diagnostic kits. In accordance with the manufacturer guidelines, all protocols were strictly carried out, ensuring the highest level of safety and accuracy.

2.4.3. Intestinal Morphology

Jejunum tissues were collected from weaning piglets and fixed in 4% formalin for the analysis of the intestinal morphology. In short, the villus height (VH) and crypt depth (CD) of the jejunum were measured using an Axio Scope A1 microscope (Zeiss, Oberkochen, Germany) with 40× combined magnification. The VH was calculated by measuring the distance between the top of the villus and the villus-crypt junction, and the CD was calculated by measuring the distance between the villus-crypt junction and the bottom of the crypt. The averages of the measurements (at least 10 normative measurements) were used for the statistical analysis, and all intestinal mucosal morphometric analyses were executed by the same operator.

2.4.4. Quantitative Real-Time PCR

The relative expressions of the genes related to the factors involved in the regulation of inflammation in the jejunal mucosa of the piglets were determined. Total RNA was isolated from frozen jejunal mucosa samples by using SteadyPure Uni-versal RNA Extraction Kits II (Code: AG21022; Accurate Biotechnology (Hunan) Co., Ltd., Changsha, China). The specific RNA extraction procedure was performed using the manufacturer’s recommendations. The concentration of total RNA was measured with a NanoDrop-ND2000 spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA), and the reverse transcription was performed with the qualified RNA samples using AMV First Strand cDNA Synthesis Kits provided by Sangon (Shanghai, China), according to the manufacturer’s instructions.
Real-time PCR analysis was performed to quantify the claudin-1 (CLDN 1), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), occludin (OCLN), interleukin-1β (IL-1β), zonula occludens-1 (ZO-1), interleukin-10 (IL-10), toll-like receptor 4 (TLR-4), NF-κB, myeloid differentiation factor 88 (MγD88), and glyceraldehyde-3-phosphate (GAPDH) mRNA levels in the jejunal mucosa. The primer sequences for all the target genes and predicted product sizes are shown in Table 2. The real-time PCR analysis was conducted using the SYBR Green approach combined with an ABI 7900 Sequence Detection System. The following thermal cycling parameters were used: initial denaturation at 94 °C for 30 s, followed by 40 cycles at 94 °C for 5 s, annealing temperature for 20 s, and extension at 72 °C for 20 s. Moreover, the melting curve analysis was used to ensure that the PCR products remained specific and pure. A standard curve was generated using LightCycler software and the amplification of serially diluted cDNA, and the quantification of the target gene expression was calculated using the 2−ΔΔCT method based on the standard curve with the GAPDH gene as the reference gene [25].

2.4.5. 16S rRNA Gene Sequencing and Microbiota Analysis

Total DNA from the digesta of the colon was extracted using Power Fecal DNA Isolation Kits (Mobio, Carlsbad, CA, USA) following the manufacturer’s instructions. Briefly, the 16S rDNA gene was presented in the genome of all bacteria and was highly conserved. Microbial profiling was performed on an Illumina HiSeq2500 platform (Novogene, Beijing, China) by the PCR amplification of a segment of a highly variable region sequence (V3 region) following 600 amplification cycles. Then, the raw data sequences for the 16S rRNA gene were collected and filtered with the software tools FLASH and QIIME. UPARSE was used to assess the valid sequences and establish the practical classification units (OTUs). Moreover, singletons and OTUs below 0.005% were eliminated. Subsequently, the species-level classification was determined by the taxonomic alignment of high-quality sequences with the National Center for Biotechnology Information (NCBI) nucleotide database (ver. 2.20) at a 90% confidence threshold. The alpha diversity index (Shannon, ACE, Chao1, and Simpson) and β-diversity (Bray Curtis) analyses were calculated with the QIIME software tool.

2.5. Statistical Analysis

According to the post hoc power analysis for the ADFI of the sows, ADGs of the piglets, and IgA in the colostrum and plasma in this study, the calculated statistical power was > 0.90; thus, 6 pigs per treatment were enough to provide sufficient statistical power (α < 0.05; β = 0.80). All data analyses were performed using ANOVA analysis, with the dietary treatments used as the fixed factor. Diarrhea rate data assessments were translated using the arcsine square root transformation for subsequent statistics. Data were subjected to Duncan’s test method using SPSS 19.0 software (SPSS Inc., Chicago, IL, USA), and they are presented as means and standard errors of means (SEMs) unless otherwise noted. The histograms were created using GraphPad Prism 8. (GraphPad Prism Inc., San Diego, CA, USA). Statistical significance was identified when p < 0.05, and trends were considered when 0.05 < p ≤ 0.10.

3. Results

3.1. Reproductive Performances of Sows

As shown in Table 3, there were no significant changes in the number of born alive, stillborn and total born among the dietary treatments (p > 0.05). Compared with the CON group, the ADFI of the sows was significantly increased in the SM and SMP groups (p < 0.01). Moreover, the sows fed the SP, MP, and SMP diets showed significantly shorter WEIs compared with those fed the CON diet (p < 0.01).

3.2. Growth Performances of Piglets

As shown in Table 3, there were no differences in the survival rates of the suckling piglets among the dietary treatments (p > 0.05). The final BWs of the piglets in the SMP group were significantly higher than those of the piglets in the CON, SM, and MP groups (p < 0.01). The ADGs of the piglets in the SMP group were higher than those of the suckling piglets in the CON and MP groups (p < 0.01). Of note, the suckling piglets in the SMP group showed higher final BWs and ADGs than the other groups. Moreover, the diarrhea incidence of the suckling piglets in the CON group was higher than those of the piglets in the SM, SP, and SMP groups (p < 0.01).

3.3. Colostrum Composition of Sows

As shown in Table 4, compared with the sows fed the control diet, the dietary addition of SM, SP, MP, and SMP increased the concentrations of fat and protein in the colostrum (p < 0.01). The SNF concentrations in the colostrum of the sows in the SM and MP groups were higher than those of the sows in the CON, SP, and SMP groups (p < 0.01). In addition, the concentrations of IgA, IgG, and IgM in the colostrum of the SM, SP, and SMP groups were higher than those of the sows in the CON group (p < 0.01).

3.4. Plasma Biochemical Index of Suckling Piglets

As shown in Table 5, the plasma TP, FFA, and HDL contents of the suckling piglets were significantly increased in the SM, SP, MP, and SMP groups compared with those of the piglets in the CON group (p < 0.01). In addition, the TG and TC contents were decreased in the plasma of the suckling piglets in the SM, MP, and SMP groups (p < 0.01) compared with those in the plasma of the piglets in the CON group. For the immunoglobulin levels, the piglets in the SM group showed higher IgA concentrations in their plasma than the other groups (p < 0.001). Compared with the CON group, the SM, SP, MP, and SMP groups showed significantly increased IgG concentrations in the plasma of the piglets (p < 0.01).

3.5. Plasma Antioxidant Capacity of Suckling Piglets

As shown in Table 6, the piglets in the SM, SP, MP, and SMP groups showed significantly increased plasma T-SOD and T-AOC activities in comparison with those in the CON group (p < 0.01). The piglets in the SM, SP, and MP groups had higher plasma CAT and GSH-Px activities than those in the CON group (p < 0.01), and the piglets in the MP group had the highest plasma GSH-Px activity among the five groups. However, the content of plasma MDA was higher in the MP group than in the CON group (p < 0.01), with no significant difference in the SM, SP, and SMP groups (p > 0.05).

3.6. Intestinal Morphology of Sucking Piglets

As shown in Figure 1B, there was no significant difference in the VH of the jejunum among the five groups (p > 0.05). The CD of the jejunum in the SM, SP, MP, and SMP groups was significantly lower than that of the jejunum in the CON group (p < 0.01, Figure 1C). The VH/CD ratio of the jejunum in the SM, SP, MP, and SMP groups was significantly increased compared with that of the CON group (p < 0.01, Figure 1D). Moreover, the piglets in the SMP group showed a higher VH/CD ratio in the jejunum mucosa than those in the other groups (p < 0.01).

3.7. mRNA Expressions of Intestinal Tight Junction Protein and Inflammatory Cytokines of Suckling Piglets

Compared with the CON group, the piglets in the SM, SP, MP, and SMP groups showed significantly upregulated mRNA expressions of CLDN-1 and ZO-1 in the jejunal mucosa (p < 0.01, Figure 2A), and the piglets in the SMP group had significantly upregulated mRNA expressions of OCLN (p < 0.01). There was no significant difference in the mRNA expressions of IL-6 among the five groups (p > 0.05, Figure 2B). However, the mRNA expressions of TNF-α, IL-1β, and TLR4 of the jejunum were significantly downregulated in the SM, SP, MP, and SMP groups compared with those in the CON group (p < 0.01, Figure 2B,C), and the mRNA expressions of NF-κB in the jejunal mucosa were downregulated in the SM, SP, and SMP groups compared with those in the CON group (p < 0.01, Figure 2C).

3.8. Intestinal Microbial Flora in Colonic Digesta

The microbial flora in the colonic digesta was analyzed. As shown in Figure 3, a total of 222 OTUs were shared among the five treatment groups (Figure 3A). The piglets in the CON, SM, SP, MP, and SMP groups had 167, 317, 189, 164, and 205 unique OTUs, respectively (Figure 3A). However, there was no significant difference in the α-diversity (Shannon, Chao1, ACE, and Simpson indexes) of the colonic digesta in the suckling piglets among the five groups (p > 0.05, Figure 3B). The SM, SP, and MP groups resulted in significant changes in the beta diversity of the colonic microbiota, as shown by the NMDS based on the UniFrac distances (Figure 3C). Dietary supplementation with SMP was associated with increased relative abundances of Faecalibacterium at the genus level (Figure 3F, LDA score >2). Additionally, the piglets in the MP group were associated with increased relative abundances of Collinsella, while the piglets in the SM group were associated with increased relative abundances of Catenbacterium, Coprococcus, and Bulleidia at the genus level (Figure 3F, LDA score >4).
At the phylum level, the relative abundances of Bacteroidetes were increased in the SMP group (p < 0.05, Figure 4A), while the relative abundances of Firmicute in the SM, MP, and SMP groups were significantly lower than those of the CON group (p < 0.05, Figure 3B). At the genus level, the relative abundances of Prevotella, Coprococcus, and Blautia were increased in the SM group (p < 0.05, Figure 4C,F,H), and the relative abundances of Blautia and Bulleidia in the MP group were higher than those in the CON group (p < 0.05, Figure 4F,H). Compared with the piglets in the CON group, the piglets in the SMP group had increased relative abundances of Faecalibacterium (p < 0.05, Figure 4E).

4. Discussion

The ADFI of the sows and the ADGs of the piglets were considered the principal limitation factors for the growth performances of the neonatal pigs. In the present study, the dietary addition of SMP led to the highest ADG (236 g in the SMP group vs. 186 g in the CON group) and final BWs of the piglets (6.48 kg in the SMP group vs. 5.36 kg in the CON group), which agree with Jin et al. [26], who reported that the addition of fish oil could produce positive effects in the ADGs of piglets. Gebhardt et al. [27] found similar results: MCFAs improved the growth performance of nursery piglets by increasing the ADG, ADFI, and feed conversion ratio in a linear dose-dependent manner. Conversely, in some studies, researchers found no effect on the ADGs of piglets using 0.2% or even lower fatty acid products [27,28], which indicates that the ADGs were affected by the dietary fatty acid contents. It has been documented that SB has a distinct cheese flavor, which regulates appetite and food intake [10,29]. Our results demonstrated that the dietary addition of SM and SMP significantly increased the ADFI of the sows, whereas the dietary addition of SP and MP obtained the reverse results. Hanczakowska et al. [30] found similar results: a mixture of SCFAs and MCFAs produced better results on the ADFI. Additionally, Smit et al. [31] indicate that n-3 PUFAs have a higher energy density and boost overall energy intake, which allows sows to eat less. Thus, a mixture of SB and MCFAs might have potential additive effects to mitigate the negative effect of n-3 PUFAs on the ADFI.
In addition, diarrhea is the critical factor that causes the retardation of growth performances and increased mortality of piglets [32]. Feng et al. [13] and Lerner et al. [33] indicated that SB and MCFAs have the potential to replace antibiotics to control pathogenic bacteria, while n-3 PUFAs have a positive immunomodulatory effect in the gut [34,35]. In this study, the diarrhea incidence of the suckling piglets in the SM, SP, and SMP groups was lower than that in the CON group. Similar results were reported by Chen et al. [20]. The reason might be that SB can provide conditions for the growth of beneficial intestinal bacteria to reduce diarrhea incidence [19]. Intriguingly, Li et al. [36] indicate that organic acid combined with MCFAs showed a better reduction in the diarrhea incidence and growth-promoting effects that were comparable to those of antibiotics. It is noteworthy that supplementing the diets of the sows with SMP had the obvious and unexpected effect of decreasing the diarrhea incidence of the nursing piglets, which indicates that a blend of SB, MCFAS, and n-3 PUFAs may have a synergistic effect, although the mechanism still needs further study.
The composition and intake of the colostrum are crucial factors that affect the early weight gain, immune function, and survival of neonatal pigs with limited energy reserves [37]. Previous studies have shown a positive association between the content of fat in the milk and the piglet BW, and maternal fat supplementation could improve the piglet weaning weight [38,39]. Consistently, dietary supplementation with fish oil has increased the concentrations of fat in the colostrum of sows [40]. In this study, compared with the CON diet, sows fed the addition of SM, SP, MP, and SMP diets showed increased concentrations of fat and protein in the colostrum, which is in agreement with previous studies. In addition, the immunoglobulins in the colostrum are the only source of passive immunity for neonatal piglets. The colostral IgA and IgG concentrations are major factors that influence the passive immune protection. Jin et al. [26] indicated that dietary fish oil supplementation increased the IgG and IgM concentrations in the colostrum of suckling pigs, which improved their immune function. Similarly, a diet supplemented with SB increased the concentration of IgA in the colostrum [12]. Our results indicated that the concentrations of IgA and IgG in the colostrum of the SM, SP, and SMP groups were higher than those of the sows in the CON group. Furthermore, similar results were seen in the piglet plasma, which indicated that fatty acids played a positive role in regulating the immune status and providing health benefits. Additionally, the addition of SMP to the sows’ diets increased the IgA and IgM concentrations in the colostrum compared with those of the sows fed the MP diets, with no significant changes observed for the SM, SP, or SMP additions. SB and omega-3 PUFAs exert multiple beneficial effects, including immunomodulatory effects. He et al. [12] also observed that the IgA concentrations in the colostrum increased in SB-treated gilts. A possible explanation is that the blends of SB, MCFAs, and omega-3 PUFAs fed to the sows had additive effects. Collectively, dietary supplementation with fatty acids could enhance the growth performances of piglets by improving the colostrum composition.
The plasma biochemical parameters can reflect the nutritional status of the organism, and they can be influenced by changes in internal and external factors. The contents of TP and BUN are used as an index for protein utilization and metabolism. In this study, the piglets in the fatty acid-supplemented groups showed increased contents of plasma TP, which was partially due to the increment in the plasma globulin content. Meanwhile, the addition of fatty acids with different chain lengths to the sow diets increased the contents of BUN in the piglets, which indicated increased nitrogen metabolism. Moreover, previous studies on rats and pigs have shown the beneficial effects of fatty acids on lipid metabolism [41,42]. It is well documented that the TC and TG contents reflect the synthesis and metabolism of lipids in the organism and are associated with diseases linked to dyslipidemia [43]. Allyson et al. [44] reported that HDL cholesterol has a strong transport function that delivers cholesterol from peripheral cells to the liver cells. Similarly, Yu et al. [41] showed that the addition of SCFAs to the diet promotes lipid catabolism. In this study, the piglets in the SM, MP, and SMP groups showed increased HDL-cholesterol levels and lower TG and TC contents, which suggest that fatty acids might reduce cholesterol deposition in the blood.
GSH-Px, SOD, and CAT are considered to be important endogenous antioxidant enzymes that scavenge endogenous free radicals produced by the body, maintain the body’s oxidative balance, and play an important role in the oxidative and antioxidative status [45]. In this study, the piglets in the SM, SP, and MP groups exhibited increases in the activities of T-AOC CAT, GSH-Px, and T-SOD in the plasma. Famurewa et al. [46] also found that the dietary addition of coconut oil relieved oxidative stress in a dose-dependent manner by significantly increasing the antioxidant enzyme activities (SOD, CAT, and GSH-Px). Similarly, Nguyen et al. [47] reported the benefits of a diet rich in n-3 PUFAs in stimulating antioxidant enzyme activities to reduce excess ROS production. MDA is considered to be the main product of lipid oxidation, and it is a commonly used indicator of lipid peroxidation [47]. Li et al. [48] showed that the addition of MCFAs to the diet linearly reduced the plasma MDA concentration. Unexpectedly, in this study, the dietary addition of a combination of mixed MCFAs and n-3 PUFAs increased the plasma MDA levels. The discrepancies between studies might be due to the different doses of n-3 PUFAs and the lengths of time that the n-3 PUFAs were supplied. Diets rich in n-3 PUFAs may undergo peroxidation, which leads to free radical-dependent cellular damage, as evidenced by elevated plasma MDA levels [49,50]. These results indicate that the fatty acid alleviation in the oxidative stress statuses of piglets might be related to the improvement in cholesterol metabolism.
Tight junction proteins play an important role in intestinal barrier function. It has been reported that OCLN and ZO-1, which are tight junction proteins, are vital in the regulation of intestinal permeability [51]. Feng et al. [13] indicated that SB significantly increased the intestinal ZO-1 and OCLN expressions in vivo and in vitro. A prior study has demonstrated that different fatty acid treatments were beneficial to the intestinal epithelial barrier integrity and intestinal barrier function [20]. In the current study, we observed that the piglets in the SM, SP, MP, and SMP groups had significantly upregulated mRNA expressions of CLDN-1 and ZO-1 in the jejunal mucosa, which contributed to the alleviation of diarrhea in the suckling piglets. The piglets in the SMP group showed higher mRNA expressions of CLDN 1, ZO-1, and OCLN than those in the other groups, which implies that these three fatty acids may have a synergistic effect in strengthening the intestinal barrier function. In addition, the intestinal mucosa morphology is an evaluation of the nutrient digestion and absorption ability, which has a direct impact on the nutrient usage efficiency [23]. It is well-known that SB can reduce some of the negative effects of the intestinal mucosal morphology by providing the preferred energy [10]. Keyser et al. [52] indicated that MCFA supplementation restored the villus height in postweaning piglets with LPS challenges. In addition, n-3 PUFAs may repair the gut damage induced by oxidative stress and enhance the intestinal morphology in piglets [34]. These combined findings indicate that fatty acid supplementation could slightly improve intestinal development by enhancing the barrier integrity and intestinal morphology.
Fatty acids play a major role in the inflammatory response of intestinal mucosa [25,53]. Many studies indicate that n-3 PUFAs can alleviate the inflammatory status in animals [17,35]. Carlson et al. indicated that medium-chain triglycerides reduced the mRNA expressions of IL-6 and TNF-α in mice and alleviated the inflammatory response [54]. Similarly, Kuang et al. [55] demonstrated that the addition of mixing MCFAs with SCFAs to the base diet significantly reduced the mRNA expressions of TNF-α and IL-1β. In the present study, the mRNA expressions of the inflammatory factors (TLR4, IL-1β, MγD88, TNF-α, and NF-κB) in the jejunal mucosa were reduced, while the mRNA expression of the anti-inflammatory factor (IL-10) was increased. Researchers have hypothesized that fatty acids of different chain lengths likely attenuate the inflammatory response through the NF-κB and TLR4 signaling pathways [56,57]. Fatty acids inhibit inflammatory factors by regulating the MγD88-dependent route. In addition, the receptor for TLR4 upregulated the MγD88 expression, which can lead to the production and release of inflammatory factors, inducing an immune response in the intestinal mucosa [58,59,60]. Of note, the mRNA expressions of IL-1β, TLR4, and TNF-α in the SM, SP, MP, and SMP groups were lower than those of the CON group, while the mRNA expressions of IL-10 had an opposite result in the SM, SP, and SMP groups. Butyric acid may be related to an inhibitor of a histone deacetylase and result in better anti-inflammatory effects [9].
Intestinal microbes play important roles in the host health and performance, and they can profoundly impact the host nutrient metabolism, intestinal development, and immunological functions [61]. Researchers have extensively demonstrated that fatty acids can modulate the abundance and composition of intestinal microbes. Firmicutes, Bacteroidota, Proteobacteria, and Actinobacteriota predominated in the colonic contents of the suckling piglets, which is consistent with previous studies [19,62]. Researchers have reported that Bacteroidetes was able to significantly reduce the diarrhea incidence [63]. In the present study, supplementing the sow diets with SMP significantly increased the relative abundance of Bacteroidetes in the colonic digesta of the suckling piglets, which may partly explain the reduction in the diarrhea incidence. At the genus level, the high abundance of bacteria provides an opportunity to understand how microbiota metabolites affect the host physiology. Prevotella belongs to Bacteroidetes, while Faecalibacterium, Blautia, Bulleidia, and Coprococcus belong to Firmicutes, in which Prevotella and Coprococcus are mostly involved in complex polysaccharide metabolism [64]. Prevotella, Faecalibacterium, Blautia, and Coprococcus can produce high levels of SCFAs, mainly including propionate, butyrate, and acetic acid [64,65,66]. Butyric acid has been identified as a major energy source for colonic epithelial cells [67]. In this study, we found that the piglets in the SM group had higher relative abundances of Coprococcus than those in the CON group, which indicates the potential for the increased intestinal availability of butyrate. Similarly, a reduced diarrhea incidence has been proven to be one of the strategies by which Prevotella improves the intestinal immunity and promotes animal growth [68,69]. Our results indicated that the relative abundances of Prevotella in the SM group were higher than those in the other groups, which partially agrees with Li et al., who observed that the combination of SCFAs and MCFAs increased the relative abundances of Prevotella [36]. We speculated that SB, along with MCFA supplementation, might modulate the gut microbiota composition and benefit the host’s health. Moreover, it has been reported that Faecalibacterium is an anti-inflammatory intestinal commensal microbe that can suppress the TLR4/NF-κB signaling pathway in intestinal epithelial cells. Importantly, we found that the relative abundances of Faecalibacterium were particularly increased in the colonic digesta of the piglets when the sows were fed the SMP diet, and it might play an anti-inflammatory role and could promote intestinal development.

5. Conclusions

In conclusion, our results indicate that diets supplemented with different combinations of SB, MCFAs, and omega-3 PUFAs during late gestation and lactation can efficiently improve the growth performance, immune function, antioxidant capability, and intestinal microbiota, as well as decrease the incidence of diarrhea, in suckling piglets. Additionally, dietary SMP supplementation had better effects on piglet intestinal health and probably through gut microorganism alterations. In the future, attention should be focused on the dosage of fatty acid additives to sow diets during lactation, the synergistic effect of multiple fatty acids, and the mechanism of the interactions between fatty acids and intestinal microorganisms.

Author Contributions

Data curation and writing—original draft, C.Y.; methodology, Q.X. and J.C.; writing—review and editing, Y.X., J.P. and X.P.; supervision, writing—review and editing, Z.T.; project administration, W.S.; funding acquisition, writing—review and editing, Z.S. All co-authors contributed to the draft review. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by grants from the National Natural Science Foundation of China (32272889) and the National Key Research and Development Program of China (SQ2022YFD1300007).

Institutional Review Board Statement

All animal operations were carried out in compliance with protocols approved by the Animal Ethics Committee of Southwestern University (Chongqing, China) and followed national laws and National Research Council (NRC) guidelines for the care and use of laboratory animals.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

We would like to thank Xiangxin Zhang, Jiajing Sun, and Mao Li for helping with the sampling.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Holen, J.P.; Woodworth, J.C.; Tokach, M.D.; Goodband, R.D.; DeRouchey, J.M.; Gebhardt, J.T.; DeDecker, A.E.; Martinez, X. Evaluation of essential fatty acids in lactating sow diets on sow reproductive performance, colostrum and milk composition, and piglet survivability. J. Anim. Sci. 2022, 100, skac167. [Google Scholar] [CrossRef]
  2. Gatlin, L.A.; Odle, J.; Soede, J.; Hansent, J.A. Dietary medium- or long-chain triglycerides improve body condition of lean-genotype sows and increase suckling pig growth. J. Anim. Sci. 2002, 80, 38–44. [Google Scholar] [CrossRef] [Green Version]
  3. Cox, N.M.; Britt, J.H.; Armstrong, W.D.; Alhusen, H.D. Effect of feeding fat and altering weaning schedule on rebreeding in primiparous sows. J. Anim. Sci. 1983, 56, 21–29. [Google Scholar] [CrossRef] [PubMed]
  4. Ren, P.; Yang, X.J.; Kim, J.S.; Menon, D.; Baidoo, S.K. Effect of different feeding levels during three short periods of gestation on sow and litter performance over two reproductive cycles. Anim. Reprod. Sci. 2017, 177, 42–55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. McPherson, R.L.; Ji, F.; Wu, G.; Blanton, J.R.; Kim, S.W. Growth and compositional changes of fetal tissues in pigs. J. Anim. Sci. 2004, 82, 2534–2540. [Google Scholar] [CrossRef]
  6. Cromwell, G.L.; Hall, D.D.; Clawson, A.J.; Combs, G.E.; Knabe, D.A.; Maxwell, C.V.; Noland, P.R.; Orr, D.E.; Prince, T.J. Effects of additional feed during late gestation on reproductive performance of sows: A cooperative study. J. Anim. Sci. 1989, 67, 3–14. [Google Scholar] [CrossRef]
  7. Zentek, J.; Buchheit-Renko, S.; Ferrara, F.; Vahjen, W.; Van Kessel, A.G.; Pieper, R. Nutritional and physiological role of medium-chain triglycerides and medium-chain fatty acids in piglets. Anim. Health Res. Rev. 2011, 12, 83–93. [Google Scholar] [CrossRef]
  8. Rosero, D.S.; Odle, J.; Mendoza, S.M.; Boyd, R.D.; Fellner, V.; van Heugten, E. Impact of dietary lipids on sow milk composition and balance of essential fatty acids during lactation in prolific sows. J. Anim. Sci. 2015, 93, 2935–2947. [Google Scholar] [CrossRef] [PubMed]
  9. Leonel, A.J.; Alvarez-Leite, J.I. Butyrate: Implications for intestinal function. Curr. Opin. Clin. Nutr. Metab. Care 2012, 15, 474–479. [Google Scholar] [CrossRef] [PubMed]
  10. Biagi, G.; Piva, A.; Moschini, M.; Vezzali, E.; Roth, F.X. Performance, intestinal microflora, and wall morphology of weanling pigs fed sodium butyrate. J. Anim. Sci. 2007, 85, 1184–1191. [Google Scholar] [CrossRef] [Green Version]
  11. Aguilar, E.C.; Leonel, A.J.; Teixeira, L.G.; Silva, A.R.; Silva, J.F.; Pelaez, J.M.N.; Capettini, L.S.A.; Lemos, V.S.; Santos, R.A.S.; Alvarez-Leite, J.I. Butyrate impairs atherogenesis by reducing plaque inflammation and vulnerability and decreasing NFκB activation. Nutr. Metab. Cardiovasc. Dis. 2014, 24, 606–613. [Google Scholar] [CrossRef]
  12. He, B.; Wang, M.; Guo, H.; Jia, Y.; Yang, X.; Zhao, R. Effects of sodium butyrate supplementation on reproductive performance and colostrum composition in gilts. Animal 2016, 10, 1722–1727. [Google Scholar] [CrossRef] [PubMed]
  13. Feng, W.; Wu, Y.; Chen, G.; Fu, S.; Li, B.; Huang, B.; Wang, D.; Wang, W.; Liu, J. Sodium Butyrate Attenuates Diarrhea in Weaned Piglets and Promotes Tight Junction Protein Expression in Colon in a GPR109A-Dependent Manner. Cell. Physiol. Biochem. 2018, 47, 1617–1629. [Google Scholar] [CrossRef]
  14. Jackman, J.A.; Boyd, R.D.; Elrod, C.C. Medium-chain fatty acids and monoglycerides as feed additives for pig production: Towards gut health improvement and feed pathogen mitigation. J. Anim. Sci. Biotechnol. 2020, 11, 44. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. López-Colom, P.; Castillejos, L.; Rodríguez-Sorrento, A.; Puyalto, M.; Mallo, J.J.; Martín-Orúe, S.M. Efficacy of medium-chain fatty acid salts distilled from coconut oil against two enteric pathogen challenges in weanling piglets. J. Anim. Sci. Biotechnol. 2019, 10, 89. [Google Scholar] [CrossRef]
  16. Tanghe, S.; Missotten, J.; Raes, K.; De Smet, S. The effect of different concentrations of linseed oil or fish oil in the maternal diet on the fatty acid composition and oxidative status of sows and piglets. J. Anim. Physiol. Anim. Nutr. 2015, 99, 938–949. [Google Scholar] [CrossRef] [PubMed]
  17. Mateo, R.D.; Carroll, J.A.; Hyun, Y.; Smith, S.; Kim, S.W. Effect of dietary supplementation of n-3 fatty acids and elevated concentrations of dietary protein on the performance of sows. J. Anim. Sci. 2009, 87, 948–959. [Google Scholar] [CrossRef] [PubMed]
  18. Smit, M.N.; Spencer, J.D.; Patterson, J.L.; Dyck, M.K.; Dixon, W.T.; Foxcroft, G.R. Effects of dietary enrichment with a marine oil-based n-3 LCPUFA supplement in sows with predicted birth weight phenotypes on growth performance and carcass quality of offspring. Animal 2015, 9, 838–846. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  19. Sun, W.; Sun, J.; Li, M.; Xu, Q.; Zhang, X.; Tang, Z.; Chen, J.; Zhen, J.; Sun, Z. The effects of dietary sodium butyrate supplementation on the growth performance, carcass traits and intestinal microbiota of growing-finishing pigs. J. Appl. Microbiol. 2020, 128, 1613–1623. [Google Scholar] [CrossRef] [PubMed]
  20. Chen, J.; Xu, Q.; Li, Y.; Tang, Z.; Sun, W.; Zhang, X.; Sun, J.; Sun, Z. Comparative effects of dietary supplementations with sodium butyrate, medium-chain fatty acids, and n-3 polyunsaturated fatty acids in late pregnancy and lactation on the reproductive performance of sows and growth performance of suckling piglets. J. Anim. Sci. 2019, 97, 4256–4267. [Google Scholar] [CrossRef]
  21. NRC. Nutrient Requirements of Swine, 11th ed.; National Academies Press: Washington, DC, USA, 2012. [Google Scholar]
  22. AOAC. Official Methods of Analysis, 17th ed.; Association of Official Analytical Chemists: Gaithersburg, MD, USA, 2000. [Google Scholar]
  23. Wu, Y.; Jiang, Z.; Zheng, C.; Wang, L.; Zhu, C.; Yang, X.; Wen, X.; Ma, X. Effects of protein sources and levels in antibiotic-free diets on diarrhea, intestinal morphology, and expression of tight junctions in weaned piglets. Anim. Nutr. 2015, 1, 170–176. [Google Scholar] [CrossRef] [PubMed]
  24. Dell’Anno, M.; Callegari, M.L.; Reggi, S.; Caprarulo, V.; Giromini, C.; Spalletta, A.; Coranelli, S.; Sgoifo Rossi, C.A.; Rossi, L. Lactobacillus plantarum and Lactobacillus reuteri as Functional Feed Additives to Prevent Diarrhoea in Weaned Piglets. Animals 2021, 11, 1766. [Google Scholar] [CrossRef]
  25. Geervliet, M.; de Vries, H.; Jansen, C.A.; Rutten, V.P.M.G.; van Hees, H.; Wen, C.; Skovgaard, K.; Antonello, G.; Savelkoul, H.F.J.; Smidt, H.; et al. Effects of E scherichia coli Nissle 1917 on the Porcine Gut Microbiota, Intestinal Epithelium and Immune System in Early Life. Front. Microbiol. 2022, 13, 842437. [Google Scholar] [CrossRef] [PubMed]
  26. Jin, C.; Fang, Z.; Lin, Y.; Che, L.; Wu, C.; Xu, S.; Feng, B.; Li, J.; Wu, D. Influence of dietary fat source on sow and litter performance, colostrum and milk fatty acid profile in late gestation and lactation. Anim. Sci. J. 2017, 88, 1768–1778. [Google Scholar] [CrossRef] [PubMed]
  27. Gebhardt, J.T.; Thomson, K.A.; Woodworth, J.C.; Dritz, S.S.; Tokach, M.D.; DeRouchey, J.M.; Goodband, R.D.; Jones, C.K.; Cochrane, R.A.; Niederwerder, M.C.; et al. Effect of dietary medium-chain fatty acids on nursery pig growth performance, fecal microbial composition, and mitigation properties against porcine epidemic diarrhea virus following storage. J. Anim. Sci. 2020, 98, skz358. [Google Scholar] [CrossRef] [PubMed]
  28. Świątkiewicz, M.; Hanczakowska, E.; Okoń, K.; Kowalczyk, P.; Grela, E.R. Effect of Maternal Diet and Medium Chain Fatty Acids Supplementation for Piglets on Their Digestive Tract Development, Structure, and Chyme Acidity as Well as Performance and Health Status. Animals 2020, 10, 834. [Google Scholar] [CrossRef]
  29. Guilloteau, P.; Martin, L.; Eeckhaut, V.; Ducatelle, R.; Zabielski, R.; Van Immerseel, F. From the gut to the peripheral tissues: The multiple effects of butyrate. Nutr. Res. Rev. 2010, 23, 366–384. [Google Scholar] [CrossRef] [Green Version]
  30. Hanczakowska, E.; Szewczyk, A.; Swiatkiewicz, M.; Okoń, K. Short- and medium-chain fatty acids as a feed supplement for weaning and nursery pigs. Pol. J. Vet. Sci. 2013, 16, 647–654. [Google Scholar] [CrossRef]
  31. Smit, M.N.; Patterson, J.L.; Webel, S.K.; Spencer, J.D.; Cameron, A.C.; Dyck, M.K.; Dixon, W.T.; Foxcroft, G.R. Responses to n-3 fatty acid (LCPUFA) supplementation of gestating gilts, and lactating and weaned sows. Animal 2013, 7, 784–792. [Google Scholar] [CrossRef] [Green Version]
  32. Osek, J. Prevalence of virulence factors of Escherichia coli strains isolated from diarrheic and healthy piglets after weaning. Vet. Microbiol. 1999, 68, 209–217. [Google Scholar] [CrossRef]
  33. Lerner, A.B.; Cochrane, R.A.; Gebhardt, J.T.; Dritz, S.S.; Jones, C.K.; DeRouchey, J.M.; Tokach, M.D.; Goodband, R.D.; Bai, J.; Porter, E.; et al. Effects of medium chain fatty acids as a mitigation or prevention strategy against porcine epidemic diarrhea virus in swine feed. J. Anim. Sci. 2020, 98, skaa159. [Google Scholar] [CrossRef] [PubMed]
  34. De Quelen, F.; Chevalier, J.; Rolli-Derkinderen, M.; Mourot, J.; Neunlist, M.; Boudry, G. n-3 polyunsaturated fatty acids in the maternal diet modify the postnatal development of nervous regulation of intestinal permeability in piglets. J. Physiol. 2011, 589, 4341–4352. [Google Scholar] [CrossRef] [Green Version]
  35. Lauridsen, C. Effects of dietary fatty acids on gut health and function of pigs pre- and post-weaning. J. Anim. Sci. 2020, 98, skaa086. [Google Scholar] [CrossRef] [PubMed]
  36. Li, S.; Zheng, J.; Deng, K.; Chen, L.; Zhao, X.L.; Jiang, X.M.; Fang, Z.F.; Che, L.Q.; Xu, S.Y.; Feng, B.; et al. Supplementation with organic acids showing different effects on growth performance, gut morphology and microbiota of weaned pigs fed with highly or less digestible diets. J. Anim. Sci. 2018, 96, 3302–3318. [Google Scholar] [CrossRef] [Green Version]
  37. Gourley, K.M.; Swanson, A.J.; DeRouchey, J.M.; Tokach, M.D.; Dritz, S.S.; Goodband, R.D.; Woodworth, J.C. Effects of increased lysine and energy feeding duration prior to parturition on sow and litter performance, piglet survival, and colostrum quality. J. Anim. Sci. 2020, 98, skaa105. [Google Scholar] [CrossRef] [PubMed]
  38. Atwood, C.S.; Hartmann, P.E. Collection of fore and hind milk from the sow and the changes in milk composition during suckling. J. Dairy Res. 1992, 59, 287–298. [Google Scholar] [CrossRef] [PubMed]
  39. Tilton, S.L.; Miller, P.S.; Lewis, A.J.; Reese, D.E.; Ermer, P.M. Addition of fat to the diets of lactating sows: I. Effects on milk production and composition and carcass composition of the litter at weaning. J. Anim. Sci. 1999, 77, 2491–2500. [Google Scholar] [CrossRef]
  40. Shen, Y.; Wan, H.; Zhu, J.; Fang, Z.; Che, L.; Xu, S.; Lin, Y.; Li, J.; Wu, D. Fish Oil and Olive Oil Supplementation in Late Pregnancy and Lactation Differentially Affect Oxidative Stress and Inflammation in Sows and Piglets. Lipids 2015, 50, 647–658. [Google Scholar] [CrossRef]
  41. Yu, S.; Ren, E.; Xu, J.; Su, Y.; Zhu, W. Effects of early intervention with sodium butyrate on lipid metabolism-related gene expression and liver metabolite profiles in neonatal piglets. Livest. Sci. 2017, 195, 80–86. [Google Scholar] [CrossRef]
  42. Yeh, J.-H.; Tung, Y.-T.; Yeh, Y.-S.; Chien, Y.-W. Effects of Dietary Fatty Acid Composition on Lipid Metabolism and Body Fat Accumulation in Ovariectomized Rats. Nutrients 2021, 13, 2022. [Google Scholar] [CrossRef]
  43. Schoeler, M.; Caesar, R. Dietary lipids, gut microbiota and lipid metabolism. Rev. Endocr. Metab. Disord. 2019, 20, 461–472. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Am, M.; Jd, F.; Co, M.; Fm, S. Dietary unsaturated fat increases HDL metabolic pathways involving apoE favorable to reverse cholesterol transport. JCI Insight 2019, 4, e124620. [Google Scholar] [CrossRef] [Green Version]
  45. Guo, Q.; Li, F.; Duan, Y.; Wen, C.; Wang, W.; Zhang, L.; Huang, R.; Yin, Y. Oxidative stress, nutritional antioxidants and beyond. Sci. China Life Sci. 2020, 63, 866–874. [Google Scholar] [CrossRef] [PubMed]
  46. Famurewa, A.C.; Aja, P.M.; Maduagwuna, E.K.; Ekeleme-Egedigwe, C.A.; Ufebe, O.G.; Azubuike-Osu, S.O. Antioxidant and anti-inflammatory effects of virgin coconut oil supplementation abrogate acute chemotherapy oxidative nephrotoxicity induced by anticancer drug methotrexate in rats. Biomed. Pharmacother. 2017, 96, 905–911. [Google Scholar] [CrossRef]
  47. Nguyen, T.X.; Agazzi, A.; Comi, M.; Bontempo, V.; Guido, I.; Panseri, S.; Sauerwein, H.; Eckersall, P.D.; Burchmore, R.; Savoini, G. Effects of Low ω6:ω3 Ratio in Sow Diet and Seaweed Supplement in Piglet Diet on Performance, Colostrum and Milk Fatty Acid Profiles, and Oxidative Status. Animals 2020, 10, 2049. [Google Scholar] [CrossRef]
  48. Li, Y.; Zhang, H.; Yang, L.; Zhang, L.; Wang, T. Effect of medium-chain triglycerides on growth performance, nutrient digestibility, plasma metabolites and antioxidant capacity in weanling pigs. Anim. Nutr. 2015, 1, 12–18. [Google Scholar] [CrossRef] [PubMed]
  49. Van Gossum, A.; Shariff, R.; Lemoyne, M.; Kurian, R.; Jeejeebhoy, K. Increased lipid peroxidation after lipid infusion as measured by breath pentane output. Am. J. Clin. Nutr. 1988, 48, 1394–1399. [Google Scholar] [CrossRef]
  50. Reyes-Camacho, D.; Vinyeta, E.; Pérez, J.F.; Aumiller, T.; Criado, L.; Palade, L.M.; Taranu, I.; Folch, J.M.; Calvo, M.A.; Van der Klis, J.D.; et al. Phytogenic actives supplemented in hyperprolific sows: Effects on maternal transfer of phytogenic compounds, colostrum and milk features, performance and antioxidant status of sows and their offspring, and piglet intestinal gene expression. J. Anim. Sci. 2020, 98, skz390. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  51. Anderson, J.M.; Van Itallie, C.M. Physiology and Function of the Tight Junction. Cold Spring Harb. Perspect. Biol. 2009, 1, a002584. [Google Scholar] [CrossRef]
  52. De Keyser, K.; Dierick, N.; Kanto, U.; Hongsapak, T.; Buyens, G.; Kuterna, L.; Vanderbeke, E. Medium-chain glycerides affect gut morphology, immune- and goblet cells in post-weaning piglets: In vitro fatty acid screening with Escherichia coli and in vivo consolidation with LPS challenge. J. Anim. Physiol. Anim. Nutr. 2019, 103, 221–230. [Google Scholar] [CrossRef] [Green Version]
  53. Zhou, H.; Sun, J.; Ge, L.; Liu, Z.; Chen, H.; Yu, B.; Chen, D. Exogenous infusion of short-chain fatty acids can improve intestinal functions independently of the gut microbiota. J. Anim. Sci. 2020, 98, skaa371. [Google Scholar] [CrossRef]
  54. Carlson, S.; Nandivada, P.; Chang, M.; Mitchell, P.; O’Loughlin, A.; Cowan, E.; Gura, K.; Nose, V.; Bistrian, B.; Puder, M. The Addition of Medium-Chain Triglycerides to a Purified Fish Oil Based Diet Alters Inflammatory Profiles in Mice. Metabolism 2015, 64, 274–282. [Google Scholar] [CrossRef] [Green Version]
  55. Kuang, Y.; Wang, Y.; Zhang, Y.; Song, Y.; Zhang, X.; Lin, Y.; Che, L.; Xu, S.; Wu, D.; Xue, B.; et al. Effects of dietary combinations of organic acids and medium chain fatty acids as a replacement of zinc oxide on growth, digestibility and immunity of weaned pigs. Anim. Feed Sci. Technol. 2015, 208, 145–157. [Google Scholar] [CrossRef]
  56. Tian, L.; Zhou, X.-Q.; Jiang, W.-D.; Liu, Y.; Wu, P.; Jiang, J.; Kuang, S.-Y.; Tang, L.; Tang, W.-N.; Zhang, Y.-A.; et al. Sodium butyrate improved intestinal immune function associated with NF-κB and p38MAPK signalling pathways in young grass carp (Ctenopharyngodon idella). Fish Shellfish. Immunol. 2017, 66, 548–563. [Google Scholar] [CrossRef] [PubMed]
  57. Luo, W.; Xu, W.; Zhang, J.; Yao, J.; Xu, J. The Maternal Diet with Fish Oil Might Decrease the Oxidative Stress and Inflammatory Response in Sows, but Increase the Susceptibility to Inflammatory Stimulation in their Offspring. Animals 2020, 10, 1455. [Google Scholar] [CrossRef]
  58. Kono, H.; Fujii, H.; Asakawa, M.; Maki, A.; Amemiya, H.; Hirai, Y.; Matsuda, M.; Yamamoto, M. Medium-chain triglycerides enhance secretory IgA expression in rat intestine after administration of endotoxin. Am. J. Physiol. Gastrointest. Liver Physiol. 2004, 286, G1081–G1089. [Google Scholar] [CrossRef] [Green Version]
  59. Zhao, L.; Li, M.; Sun, K.; Su, S.; Geng, T.; Sun, H. Hippophae rhamnoides polysaccharides protect IPEC-J2 cells from LPS-induced inflammation, apoptosis and barrier dysfunction in vitro via inhibiting TLR4/NF-κB signaling pathway. Int. J. Biol. Macromol. 2020, 155, 1202–1215. [Google Scholar] [CrossRef]
  60. Zughaier, S.M.; Zimmer, S.M.; Datta, A.; Carlson, R.W.; Stephens, D.S. Differential Induction of the Toll-Like Receptor 4-MyD88-Dependent and -Independent Signaling Pathways by Endotoxins. Infect. Immun. 2005, 73, 2940–2950. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  61. Richards, J.D.; Gong, J.; de Lange, C.F.M. The gastrointestinal microbiota and its role in monogastric nutrition and health with an emphasis on pigs: Current understanding, possible modulations, and new technologies for ecological studies. Can. J. Anim. Sci. 2005, 85, 421–435. [Google Scholar] [CrossRef]
  62. Feng, J.; Wang, L.; Chen, Y.; Xiong, Y.; Wu, Q.; Jiang, Z.; Yi, H. Effects of niacin on intestinal immunity, microbial community and intestinal barrier in weaned piglets during starvation. Int. Immunopharmacol. 2021, 95, 107584. [Google Scholar] [CrossRef]
  63. Krogius-Kurikka, L.; Lyra, A.; Malinen, E.; Aarnikunnas, J.; Tuimala, J.; Paulin, L.; Mäkivuokko, H.; Kajander, K.; Palva, A. Microbial community analysis reveals high level phylogenetic alterations in the overall gastrointestinal microbiota of diarrhoea-predominant irritable bowel syndrome sufferers. BMC Gastroenterol. 2009, 9, 95. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. Alessi, A.M.; Gray, V.; Farquharson, F.M.; Flores-López, A.; Shaw, S.; Stead, D.; Wegmann, U.; Shearman, C.; Gasson, M.; Collie-Duguid, E.S.R.; et al. β-Glucan is a major growth substrate for human gut bacteria related to Coprococcus eutactus. Environ. Microbiol. 2020, 22, 2150–2164. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Flint, H.J.; Scott, K.P.; Louis, P.; Duncan, S.H. The role of the gut microbiota in nutrition and health. Nat. Rev. Gastroenterol. Hepatol. 2012, 9, 577–589. [Google Scholar] [CrossRef] [PubMed]
  66. Fagundes, R.R.; Bourgonje, A.R.; Saeed, A.; Vich Vila, A.; Plomp, N.; Blokzijl, T.; Sadaghian Sadabad, M.; von Martels, J.Z.; van Leeuwen, S.S.; Weersma, R.K. Inulin-grown Faecalibacterium prausnitzii cross-feeds fructose to the human intestinal epithelium. Gut Microbes 2021, 13, 1993582. [Google Scholar] [CrossRef]
  67. Brahe, L.K.; Astrup, A.; Larsen, L.H. Is butyrate the link between diet, intestinal microbiota and obesity-related metabolic diseases? Obes. Rev. 2013, 14, 950–959. [Google Scholar] [CrossRef]
  68. Ren, W.; Yan, H.; Yu, B.; Walsh, M.C.; Yu, J.; Zheng, P.; Huang, Z.; Luo, J.; Mao, X.; He, J.; et al. Prevotella-rich enterotype may benefit gut health in finishing pigs fed diet with a high amylose-to-amylopectin ratio. Anim. Nutr. 2021, 7, 400–411. [Google Scholar] [CrossRef]
  69. Bekele, A.Z.; Koike, S.; Kobayashi, Y. Genetic diversity and diet specificity of ruminal Prevotella revealed by 16S rRNA gene-based analysis. FEMS Microbiol. Lett. 2010, 305, 49–57. [Google Scholar] [CrossRef]
Animals 13 01093 g001 550
Figure 1. Effects of supplementing the diets with different combinations of SB, MCFAs, and omega−3 PUFA on the intestinal morphology in suckling piglets. Intestinal morphology of the jejunum was shown (A) among the five groups. Villous height (B), crypt depth (C), and villus height/crypt depth (D) in the jejunum (shooting magnification of 400×). Data are presented as means ± SEM (n = 6). a–d Values within a row with different superscripts differ significantly at p < 0.05.
Figure 1. Effects of supplementing the diets with different combinations of SB, MCFAs, and omega−3 PUFA on the intestinal morphology in suckling piglets. Intestinal morphology of the jejunum was shown (A) among the five groups. Villous height (B), crypt depth (C), and villus height/crypt depth (D) in the jejunum (shooting magnification of 400×). Data are presented as means ± SEM (n = 6). a–d Values within a row with different superscripts differ significantly at p < 0.05.
Animals 13 01093 g001
Animals 13 01093 g002 550
Figure 2. Effects of supplementing the diets with different combinations of SB, MCFAs, and omega−3 PUFA on the tight junction proteins and inflammatory cytokines in the jejunal mucosa of suckling piglets. The relative expression of Claudin-1, ZO-1, Occludin, IL-1β, IL-6, IL-10, TNF-α, TLR-4, MγD88, and NF-κB mRNA in the jejunal mucosa (A–C) were determined via real-time PCR. Data are expressed as the means ± SEM (n = 6). a–c Values within a row with different superscripts differ significantly at p < 0.05.
Figure 2. Effects of supplementing the diets with different combinations of SB, MCFAs, and omega−3 PUFA on the tight junction proteins and inflammatory cytokines in the jejunal mucosa of suckling piglets. The relative expression of Claudin-1, ZO-1, Occludin, IL-1β, IL-6, IL-10, TNF-α, TLR-4, MγD88, and NF-κB mRNA in the jejunal mucosa (A–C) were determined via real-time PCR. Data are expressed as the means ± SEM (n = 6). a–c Values within a row with different superscripts differ significantly at p < 0.05.
Animals 13 01093 g002
Animals 13 01093 g003 550
Figure 3. Effects of supplementing the diets with different combinations of SB, MCFAs, and omega−3 PUFA on microbial counts in the colonic digesta of suckling piglets. (A) Venn diagram shows the common and special OTUs distribution among the five groups. (B) Alpha diversity of the colonic digesta. (C) Nonmetric Multidimensional Scaling analysis (NMDS) on genus level based on UniFrac distances. The relative abundance of colonic microbiota at the phylum level (D) and the genus level (E). (F) The LEfSe analysis screened biomarkers of the microbial community. Data are expressed as the means ± SEM (n = 4). Note the 0, 4, 5, 6, and 7 groups in the legends indicate the CON, SM, SP, MP, and SMP groups, respectively.
Figure 3. Effects of supplementing the diets with different combinations of SB, MCFAs, and omega−3 PUFA on microbial counts in the colonic digesta of suckling piglets. (A) Venn diagram shows the common and special OTUs distribution among the five groups. (B) Alpha diversity of the colonic digesta. (C) Nonmetric Multidimensional Scaling analysis (NMDS) on genus level based on UniFrac distances. The relative abundance of colonic microbiota at the phylum level (D) and the genus level (E). (F) The LEfSe analysis screened biomarkers of the microbial community. Data are expressed as the means ± SEM (n = 4). Note the 0, 4, 5, 6, and 7 groups in the legends indicate the CON, SM, SP, MP, and SMP groups, respectively.
Animals 13 01093 g003
Animals 13 01093 g004 550
Figure 4. Effects of supplementing the diets with different combinations of SB, MCFAs, and omega−3 PUFA on specific bacteria in the colonic digesta of suckling piglets. Data are expressed as the means ± SEM (n = 4). a–c Values within a row with different superscripts differ significantly at p < 0.05. (A,B) Significantly different species of the colonic digesta at the phylum level. (C–H) Significantly different species of the colonic digesta at the genus level.
Figure 4. Effects of supplementing the diets with different combinations of SB, MCFAs, and omega−3 PUFA on specific bacteria in the colonic digesta of suckling piglets. Data are expressed as the means ± SEM (n = 4). a–c Values within a row with different superscripts differ significantly at p < 0.05. (A,B) Significantly different species of the colonic digesta at the phylum level. (C–H) Significantly different species of the colonic digesta at the genus level.
Animals 13 01093 g004
Table
Table 1. The formulations and chemical composition of the basal diet (as-fed basis).
Table 1. The formulations and chemical composition of the basal diet (as-fed basis).
ItemsStages
Late GestationLactation
Ingredients%%
Corn50.0447.65
Barley17.4018.00
Soybean meal17.2019.00
Expanded soybean6.006.00
Soybean oil2.702.70
Fish meal2.002.00
Limestone1.601.60
CaHPO41.401.40
NaCl0.400.40
Lys0.260.25
Premix 11.001.00
Total100.00100.00
Composition
DE 2, Mcal/kg3.393.42
CP 3, %15.4015.90
EE 3, %5.005.10
Ash 3, %5.805.90
CF 3, %3.903.50
Ca 3, %1.071.20
Total P 3, %0.630.74
Available P 3, %0.500.59
Lys 2, %1.141.17
1 The premix provided the following per kilogram of the diet: Cu 5 mg, I 0.15 mg, Fe 83 mg, Mn 20 mg Zn 128 mg, VA 13,400 IU, VD3 2800 IU, choline chloride 1000 mg, VE 22.4 mg, VK3 3 mg. The premix provided the following per kilogram of the diet for Lactation: Cu 15 mg, I 0.13 mg, Fe 82 mg, Mn 20 mg, Zn 128 mg, VA 10,000 IU, VD3 2000 IU, VE 30 mg, and VK3 1.5 mg. 2 DE and the levels of Lys are calculated values and others are measured values. DE and the levels of Lys were calculated according to NRC (2012) [21]. 3 Analyzed according to the procedures followed by standard AOAC (2000).
Table
Table 2. Primers for real-time PCR analysis.
Table 2. Primers for real-time PCR analysis.
GeneAccession
Number		Sequence (5′-3′)Size (bp)Tm Value
ZO-1XM 003353439.1Forward: GAGGATGGTCACACCGTGGT16956 °C
Reverse: GGAGGATGCTGTTGTCTCGG
OCLNNM 001163647.2Forward: TGGGTTAAAAACGTGTCGGC10560 °C
Reverse: CACTTTCCCGTTGGACGAGT
CLDN 1NM 001161635.1Forward: ACCCCAGTCAATGCCAGATA15554 °C
Reverse: GGCGAAGGTTTTGGATAGG
IL-1βNM 9405217038Forward: CAAGGAAGTGATGGCTAA16556 °C
Reverse: ACCAAGGTCCAGGTTTT
IL-6NM 9405217033Forward: TCAGTCCAGTCGCCTTCT14661 °C
Reverse: CCTTTGGCATCTTCTTCC
IL-10NM 214041.1Forward: CACTGCTCTATTGCCTGATCTC13658 °C
Reverse: AAACTCTTCACTGGGCCGAAG
MyD88AB292176.1Forward: GATGGTAGCGGTTGTCTCTGAT14860 °C
Reverse: GATGCTGGGGAACTCTTTCTTC
TNF-αNM 214022.1Forward: CCACGCTCTTCTGCCTACTGC16855 °C
Reverse: GCTGTCCCTCGGCTTTGAC
NF-κBEU399817.1Forward: CAGCCCTATCCCTTTACG13360 °C
Reverse: GCCACAGCCTGAGCAA
TLR4NM_001113039Forward: CATACAGAGCCGATGGTG11360 °C
Reverse: CCTGCTGAGAAGGCGATA
GADPHAF017079.1Forward: ACATCAAGAAGGTGGTGAAG17860 °C
Reverse: ATTGTCGTACCAGGAAATGAG
Abbreviations: ZO-1, zonula occludens-1; TLR4, toll-like receptor 4; MγD88, myeloid differentiation factor 88; NF-κB p65, nuclear factor-kappa B p65; TNF-α, tumor necrosis factor; IL-6, interleukin-6; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Table
Table 3. Effects of supplementing the diets with different combinations of SB, MCFAs, and omega−3 PUFA on the reproductive performance of sows and the growth performance of their piglets.
Table 3. Effects of supplementing the diets with different combinations of SB, MCFAs, and omega−3 PUFA on the reproductive performance of sows and the growth performance of their piglets.
ItemTreatments 1SEMp-Value
CONSMSPMPSMP
Reproductive performance of sows
ADFI lactation, kg/d6.46 c7.32 a6.96 bc6.37 c7.35 a0.21<0.010
Total born14.214.213.213.614.21.800.360
Born alive13.413.412.412.212.81.020.210
Stillborn0.800.800.801.401.400.540.821
Born alive rate, %94.294.194.390.390.63.640.802
Initial BW, kg1.441.301.571.531.520.070.074
Litter birth weight, kg20.420.620.820.721.41.430.991
WEI, d6.60 ab7.80 a5.20 b4.60 b4.00 b0.69<0.010
Growth performance of piglets
Survival rate, %82.090.784.790.088.42.580.131
final BW, kg5.36 c5.64 bc6.05 ab5.71 bc6.48 a1.33<0.010
ADG, g/d186 b207 ab213 ab199 b236 a8.33<0.010
Diarrhea incidence, %20.6 a14.7 b14.6 b17.6 ab13.8 b1.47<0.010
1 CON, a basal diet; SM, the basal diet plus a blend of 1 g/kg SB and 7.75 g/kg MCFAs; SP, the basal diet plus a blend of 1 g/kg SB and 68.2 g/kg n-3 PUFA; MP, the basal diet plus a blend of 7.75 g/kg MCFA and 68.2 g/kg n-3 PUFA; SMP, the basal diet plus a blend of 1 g/kg SB, 7.75 g/kg MCFA, and 68.2 g/kg n-3 PUFA. Data are presented as means ± SEM (n = 6). a–c Values within a row with different superscripts differ significantly at p < 0.05.
Table
Table 4. Effects of supplementing the diets with different combinations of SB, MCFAs, and omega−3 PUFA on the colostrum composition of sows.
Table 4. Effects of supplementing the diets with different combinations of SB, MCFAs, and omega−3 PUFA on the colostrum composition of sows.
ItemTreatments 1SEMp-Value
CONSMSPMPSMP
Fat, %3.67 b5.18 a5.08 a6.25 a4.92 a0.20<0.010
Protein, %12.3 c18.3 a16.4 ab16.6 ab14.9 b0.79<0.010
Lactose, %2.89 c3.19 bc3.69 a3.84 a3.25 bc0.16<0.010
SNF, %23.1 b27.7 a23.7 b28.3 a21.9 b1.18<0.010
IgA, μg/mL5.80 c9.04 ab9.43 ab7.16 bc9.98 a0.62<0.010
IgG, μg/mL45.1 b66.8 a62.5 a68.6 a71.5 a4.57<0.010
IgM, μg/mL45.1 b56.3 a64.0 a46.7 b60.6 a2.67<0.010
1 CON, a basal diet; SM, the basal diet plus a blend of 1 g/kg SB and 7.75 g/kg MCFAs; SP, the basal diet plus a blend of 1 g/kg SB and 68.2 g/kg n-3 PUFA; MP, the basal diet plus a blend of 7.75 g/kg MCFAs and 68.2 g/kg n-3 PUFA; SMP, the basal diet plus a blend of 1 g/kg SB, 7.75 g/kg MCFAs, and 68.2 g/kg n-3 PUFA. Data are presented as means ± SEM (n = 6). a–c Values within a row with different superscripts differ significantly at p < 0.05. Abbreviations: SNF, solids nonfat; IgA, immunoglobulin A; IgG, immunoglobulin G; IgM, immunoglobulin M.
Table
Table 5. Effects of supplementing the diets with different combinations of SB, MCFAs, and omega−3 PUFA on the plasma biochemical index of suckling piglets.
Table 5. Effects of supplementing the diets with different combinations of SB, MCFAs, and omega−3 PUFA on the plasma biochemical index of suckling piglets.
ItemTreatments 1SEMp-Value
CONSMSPMPSMP
TP, g/L56.1 c64.1 b72.6 a67.3 b71.8 a1.17<0.010
Albumin, g/L22.8 b21.7 b22.2 b30.0 a20.6 b0.78<0.010
Globulin, g/L33.2 c42.4 b50.4 a37.3 c51.2 a1.39<0.010
Albumin/globulin0.70 b0.52 c0.44 c0.81 a0.40 c0.04<0.010
BUN, mmol/L2.20 c2.88 ab3.28 a3.10 ab2.74 b0.14<0.010
TG, mmol/L0.64 b0.46 c0.67 a0.49 c0.46 c0.03<0.010
FFA, μmol/L200 b752 a869 a845 a887 a34.9<0.010
TC, mmol/L4.22 a2.07 bc3.94 a2.55 bc3.13 b0.26<0.010
HDL, mmol/L1.14 c2.02 a1.54 b1.75 ab1.58 b0.09<0.010
IgA, μg/mL8.85 b13.7 a10.7 b10.3 b10.1 b0.52<0.010
IgG, μg/mL43.5 c89.6 a91.2 a53.4 b64.0 b3.48<0.010
IgM, μg/mL84.771.973.385.688.44.300.062
1 CON, a basal diet; SM, the basal diet plus a blend of 1 g/kg SB and 7.75 g/kg MCFAs; SP, the basal diet plus a blend of 1 g/kg SB and 68.2 g/kg n-3 PUFA; MP, the basal diet plus a blend of 7.75 g/kg MCFAs and 68.2 g/kg n-3 PUFA; SMP, the basal diet plus a blend of 1 g/kg SB, 7.75 g/kg MCFAs, and 68.2 g/kg n-3 PUFA. Data are presented as means ± SEM (n = 6). a–c Values within a row with different superscripts differ significantly at p < 0.05. Abbreviations: TP, total protein; TG, triglycerides; BUN, blood urea nitrogen; TC, total cholesterol; HDL, high-density lipoprotein; FFA, free fatty acid.
Table
Table 6. Effects of supplementing the diets with different combinations of SB, MCFAs, and omega−3 PUFA on antioxidant capacity in the plasma of suckling piglets.
Table 6. Effects of supplementing the diets with different combinations of SB, MCFAs, and omega−3 PUFA on antioxidant capacity in the plasma of suckling piglets.
ItemTreatments 1SEMp-Value
CONSMSPMPSMP
T-AOC, U/mL4.50 c5.76 b14.6 a12.0 a11.2 a0.14<0.010
T-SOD, U/mL96.6 b101 a104 a102 a107 a1.58<0.010
CAT, U/mL5.73 c10.7 a6.53 b8.31 b5.26 c0.24<0.010
GSH-Px, umol/L321 c584 b623 a659 a498 c12.4<0.010
MDA, nmol/mL2.81 b2.75 b3.01 b3.44 a2.96 b0.07<0.010
1 CON, a basal diet; SM, the basal diet plus a blend of 1 g/kg SB and 7.75 g/kg MCFAs; SP, the basal diet plus a blend of 1 g/kg SB and 68.2 g/kg n-3 PUFA; MP, the basal diet plus a blend of 7.75 g/kg MCFAs and 68.2 g/kg n-3 PUFA; SMP, the basal diet plus a blend of 1 g/kg SB, 7.75 g/kg MCFAs, and 68.2 g/kg n-3 PUFA. Data are presented as mean ± SEM (n = 6). a–c Values within a row with different superscripts differ significantly at p < 0.05. Abbreviations: T-AOC, total antioxidant capacity; T-SOD, total superoxide dismutase; CAT, catalase; GSH-Px, glutathione peroxidase; MDA, malondialdehyde.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

You, C.; Xu, Q.; Chen, J.; Xu, Y.; Pang, J.; Peng, X.; Tang, Z.; Sun, W.; Sun, Z. Effects of Different Combinations of Sodium Butyrate, Medium-Chain Fatty Acids and Omega-3 Polyunsaturated Fatty Acids on the Reproductive Performance of Sows and Biochemical Parameters, Oxidative Status and Intestinal Health of Their Offspring. Animals 2023, 13, 1093. https://doi.org/10.3390/ani13061093

AMA Style

You C, Xu Q, Chen J, Xu Y, Pang J, Peng X, Tang Z, Sun W, Sun Z. Effects of Different Combinations of Sodium Butyrate, Medium-Chain Fatty Acids and Omega-3 Polyunsaturated Fatty Acids on the Reproductive Performance of Sows and Biochemical Parameters, Oxidative Status and Intestinal Health of Their Offspring. Animals. 2023; 13(6):1093. https://doi.org/10.3390/ani13061093

Chicago/Turabian Style

You, Caiyun, Qingqing Xu, Jinchao Chen, Yetong Xu, Jiaman Pang, Xie Peng, Zhiru Tang, Weizhong Sun, and Zhihong Sun. 2023. "Effects of Different Combinations of Sodium Butyrate, Medium-Chain Fatty Acids and Omega-3 Polyunsaturated Fatty Acids on the Reproductive Performance of Sows and Biochemical Parameters, Oxidative Status and Intestinal Health of Their Offspring" Animals 13, no. 6: 1093. https://doi.org/10.3390/ani13061093

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop